Geração de Integração-livres induzidas células-tronco pluripotentes a partir de células mononucleares de sangue periférico humano Usando episs�ica Vectors

JoVE Journal
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Induzidas células-tronco pluripotentes (iPSCs) são uma grande promessa para a modelagem de doenças e terapias regenerativas. Nós anteriormente relatada a utilização de vectores epissomais (EV) para gerar iPSCs livre de integração a partir de células mononucleares do sangue periférico (SP MNCs). Os vectores epissómicos são utilizados plasmídeos de ADN incorporados com OriP e EBNA1 elementos do vírus de Epstein-Barr (EB), que permitem a replicação e a longo prazo retainment de plasmídeos em células de mamífero, respectivamente. Com uma maior optimização, milhares de colónias IPSC pode ser obtido a partir de 1 ml de sangue periférico. Dois factores essenciais para alcançar altas eficiências de reprogramação são: 1) o uso de um 2A "auto-clivagem" péptido de ligação OCT4 e SOX2, conseguindo-se assim a expressão equimolar dos dois factores; 2) o uso de dois vectores para expressar MYC e KLF4 individualmente. Aqui nós descrevemos um protocolo passo-a-passo para a geração de iP livre de integraçãoSCs de amostras de sangue periférico de adultos. As iPSCs gerados são livres de integração como plasmídeos episs�icas residuais são indetectáveis ​​após cinco passagens. Embora a eficiência reprogramação é comparável com a do vírus Sendai (VS) vectores, plasmídeos EV são consideravelmente mais económica do que os vectores comercialmente disponíveis SV. Este sistema EV reprogramação acessível tem potencial para aplicações clínicas em medicina regenerativa e fornece uma abordagem para a reprogramação direta de multinacionais PB para as células sem integração-tronco mesenquimais, células-tronco neurais, etc.

Introduction

Após expressão forçada de vários factores de transcrição (Ie OCT4, SOX2, MYC e KLF4), células somáticas podem ser reprogramadas para células-tronco pluripotentes induzidas (iPSCs), que detêm grande promessa para aplicações em medicina regenerativa e terapia de reposição celular 1-3. Até à data, diversos métodos foram desenvolvidos para aumentar a taxa de sucesso de reprogramação 4-7. vectores virais induzida por reprogramação é amplamente utilizado para a produção eficiente de iPSCs, pois a integração virai conduz a um alto nível, a expressão estável dos fatores de reprogramação. No entanto, a integração permanente do ADN do vector no genoma da célula pode induzir a mutagénese de inserção 5. Além disso, a inativação insuficiente de fatores de reprogramação pode perturbar iPSCs diferenciação 8. Como tal, a utilização de iPSCs sem integração dos factores de reprogramação é imperativo, especialmente para uso em aplicações de terapia celular.

9. O elemento oriP promove a replicação do plasmídeo em células de mamíferos, enquanto que o elemento EBNA1 amarras o DNA do plasmídeo que contém oriP ao ADN cromossómico que permite a compartimentação do epissoma durante a divisão da célula hospedeira. Em comparação com outras abordagens livre de integração, incluindo vírus Sendai (SV) e transfecção RNA, EVs possuem várias vantagens 5,6,10. Como DNA plasmídeo, EVs podem ser facilmente produzida e modificada em casa, tornando-os extremamente acessível. Além disso, a reprogramação com EV é um menor processo trabalhoso já que um único transfecção com EVs é suficiente para a geração de iPSC, enquanto vários transfections RNA são necessários para a reprogramação.

Dfibroblastos ermal têm sido utilizados em vários estudos de reprogramação. No entanto, a biópsia de pele não é apenas um processo invasivo e doloroso, mas também demorado para expansão de células a quantidades suficientes para a reprogramação. De maior preocupação, as células da pele de doadores adultos frequentemente ter sido exposto à radiação de luz UV de longo prazo, o que pode conduzir a mutações associadas a tumores, o que limita as aplicações de iPSCs derivadas a partir de fibroblastos da pele 11,12. Recentemente, foi relatado que as células de pele humanas normais acumulam mutações somáticas e múltiplos genes do cancro, incluindo a maioria dos principais motores de carcinomas de células escamosas cutâneas, estão sob forte seleção positiva 13.

