के जैवप्रभावों को बनाए रखने और विभेद करने के लिए प्रयुक्त प्रयोगशाला तकनीक * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यह पांडुलिपि, जैविक रासायनिक assays की एक श्रृंखला के अलावा उचित विब्रियो कोलरे रखरखाव तकनीकों का वर्णन करता है, सामूहिक रूप से क्लिनिकल और पर्यावरण वी के बीच त्वरित और विश्वसनीय अंतर के लिए उपयोग किया जाता है। एक प्रयोगशाला सेटिंग में कोलरे बायोटाइप।

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

जलीय ग्राम-ऋणात्मक जीवाणु विब्रियो कोलेरे संक्रामक गैस्ट्रोइंटेस्टाइनल रोग केजा के एटिऑलजिक एजेंट है। इस रोग की वैश्विक व्याप्ति और गंभीरता के कारण, वी । कोलेरे का पर्यावरण और प्रयोगशाला सेटिंग्स दोनों में बड़े पैमाने पर अध्ययन किया गया है, उचित रखरखाव और संवर्धन तकनीकों की आवश्यकता होती है। शास्त्रीय और एल टोर दो मुख्य जैव-प्रकार हैं जो वी बनाते हैं। कोलरे ओ 1 सेरोग्रुप, प्रत्येक अद्वितीय जीनोटाइपिक और फ़िनोटीपिक विशेषताओं को प्रदर्शित करते हैं जो बायोटाइप लक्षण वर्णन के लिए विश्वसनीय तंत्र प्रदान करते हैं, और संवर्धन परिस्थितियों को प्रेरित करने के लिए अलग-अलग वायरस की आवश्यकता होती है। किसी भी संक्रमण या प्रकोप के कारण कारक तनाव के बायोटाइप के बावजूद, इस बीमारी के लिए मानक उपचार में रिहाइड्रेशन थेरेपी को एंटीबायोटिक दवाओं के एक आहार के साथ पूरक होता है। हालांकि, प्रयोगशाला अध्ययन के लिए बायोटाइप वर्गीकरण आवश्यक हो सकता है और बायोमेडिकल क्षेत्र में व्यापक प्रभाव पड़ सकता है।प्रारंभिक 2000 के नैदानिक ​​आइसोलेट्स की पहचान की गई, जो शास्त्रीय और एल टोरी दोनों प्रकार के जीवों से जीनोटाइपिक और फ़िनोटीपिक लक्षण दिखाते हैं। एल टोर नामक नए पहचान वाले हाइब्रिड ने पिछले पारंपरिक एकल परख पहचान प्रोटोकॉल की तुलना में नैदानिक ​​और पर्यावरणीय पृथक बायोटाइप पहचान को अधिक जटिल बनाने के लिए कारण दिया है। वी का वर्णन करने के अतिरिक्त कोलरे सामान्य रखरखाव और संवर्धन तकनीकों, यह पांडुलिपि जीन विशिष्ट ( सीटीएक्सबी और टीसीपीए ) पीसीआर-आधारित आनुवंशिक स्क्रीन और फ़िनोटीपीक एशेज (पॉलीमीक्सिन बी प्रतिरोध, साइट्रेट चयापचय, प्रोटीयोलाइटिक गतिविधि, हेमोलीटिक गतिविधि, गतिशीलता, और ग्लूकोस चयापचय के माध्यम से वाोग्स- प्रोस्काउर परख) सामूहिक रूप से शास्त्रीय और एल टोरी बायोटाइप के बीच अंतर करने और / या अंतर करने के लिए प्रयोग किया जाता है। साथ में, इन assays एक विकल्प के रूप में इस्तेमाल किया जा करने के लिए एक प्रभावी व्यवस्थित दृष्टिकोण प्रदान करते हैं, या इसके अलावा, महंगा, श्रम से सशक्त प्रयोग चरित्र मेंवी । कोलरे नैदानिक ​​(और पर्यावरण) अलग।