Em contraste com os fibroblastos da pele, células do sangue periférico (PB) são uma fonte preferida de células de reprogramação porque 1) as células de sangue podem ser facilmente obtidas através de um processo minimamente invasiva, 2) as células do sangue periférico são a progénie de células estaminais hematopoiéticasresidem na medula óssea, assim, protegido contra a radiação prejudicial. células mononucleares do sangue periférico (PB MNCs) pode ser coletado em uma hora a partir da camada de revestimento de Buffy na sequência de uma centrifugação de gradiente simples usando Ficoll-Hypaque (1.077 g / mL). As EMNs PB obtidos são compostos de linfócitos, monócitos e algumas células progenitoras hematopoiéticas (HPCs) 14. Embora os linfócitos T humanos são um dos principais tipos de células em PB, as células T maduras contêm rearranjos do receptor de células T (TCR) e os genes não têm um genoma intacto limitando assim o seu potencial para aplicações 15,16. No entanto, o rejuvenescimento das células T através da geração iPSC pode ter aplicações potenciais em quimérico Antigen Receptor (CAR) terapia com células T 17-19. Em comparação, HPCs tem um genoma intacto e estão prontamente reprogramável. Apesar de apenas 0,01-0,1% das células em circulação periférica são HPCs, estas células podem ser expandidas ex vivo, em meio de eritróide que favorece a proliferação de erythrcélulas progenitoras oid 14.

Em nosso estudo anterior, foi utilizado o fator de BCL-XL além dos fatores de Yamanaka (OCT4, SOX2, MYC e KLF4), o que resultou em um aumento de 10x na PB reprogramação efficency 20. BCL-XL, também conhecido como BCL2L1, é um inibidor potente da morte celular, por inibição da activação de caspases 21,22. Mas, a BCL-XL também podem desempenhar um papel importante na manutenção da pluripotência 21,22. Recentemente, temos aperfeiçoado ainda mais nosso sistema EV reprogramação expressando separadamente MYC e KLF4 com dois vectores, o que leva a um aumento de aproximadamente 100 vezes na eficiência da reprogramação 23. Usando este método, a eficiência de reprogramação, definido pelo número de colónias a partir dividido pelo número de células na transfecção, é 0,2-0,5% de dadores saudáveis. Como se segue, descrevemos o procedimento experimental detalhado para gerar iPSCs livre de integração de PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todas as amostras PB humanos foram obtidos de doadores adultos anônimos sem informações de identificação disponível a partir de Tianjin Hemocentro com a aprovação do comitê de ética em pesquisa local.

O plasmídeo Preparação 1. Endo-livre

  1. Use um kit Plasmid Maxi A purificação comercial para extrair os vectores epissomais de E. coli de acordo com o protocolo do fabricante. Para o passo final, tampão TE substituto com água estéril livre de endotoxinas para dissolver o sedimento de DNA.
  2. Medir a concentração de ADN utilizando um espectrofotómetro comercial de UV / Vis. A concentração é geralmente maior do que 1 mg / mL, com A260 / A280 e razões A260 / A230 maiores que 1,8 e 2,0, respectivamente.