Introduction

हैजा, दूषित भोजन या जल के जल के ग्राम-नकारात्मक जीवाणु विब्रियो कोलेरे युक्त पानी की खपत के कारण दूर की छोटी आंत की बीमारी है। हैजा के लक्षणों में उल्टी और अनियंत्रित पानी का दस्त शामिल होता है, जिससे गंभीर निर्जलीकरण होता है, जो कि अगर ठीक से नहीं किया जाता है, तो मृत्यु हो जाएगी। वी । कोलेरे को सेल-सतह लाइपोपॉलीसेकेराइड ओ-एंटीजन की संरचना के आधार पर 200 से अधिक सरोर्गों में विभाजित किया जा सकता है। हालांकि, केवल 2 सेरोग्रुप, ओ 1 और ओ 139 ने महामारी या महामारी क्षमता 1 , 2 दिखायी है। इसके अलावा, सर्गोगाप O139 मुख्य रूप से दक्षिण एशिया 3 , 4 को पृथक कर दिया गया है, जबकि सर्गोग्रुप ओ 1 को दुनियाभर में वितरित किया गया है। इसके अलावा, ओ 1 सीरोग्रुप को 2 मुख्य बायोटाइप में विभाजित किया जा सकता है: शास्त्रीय और एल टोर। शास्त्रीय बायोटाइप पहले 6 हैजा के महामारी के लिए जिम्मेदार था1817 और 1 9 23 के बीच है। चालू सातवें महामारी एल गोंद बायोटाइप का परिणाम है, जिसने पर्यावरण 5 , 6 , 7 में क्लासिकल बायोटाइप को दुनिया भर में विस्थापित कर दिया है। हाल ही में, उपभेदों में उत्पन्न हुए हैं जिनमें शास्त्रीय और एल टोर दोनों 8 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 और दोनों के विशिष्ट गुण हैं जिनमें से एल टोर 13 , 17 के रूप में कहा गया है। कुछ एल तोर वेरिएंट ने पहले की तुलना में अधिक तीव्र और गंभीर बीमारी की प्रगति के साथ एलाइटेड वैरुलेंस क्षमताओं का प्रदर्शन किया, बल दियाएजेंट की पहचान और रोग की रोकथाम और उपचार के लिए एक अधिक व्यापक दृष्टिकोण की आवश्यकता 8 , 9 , 18 जबकि बायोटाइप पहचान तुरंत उपचार को निर्देशित नहीं करती है, वैक्सीन के विकास और भावी चिकित्सकीय एजेंटों में आगे बढ़ने से बायोटाइप भेदभाव से लाभ हो सकता है।

यहां सूचीबद्ध प्रोटोकॉल की पहली श्रृंखला जांचकर्ताओं को उचित रूप से बनाए रखने में सक्षम होगी। एक प्रयोगशाला सेटिंग में कोलेरे की उपभेद एकरूपता और बाद के विश्लेषण में स्टॉक तैयारी और आइसोलेट्स के विकास की आवश्यकता होती है, जो बायोटाइप-निर्भर नहीं है। हालांकि, अतिसंवेदनशील जीन अभिव्यक्ति को बेहतर रूप से प्रेरित करने के लिए, स्वतंत्र बायोटाइप विशिष्ट संवर्धन तकनीक को 1 9 की आवश्यकता है। इसके अतिरिक्त, विभिन्न आनुवंशिक और जैव रासायनिक assays की तैयारी इस पांडुलिपि में उल्लिखित हैं।

कोरा टोक्सिन (सीटी) और विष को-सहग्रुलेट प्लीयस (टीसीपी) वी के दोनों बायोटाइप में मास्टर नियामक टोक्सटी द्वारा नियंत्रित दो मुख्य विषम कारक हैं। कोलेरे ओ 1 सेरोगroup 20 सीटी पांच सीटीएक्सबी से बना एक द्विपक्षीय विष है एक एकल सीटीएक्सए सबयूनेट के आसपास के सब यूनिट, और हैजा से संबंधित तीव्र इलेक्ट्रोलाइट हानि के लिए जिम्मेदार है। टीसीपी टीसीपी ऑपेरॉन ( टीसीपीएबीएसीएसीडीआरडीएसटीईएफ़ ) द्वारा एन्कोडेड एक प्रकार का IV प्लीज है , और इसे बाहर की छोटी आंत की लगाव और उपनिवेश में शामिल किया गया है। टीसीपीए टीसीपी ओपेरॉन का पहला जीन है जो पिलियस 8 के निर्माण के लिए जरूरी निजी पियलिन सबिनट्स को एनकोड करता है। सीटीएक्सए के लिए जीन अनुक्रम शास्त्रीय और एल टोरी बायोटाइप्स के बीच पूरी तरह से संरक्षित है, जबकि सीटीएक्सबी और टीसीपीए दो बायोटाइपों में भिन्न है लेकिन प्रत्येक बायोटाइप 8 में संरक्षित हैं। सीटीएक्सबी पूरी तरह से बायोटेक्स्ट्स के बीच संरक्षित है, इसके अलावा दो आधार पॉजी को छोड़करप्रवृत्तियों (115 और 203) एल टोरी बायोटाइप में, थाइमाइन आधार स्थितियों 115 और 203 में रहता है, जबकि शास्त्रीय बायोटाइप इन बेस में साइटोसिन होता है। टीसीपीए पूरी तरह से प्रत्येक बायोटाइप के भीतर संरक्षित है, फिर भी बायोटाइप के बीच कई ठिकानों में अंतर है। ये आनुवांशिक भेद प्राथमिक बायोटाइप पहचान चिह्नक के रूप में कार्य करते हैं, और इन साइटों सहित पॉलिमरेज़ चेन रिएक्शन (पीसीआर) प्रवर्धन उत्पाद को अनुक्रमित करने के बाद, अलग-अलग दृश्यों को बायोटाइप पृष्ठभूमि निर्धारित करने के लिए वन्य-प्रकार (डब्ल्यूटी) शास्त्रीय O395 या WT El Tor N16961 से तुलना की जा सकती है सीटी और टीसीपी का, क्रमशः दिए गए वी । कोलरे में अलग।