2. Meios de Cultura

  1. Prepare forma eritróide: Haste hematopoiéticas meio celular Expansão suplementado com 100 ng / ml factor de célula estaminais humanas (SCF), 10 ng / mL de interleucina-3 (IL-3), 2 U / mL de eritropoietina (EPO), 20 ng / ml de insulina do fator de crescimento-1 (IGF-1), 1 uM de dexametasona e 0,2 mM 1-tioglicerol. Filtrar esterilizar com um filtro de seringa de 0,22? M. forma eritróide pode ser armazenado a 4 ° C durante até um mês.
  2. Prepare forma iPSC: meio DMEM / F12 (Modified Eagle Médium / Nutrient Mixture de Dulbecco F-12) suplementado com 1 x L-glutamina, 1x penicilina / estreptomicina, 1x não-essencial solução de aminoácidos, 50 ng / mL de Fibroblastos Factor de Crescimento 2 (FGF2 ), 1x suplemento de insulina-transferrina-selenite (STI), e 50 mg / ml de ácido ascórbico. Filtrar esterilizar com um filtro de seringa de 0,22? M. iPSC forma pode ser armazenado a 4 ° C durante até um mês.
  3. Prepare forma MEF: de Dulbecco Modified Eagle Médium (DMEM; glucose elevada) suplementado com 1x penicilina / estreptomicina e 10% de Soro Fetal Bovino (FBS). Filtrar esterilizar com um filtro de seringa de 0,22? M. MEF forma pode ser armazenado a 4 ° C durante até um mês ou recém adicionar 1x L-glutamina antes da utilização.
  4. Prepare forma iPSC criopreservação (2x): Dissolve-se 5 g de D-trealose, em 30 mL de água estéril num banho de água a 37 ° C. Elevar a temperatura até 4 ° C e, em seguida, adicionar 10 mL de FBS e 10 mL de dimetilsulfóxido (DMSO). Filtrar esterilizar com um filtro de seringa de 0,22? M. Armazenar a 4 ° C por até 3 meses 24.

3. Isolamento de células mononucleares do sangue periférico (PB PTM)

  1. Combinar 10 mL de amostra PB fresco e 10 mL de tampão de PBS num tubo de 50 mL e misturar bem. Traga PBS à temperatura ambiente ou 37 ° C antes de usar.
    NOTA: aproximadamente 1 - 3 x 10 6 PTM (frescas ou criopreservados) pode ser obtido a partir de 1 ml de PB. Após 6 d da cultura, espera ter 0,5 - 1 x 10 6 células totais devido à morte de células maduras durante a cultura. Aproximadamente 1 x 10 7 células podem ser obtidas a partir de 10 ml de PB fresco.
  2. Adicionar 10 ml de Ficoll para o fundo do tubo utilizando uma seringa de 10 mL ligado a uma agulha longa. este processo deve ser feita lentamente para garantir que a camada de Ficoll não se mistura com o PB.
  3. Centrifugar a 400 xg durante 30 min a uma velocidade de aceleração e de desaceleração baixo. Após centrifugação, os EMNs PB são na camada branca (buffy coat) situada entre o plasma e o Ficoll PB.
  4. Lentamente aspirado de ~ 10 mL PB plasma sem perturbar a camada de revestimento de Buffy. Cuidadosamente colher a camada de branco, utilizando uma ponta de pipeta de 1 ml para um novo tubo de 50 mL. O volume total de células colhidas a partir da camada branca será entre 3-6 ml.
  5. Adicionar PBS para perfazer um volume total de 30 mL e misturar bem com uma pipeta de 10 mL. Centrifugar a 400 xg durante 10 min.
  6. Remover o sedimento celular sobrenadante e ressuspender em 20 ml de meio de cultura (Modificado por Dulbecco ou seja, Meio de Iscove, IMDM) e misture bem. Centrifuga-se a 400 xg durante 10 min para remover a maioria das plaquetas.
  7. Remover o sobrenadante e ressuspender o sedimento de células em 1 - 2 mL de IMDM. As células podem ser usadas fou cultura imediata, ou congeladas-se para uso posterior. Para criopreservação, adicionar uma quantidade igual de meio de criopreservação. células da alíquota em criotubos (0,5 - 1 ml por frasco) e cryovials transferência para um -80 ° C congelador imediatamente. EMNs PB pode ser armazenado no congelador a -80 ° C durante várias semanas ou transferido para um tanque de azoto líquido durante a armazenagem a longo prazo.
    NOTA: Quando o descongelamento das células congeladas, embora o nosso meio de criopreservação pode sustentar a viabilidade celular, o número de células pode diminuir devido a morte celular durante o processo de descongelamento. Recomenda-se que uma - 10 x 10 7 células irão ser congeladas em cada frasco.

4. Expansão da PTM PB em eritróide Médio

  1. Prepare 5 mL de meio IMDM em um tubo de 15 mL. descongelar rapidamente as multinacionais PB congelados num banho de água C 37 ° e depois transferi-los para o tubo com o meio IMDM.
    NOTA: O comprimento de tempo no banho de água depende do volume das células criopreservadas e u cryovialsed. Normalmente, a célula irá congelado descongelar dentro de 1 min.
  2. Centrifugar a 400 xg durante 5 - 10 min. Remover o sobrenadante e ressuspender o sedimento de células em meio de eritróides. Adicionar 10 mL solução Trypan Blue a suspensão de células 10 mL e misture bem. Azul de Tripano mancha as células mortas no prazo de 1-3 min. Contar as células ao microscópio utilizando um hemocitômetro.
  3. EMNs Cultura PB em uma cultura não-tecido (não-TC) tratada placa de 6 poços, com 2 ml de meio por poço, a uma densidade celular de ~ 5 X 10 6 células / ml, a 37 ° C em um 5% de CO2 incubador humidificado.
  4. Adicionar 1 mL de meio fresco eritróide directamente a cada poço sem alterar a forma em D 3 e 5.
  5. No D 6, a colheita das multinacionais PB para nucleofection.

5. PB MNC Nucleofection e Reprogramação

  1. Um dia antes nucleofection, pré-revestimento TC-tratada placas de 6 poços com 0,1% de gelatina a 37 ° C durante 20 min. Thaw inativada Murino Embryonic Fibroexplosão (MEF) células de alimentação em um banho de água a 37 ° C e imediatamente transferi-los para um tubo de 15 mL contendo 5 mL de meio de MEF.
  2. Centrifugar a 400 xg durante 5 min e remover o sobrenadante. Remover a gelatina a partir da placa de 6 poços, ressuspender o sedimento de células em meio de FAE, e transferi-los para a gelatina pré-tratada placa de 6 poços. Em cada poço, sementes 2 - 4 x 10 5 células MEF inativadas suspenso em 2 mL de meio MEF.
  3. Cultura das células alimentadoras MEF a 37 ° C em uma incubadora de CO 2 a 5% humidificada.
  4. No dia da nucleofection, aspirar o meio MEF e substituí-la por uma média eritróide mL. Pré-equilibrar a placa de cultura de 10 - 30 min a 37 ° C em uma incubadora de CO 2 a 5% humidificada.
  5. Adicionar 2 ug pEV-OCT4-2A-SOX2, 1 ug pEV-myc, 1 ug pEV-KLF4, e 0,5? G pEV-BCL-XL num tubo de Eppendorf de 1,5 ml estéril. Aqueça o tubo a 50 ° C durante 5 minutos para evitar a contaminação, e arrefecer à temperatura ambiente. Adicionar57 mL nucleofection tampão e 13 suplemento mL.
  6. Colheita 2 x 10 6 EMNs cultivadas PB para um tubo de 5 ml por centrifugação a 200 xg durante 7 minutos. Remover o sobrenadante e adicionar o plasmídeo e nucleofection mistura tampão para a pelete de células. Misture bem sacudindo o tubo com o dedo.
    NOTA: A partir de 2 x 10 5 células podem ser usadas para nucleofection, mas uma eficiência de reprogramação inferior deve ser esperado como bem.
  7. Transferir o DNA e a suspensão de células para a cuvete fornecido no kit e a tampa da cuvete. Selecione o programa U-008 no dispositivo nucleofection. Insira a cuvete no suporte e pressione OK para aplicar o programa U-008.
  8. Aqui a cuvete para fora do suporte, adicionar 0,5 - meio eritróide 1 ml de pré-aquecida em cada cuvete, e células de transferência para a placa MEF pré-equilibrada imediatamente. Devido à eficiência de reprogramação e alta variação doador, semeando números diferentes de células que variam de 1-10 x 10 5 células per bem é altamente incentivado.
  9. Transferir a placa para uma câmara de hipoxia, e lavar a câmara com um gás misto constituído por 92% de N2, CO2 a 5% e 3% de O 2, o 1 - 2 minutos a uma taxa de 20 l / min. Após a selagem da câmara, a cultura das células a 37 ° C.
  10. No D 2 pós-nucleofection, adicione 2 mL de meio iPSC diretamente a cada poço.
  11. No D 4 pós-nucleofection, retire 3 mL de meio e adicionar 2 ml de meio iPSC fresco. No pós-D 4 nucleofection, a maioria das células vivas irá ter ligado à camada alimentadora.
  12. Depois D 6 pós-nucleofection, mudar o meio cada 2 d, deixando 500 mL gasto médio e adição de 2 ml de meio E8 fresco suplementado com 0,25 mM butirato de sódio até D 14-18.
    NOTA: células alimentadoras adicionais podem ser adicionados nos poços de cultura sempre observar que as células alimentadoras foram removidas. Depois de descongelar MEFs (ver 5.1 e 5.2), ressuspender o sedimento de células em um pequeno volume de meio E8 (isto é, ~ 0.2 ml para um poço de uma placa de 6 poços) e em seguida, adicionar MEFs em poços de cultura. Cerca de 2% de FBS pode ser adicionado para aumentar a aderência celular. Em alternativa, o meio MEF-condicionado pode também ser utilizado, mas é mais trabalhoso.