शास्त्रीय और एल टोरी बायोटाइप्स 21 , 22 , 23 के बीच फ़िनोटीपिक भेदों को चिह्नित करने के लिए कई प्रोटोकॉल विकसित किए गए हैं। पॉलीमीक्सिन बी एक पेप्टाइड एंटीबायोटिक है जो ग्राम-नकारात्मक बीएसी में बाह्य कोशिका झिल्ली की अखंडता का समझौता करता हैटेरिया और पॉलीमीक्सिन बी प्रतिरोध को पॉलीमीक्सिन बी प्रतिरोधी परख 21 के माध्यम से देखा जा सकता है। साइट्रेट क्रेब के चक्र का एक प्राथमिक सब्सट्रेट है, और साइटट्रेट चयापचय परख 22 का उपयोग करके एक एकल कार्बन स्रोत के रूप में साइट्रेट को मेटाबोलाइज करने की क्षमता निर्धारित की जा सकती है। एचएपीआर एक वैश्विक नियामक और वी। कोलरे, एचएपीआर में मास्टर कोरम-सेंसिंग नियामक को एन्कोड करता है, जो विभिन्न प्रमोटर क्षेत्र में बांधता है और जीन और ऑपरोन एक्सप्रेशन 24 को नियंत्रित करता है। वी। कोलेरे के कुछ रोगजनक उपभेदों में एचएपीआर जीन में एक स्वाभाविक रूप से उत्पन्न होने वाली फ्रेम-शिफ्ट उत्परिवर्तन होता है जिसके कारण इस घनत्व पर निर्भर विनियमन विषाणु जीन की अभिव्यक्ति 24 , 25 खो गई है। दूध एगर मीडिया का उपयोग करते हुए एचएपीआर-विनियमित प्रोटीज गतिविधि को मापने से शोधकर्ता को यह पता करने की अनुमति मिलती है कि क्या एक विशेष पृथक में एक कार्यात्मक एचएपीआर 23 है ।हेमोलिसिस परख के परीक्षण के लिए हेमोलिटेक एंजाइम को छिपाने के लिए एक तनाव की क्षमता होती है जो कि लाल रक्त कोशिकाओं को बोलती है; हेमोलिसिस की डिग्री रक्त एगर प्लेट्स 23 पर देखी जा सकती है। गतिशीलता अक्सर वी। कोलरे में खतरे के साथ जुड़ी होती है और गतिशीलता अगर प्लेट्स 23 का उपयोग करके इसका विश्लेषण किया जा सकता है। वाोग्स-प्रोस्काउर परख एक एकमात्र कार्बन स्रोत के रूप में ग्लूकोज को उत्तेजित करने और उप-उत्पाद एसीटोन 21 का उत्पादन करने की तनाव के लिए परीक्षण करता है। एल टोर के रूपांतरों के उद्भव के साथ, व्यापक जीनोटाइपिक स्क्रीनिंग के बिना किसी भी फेनोटाइपिक परख के परिणामों की भविष्यवाणी करना मुश्किल है, और वी के बायोटाइप पृष्ठभूमि को कम करने से पहले। कोलेरे आइसोलेट्स, यह सिफारिश की जाती है कि इस विधानसभा को 23 एसेशन के प्रदर्शन के लिए और परिणाम की तुलना तालिका 2 के संदर्भ में तनाव के रूप में करें।

इसके साथ ही, हम प्रोटोकॉल की एक श्रृंखला को उन्नत कर चुके हैं, सामूहिक रूप से उपर्युक्त उपयोग करते हैंवी को चित्रित करने के लिए एक अधिक व्यापक दृष्टिकोण के लिए ntioned जीनोटाइपिक और फ़िनोटाइपिक assays कोलरे बायोटाइप इसके अलावा, हमने ज्ञात वी के जीनोटाइपिक और फ़िनोटाइपिक भेदों का वर्णन किया है। कोलेरे एल टोर वेरिएंट (एमक्यू 1 9 5 और बीए -2163), आमतौर पर इस्तेमाल किए गए बायोटाइप संदर्भ तनाव (डब्ल्यूटी शास्त्रीय ओए 3 9 5, डब्लूटी एल टोर सी 6706, और डब्लूटी एल टोर एन 16961; तालिका 1 ) की तुलना में। एल टोर संस्करणों के उद्भव ने पहले से नियोजित एकल परख बायोटाइप वर्णक्रम प्रोटोकॉल की विश्वसनीयता के लिए चुनौतियों का सामना किया है; हालांकि, यह कई परख पहचान प्रणाली क्लिनिकल और पर्यावरण वी के अधिक विश्वसनीय लक्षण वर्णन के लिए अनुमति देगा। कोलरे आइसोलेट्स

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: प्रत्येक परख के लिए समय पर विचार किया जाना चाहिए क्योंकि व्यक्तिगत मीडिया की तैयारी के लिए अलग-अलग समय चाहिए। उदाहरण के लिए, ठोस अगर प्लेट मीडिया को पर्याप्त रूप से शांत और सूखे (1-2 दिनों) की अनुमति दी जानी चाहिए। अतिरिक्त समय विचार ( यानी एकल कॉलोनी और रातोंरात संस्कृति विकास) प्रत्येक प्रोटोकॉल के तहत निर्दिष्ट हैं और तालिका 2 में पाए जाते हैं।