6. Expansão das iPSCs

NOTA: Na maioria dos casos, um grande número de colónias IPSC aparecer em D 8-10 pós nucleofection. Depois D 14, grandes colónias IPSC geralmente estão prontos para a colheita.

  1. Antes de escolher colónias, adicionar 500 uL E8 meio suplementado com inibidor de ROCK, Y27632 (10 uM), em uma cavidade de um alimentador ou Matrigel revestido placa de 24 poços. Use a 10 ou 20 mL pipeta para arranhar e escolher colónias sob o microscópio. Transferir os pedaços de cada colónia para os poços que contêm o meio de cultura.
    NOTA: A concentração de Matrigel difere de um lote para outro. Normalmente, usamos diluição 1: 100 de Matrigel.
    1. A fim de evitar a contaminação cruzada, escolhacolónias que são grandes e bem separados dos outros. IPSCs de cultura a 37 ° C em uma incubadora de CO 2 a 5% humidificada.
      NOTA: Deve ser notar que a população policlonal IPSC poderá ser devido a migração de células quando há dezenas ou centenas de colónias em cada cavidade de uma placa de 6 poços.
  2. Não altere meio para o primeiro 2 d. Inibidor ROCHA pode promover a sobrevivência de pequenas colônias 25.
  3. A partir de D 2 em diante, mudar médio todos os dias através da remoção de meio gasto e adicionando meio E8 500 mL fresco em cada poço.
  4. Cerca de 1 semana mais tarde, quando as colónias são grandes o suficiente, remover o meio e tratar as células com 300 uL de células solução de descolamento (EDTA 0,5 mM em PBS) a 37 ° C durante 1-3 min. Remover a solução de separação celular e adicionar meio E8 contendo inibidor ROCHA (10 mM) de suspender iPSCs. Não quebrar colónias em células individuais, que podem conduzir à morte celular excessiva. Os aglomerados de células com 5-50 célulass são adequados para iPSC passagem.
  5. Transferir 50 - 100% da suspensão de células a cada poço de um de 12 ou 6 cavidades da placa que tenha sido pré-revestidos com Matrigel ou alimentadores.
  6. Para a cultura de longo prazo em placas Matrigel-revestidas (ver nota em 6.1), alterar o meio todos os dias. Quando a célula atinge a confluência 40-60%, tratar as células com uma solução de separação celular ml (0,5 mM de EDTA em PBS) a 37 ° C durante ~ 3 min. Quando as colônias começam a enrolar, remover a solução de separação celular e adicionar E8 meio contendo inibidor ROCHA (10 mM) de suspender as iPSCs. células de passagem com um fator de divisão de 4 - 8. o inibidor ROCHA deve ser adicionado quando passaging células para aumentar a sobrevida e removido 1 d tarde para evitar diferenciação.
  7. Para congelar-se iPSCs, o tratamento de células com solução de descolamento de células a 37 ° C durante 3 - 5 minutos de acordo com o protocolo do fabricante. Quando colónias IPSC começar a enrolar-se, aspirar o tampão e adicionar 0,5-1 mL de meio E8.
  8. <li> Adicionar um volume igual de meio de criopreservação para a suspensão de células e misture bem. Congelado iPSCs pode ser armazenado em um congelador a -80 ° C durante várias semanas ou em azoto líquido durante a armazenagem a longo prazo.

7. Seleção de iPSCs sem Residual episs�ica Plasmids

  1. Após a passagem 5, iPSCs de colheita e extração de DNA genômico.
    NOTA: Normalmente, após 5 passagens de cultura, plasmídeos episs�icas residuais são indetectáveis. Assim, quase todas as colónias IPSC em passagens superiores a 5 (isto é, passagem 10) faltam plasmídeos epissomais residuais.
  2. Utilizar o ADN genómico a partir de MNCs PB não transfectadas como controlo negativo. Adicionar 1,6 pg do plasmídeo pEV-OCT4-2A-SOX2 no DNA controle negativo 1 mg para imitar células com uma cópia do pEV plasmídeo por célula.
  3. Adicionar 9 mL de água de grau de PCR incluindo os iniciadores específicos 100 ng de ADN genómico e 1 ul (10 uM de cada um dos iniciadores directos e inversos) em 10 mL de alta fidelidade-PCR Master Mix. Normalizar o amount do DNA por GAPDH. Use as seguintes primers para PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Incubar a mistura de reacção a 98 ° C durante 60 s; seguido por 98 ° C durante 10 s, 60 ° C durante 30 s, e 72 ° C durante 30 s. Depois de 30 ciclos; estender a reacção a 72 ° C durante 5 min.
  5. Carga de 5 uL produtos de PCR em cada poço de um gel de agarose a 1%. Execute o gel para 20 - 30 minutos a 100 V. Escolha os clones IPSC com bandas indetectáveis ​​para EBNA1 e WPRE para posterior cultura e análise a jusante.

8. Citometria de Fluxo

  1. Colheita iPSCs por tratamento com Accutase a 37 ° C durante 3-5 minutos para se obter uma suspensão de célula única. Adicionar 1 mL de PE-conjugado anti-TRA-1-60 ou eFluor 570-conjugado anti-anticorpo isotípico SSEA4 ou a 100 ul de suspensão de células (1 - 5 x 10 5 células) Em 5 mL de tubos. Incubar os tubos em um local escuro, à TA durante 20 min.
  2. Após a coloração durante 20 minutos à TA, adiciona-se 2 mL de PBS e centrifugar a 400 xg durante 5 min. Ressuspender as células em 300 uL de PBS para análise de células activadas por fluorescência (FACS), utilizando um analisador de citometria de fluxo de células. 23,26