1. मीडिया की तैयारी

  1. 1x फॉस्फेट बुफोर्ड सलाइन (पीबीएस)
    1. वजन 4.0 ग्राम NaCl, 0.1 ग्राम किलोवाट, 0.72 ग्राम ना 2 एचपीओ 4 , और 0.12 ग्राम केएच 2 पीओ 4 । 1 एल एरलेमेयर फ्लास्क में घटकों को मिलाकर, विआयनीकृत पानी के साथ 500 मिलीलीटर की मात्रा समायोजित करें, पीएच को 7.2 से पीएच को समायोजित करें और हल करने के लिए एचसीएल बूंद छोड़कर, 0.22 माइक्रोन फिल्टर का उपयोग करके आटोक्लेव या फिल्टर बाँझें। 1x पीबीएस को कमरे के तापमान पर अनिश्चितकाल में संग्रहीत किया जा सकता है।
      सावधानी: एचसीएल एक केंद्रित एसिड होता है और इसके अनुसार संभाला जाना चाहिएसंस्थागत, स्थानीय, राज्य और संघीय नियमों के लिए उपयुक्त हैंडलिंग दिशानिर्देशों के लिए निर्माता द्वारा प्रदत्त सुरक्षा डाटा शीट का संदर्भ दिया गया है।
  2. लुरी-बर्टानी (एलबी) ब्रोथ
    1. 5.0 ग्राम ट्रिप्टन, 2.5 ग्राम खमीर निकालने, और 2.5 ग्राम नाक वजन। 1 एल बोतल में घटकों को मिलाएं, विआयनीकृत पानी, आटोक्लेव के साथ 500 एमएल तक मात्रा समायोजित करें और कमरे के तापमान पर 6 महीने तक स्टोर करें। शास्त्रीय बायोटाइप वायरलेंस उत्प्रेरण की स्थिति के लिए, पीएच को 6.5 को एचसीएल का उपयोग करके आटोक्लेविंग से पहले समायोजित करें।
  3. AKI मध्यम 0.03% युक्त (w / v) NaHCO 3
    1. घटक 1 (AKI मध्यम) के लिए: 7.5 ग्राम पेप्टाफोन, 2.0 ग्राम खमीर निकालने, और 2.5 ग्राम नाल का वजन। 1 एल बोतल में घटकों को मिलाकर, विआयनीकृत पानी और आटोक्लेव के साथ 450 एमएल के लिए मात्रा समायोजित करें। AKI माध्यम को कमरे के तापमान पर 6 महीने तक संग्रहीत किया जा सकता है।
    2. घटक 2 (NaHCO 3 ) के लिए: 1.5 ग्राम NaHCO 3 वजन, और मात्रा को समायोजित करेंएक बाँझ पुटिका में विआयनीकृत पानी के साथ 50 एमएल तक। फिल्टर 0.22 माइक्रोन फिल्टर का उपयोग कर 3 NaHCO निष्फल। प्रयोग करने से पहले नाहोको 3 तुरंत तैयार हो जाना चाहिए।
    3. एस्केपिक रूप से दो घटकों को एक 1:10 अनुपात बनाने के लिए घटक 2 को घटक 1 में उपयोग करने से पहले फ़िल्टर करके जोड़ता है।
  4. लूरिया-बर्टानी (एलबी) अगार प्लेट्स
    1. 5.0 ग्राम ट्रिप्टन, 2.5 ग्राम खमीर निकालने, 2.5 ग्राम नाक और 7.5 ग्राम वजन का वजन। 1 एल एर्लेमेयर फ्लास्क में घटकों को मिलाकर, विआयनीकृत पानी, आटोक्लेव के साथ 500 एमएल तक मात्रा समायोजित करें और मानक आकार में 100 मिमी x 15 मिमी बाँझ पेट्री डिश करें। मढ़वाया मीडिया को 6 महीनों तक प्लास्टिक में लिपटे रखा जा सकता है, 4 डिग्री सेल्सियस पर ढक्कन की ओर
  5. एलबी एगर प्लेट्स पॉलीमीक्सिन बी के साथ पूरक हैं
    1. घटक 1 (एलबी अगर) के लिए: 5.0 ग्राम ट्रिप्टन, 2.5 ग्राम खमीर निकालने, 2.5 ग्राम नाक, और 7.5 ग्राम अगर का वजन। 1 एल एरलेमेयर फ्लास्क में घटकों को मिलाकर, 500 एमएल वाई की मात्रा समायोजित करेंडी विआयनीकृत पानी और आटोक्लेव
    2. अवयव 2 (पॉलीमीक्सिन बी) के लिए: डीमैनेज किए गए पानी में पाइलीक्सीन बी को भंगुर 2 एमएल माइक्रोसेंट्रिफ्यूज ट्यूब में 50,000 आईयू / μ एल की एकाग्रता में भंग कर दें और 0.22 माइक्रोन फिल्टर का उपयोग करके फ़िल्टर बाँझें।
    3. कंपोनेंट 1 स्पर्श करने के लिए अच्छा है, लेकिन अभी तक ठोस नहीं है, तो घटक को 1 घटक के लिए 500 μL घटक 2 को जोड़कर 1 IU / μL का अंतिम एकाग्रता बनाकर अच्छी तरह मिलाएं। पेट्री डिश में मिश्रित अतर मीडिया डालने से मानक आकार के 100 मिमी x 15 मिमी बाँझ पेट्री डिश में तैयार करें। प्लेटेड मीडिया 3 महीने तक प्लास्टिक में लपेटा जा सकता है, 4 डिग्री सेल्सियस पर ढक्कन के ऊपर
  6. मिनिमल साइट्रेट मध्यम एगर प्लेट्स
    1. घटक 1 (ब्रोमोथिमोल नीले रंग के साथ) के लिए: 7.5 ग्राम अदर और 0.02 ग्राम ब्रोमोथिमोल नीला वजन। एक एल एल Ermenmeyer फ्लास्क में घटकों को गठबंधन, विआयनीकृत पानी के साथ 450 एमएल के लिए मात्रा को समायोजित और मिश्रण आटोक्लेव।
    2. घटक 2 (10x वीबीएमएम) के लिए: वजन 1.0 ग्राम एमजीएसओ 4 7 एच 2 ओ, 10.0 ग्राम साइट्रिक एसिडएच 2 ओ, 50.0 ग्राम निर्जल के 2 एचपीओ 4 और 17.5 ग्राम एनएएनएच 4 एचपीओ 4 4 एच 2 ओ। 1 एल एरलेमेयर फ्लास्क में घटकों को मिलाकर, 500 एमएल तक मात्रा समायोजित करें विआयनीकृत पानी और आटोक्लेव या फिल्टर के साथ एक 0.22 माइक्रोन फिल्टर का उपयोग कर बाँझ। 10x वीबीएमएम कमरे के तापमान पर 6 महीने तक जमा किया जा सकता है।
    3. घटक 1 के लिए घटक 2 के 50 एमएल को जोड़ें और पेट्री डिश में मिश्रित एगर मीडिया डालने से मानक आकार के 100 मिमी x 15 मिमी बाँझ पेट्री डिश करें। मढ़वाया मीडिया को 6 महीनों तक प्लास्टिक में लिपटे रखा जा सकता है, 4 डिग्री सेल्सियस पर ढक्कन की ओर
  7. दूध अजार प्लेट्स
    1. घटक 1 (दूध) के लिए: एक एल एल एर्लेमेयर फ्लास्क में 8.0 जी तुरंत नॉनफैट सूखी दूध का वजन, विआयनीकृत पानी और आटोक्लेव के साथ 200 एमएल तक मात्रा को समायोजित करें।
    2. अवयव 2 के