9. Imagem Confocal

  1. iPSCs de sementes em lâminas de câmara Matrigel revestidos.
  2. Depois de 3 - 4 d de cultura, remover o meio de crescimento e fixar com 4% de paraformaldeído (PFA) a TA durante 30 min. Lavar as células duas vezes com PBS.
    Nota: PFA é tóxico e perigoso.
  3. Tratar as células com 0,1% de Triton X-100 em PBS (PBS-T) à TA durante 30 min. Lavar as células duas vezes com PBS.
  4. Bloquear as células com tampão de bloqueamento (soro de cabra a 5% em PBS, v: v) à temperatura ambiente durante 1 h.
  5. Durante o passo de bloqueio, diluir o anticorpo primário (100x) em tampão de bloqueio.
    NOTA: As informações anticorpos está listada na Tabela de materiais / equipamentos.
  6. Incubar as células com anticorpos diluídos a 4 ° CO / N.
  7. Lavar duas vezes com PBS-T, durante 15 min, seguido por duas vezes com PBS durante 15 min.
  8. Incubar as células com um anticorpo secundário conjugado com fluoróforo diluído à temperatura ambiente durante 2 h.
  9. Lavar as células duas vezes com PBS-T, durante 15 min, seguido por duas vezes com PBS durante 15 min.
  10. Manchar o núcleo com DAPI (1 ug / ml) em PBS à temperatura ambiente durante 10 min.
  11. Lavar as células duas vezes com PBS durante 15 min.
  12. Capturar imagens com um microscópio confocal. 23,27

10. Teratoma Assay

Colheita 1 x 10 6 iPSCs com solução de separação celular (EDTA 0,5 mM em PBS) e ressuspender as células em 200 ul de DMEM / F12 diluída (1: 1) de Matrigel.

  1. Por via subcutânea injetar células na coxa traseira de ratos imunodeficientes NOD / SCID.
  2. No 8-12 semana após a injecção iPSC, dissecar e corrigir teratomas em formalina a 10%. 28
  3. Após microsectioning ecoloração com hematoxilina e eosina (H & E), analisar amostras. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Usando este protocolo, podemos obter centenas de colónias a partir de 1 x 10 5 nucleofected PB multinacionais (Figuras 1A e 1B). A eficiência de reprogramação é de aproximadamente 0,2-0,5% e as colónias expressam marcadores de pluripotência (Figuras 1C e 1D). iPSCs gerados utilizando o protocolo descrito são livres de integração e tem a capacidade de formar teratoma compor as 3 camadas germinais (Figuras 1E e 1F).

figura 1
Figura 1: Geração de iPSCs livre de integração a partir de células mononucleares do sangue periférico. (A): Um esquema do protocolo para a reprogramação de células do sangue periférico. (B): coloração AP a granel (esquerda) e um típico ESC-como colónia iPSC (à direita)60; 14 d após PB multinacionais nucleofection. Barra de escala: 100? m. (C): FACS representativos diagramas de iPSCs em passagem 5 expressando TRA-1-60 ou SSEA4. (D): imagens confocal representativos de colónias IPSC expressando NANOG e OCT4. Barra de escala: 100? m. (E): Imagem representativa do quadro total e coloração H & E de teratoma, compreendendo todas as três camadas germinativas. Barra de escala: 100? m. (F): Copie o número de plasmídeos EV residuais em iPSCs após cinco passagens. primers específicos para EBNA1 e WPRE foram utilizados para amplificar vetores episs�icas. GAPDH foi usada como um controlo de carga de ADN. UD, indetectável. A pista positivo indica um controle de uma cópia. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aquisição de amostras de sangue de dadores saudáveis ​​ou doentes é conveniente e não invasivo, tornando-se uma fonte de células atraente para a investigação básica e clínica de terapia celular. Aqui nós descrevemos um protocolo para a geração altamente eficiente de iPSCs livre de integração a partir de amostras de sangue periférico. Esta abordagem reprodutível e acessível deve beneficiar o campo da IPSC.

Nós relatamos que existem dois factores críticos responsáveis pela reprogramação PB altamente eficiente 30. Uma expressão é equimolar de OCT4 e SOX2 usando um ligante 2A 31. Para conseguir isso, pEV-OCT4-2A-SOX2 é usado neste protocolo. A outra é a utilização de dois plasmídeos pEV-myc e pEV-KLF4 para expressar MYC e KLF4 em vez de pEV-MYC-2A-KLF4 que anteriormente foram utilizadas 30. A mudança aparentemente simples leva a um aumento de aproximadamente 100X na eficiência de reprogramação PB, que é em grande parte devido a um aumento gradual e maior no MYC: KLproporção F4 durante o curso do processo.

Vários pontos devem ser considerados para a realização de alta eficiência de geração iPSC de PB. EMNs PB são cultivadas durante ~ 1 semana em meio de eritróide, que promove a proliferação e expansão de células progenitoras eritróides e, assim, aumenta a eficiência de reprogramação 20. No entanto, para algumas amostras, em particular para as células do sangue de pacientes com leucemia, células sobrevivem mal quando cultivadas em meio eritróide. Neste caso, seria útil para diminuir o tempo de cultura. Também é encorajado a usar 1 - 2 ug pmaxGFP vector para verificar a eficiência nucleofection, que deve ser superior a 50%. Além disso, a qualidade do plasmídeo é importante. Recomenda-se utilizar plasmídeos sem contaminação de endotoxina (ou seja, utilizando Endo-livres Kit Plasmid Maxi para extrair plasmídeos). Má qualidade plasmídeo pode levar à morte celular significativa e, assim, reduzir a eficiência de reprogramação. Nós e outros autores mostraram que promot hipoxiaes geração iPSC 14,32. Nós lavar a câmara hipoxia com uma mistura gasosa constituída por 92% de N2, CO2 a 5% e 3% de O2. Se normoxia é usado em vez disso, uma redução de até 80% na eficiência de reprogramação podem ser observadas. Uma vez que a reprogramação está completa, iPSCs podem ser cultivadas num regulares humidificada com 5% de CO2. Ao mudar de forma, que é útil para deixar uma pequena quantidade de meio gasto (isto é, 500 ul por poço numa placa de 6 poços) e em seguida, adicionar meio fresco. Alterar médio apenas a cada dois dias durante a reprogramação, como mudança de meio demasiado frequente pode reduzir iPSCs geração 33.

O novo protocolo de nós desenvolvemos alcançou uma reprogramação PB de alto nível, que é comparável ao sistema de SV reprogramação. O sistema EV tem várias vantagens óbvias. Por um lado, EV é mais acessível do SV. O sistema EV também pode ser ainda modificado através da inclusão de factores adicionais ou diferentes Combinações de vários factores, enquanto que os vectores de SVS é um produto comercial que não pode ser modificada pelos investigadores. Nosso protocolo corrente inclui a utilização de células alimentadoras MEF e produtos de origem animal, o que pode limitar as aplicações clínicas, mas pode ser facilmente removido por um desenvolvimento ainda mais protocolo 34,35.

iPSCs gerados com este sistema pode ser usado não só para a modelação da doença e o rastreio de drogas, mas também para a terapia clínica, porque plasmídeos de nível de GMP EV pode ser gerado facilmente e não há iPSCs com integração EV considerável tem sido identificado. Em aplicações clinicas, as células do paciente normalmente abrigar um gene de indução de doença, que tem de ser corrigido nos iPSCs antes de diferenciação em células funcionais para a terapia. Um relatório recente mostrou que o sistema EV reprogramação pode ser facilmente integrado com o sistema / Cas9 CRISPR para alcançar reprogramação simultânea e edição genoma após um nucleofection simples 36. Isto é umvantagem nother de EV sobre o sistema SV. Os nossos dados não publicados mostraram que até um genoma eficiência edição de 20% pode ser conseguida quando verticalização edição genoma sobre EV reprogramação. É nossa esperança que a integração de reprogramação PB com CRISP / Cas9R genoma edição pode ter potenciais aplicações no tratamento de várias doenças que são de outra maneira incurável nas próximas décadas.

Em resumo, a nossa melhorada protocolo de reprogramação de células do sangue periférico deverão ser úteis para um amplo espectro de investigadores em pesquisa básica e aplicações clínicas. Este sistema EV reprogramação eficiente também pode ser empregada, após as modificações, para gerar células-livre de integração-tronco mesenquimais (MSCs) 37, ou células-tronco neurais (NCCC) 38, directamente a partir de células do sangue periférico adulto sem passar por uma fase da IPSC.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics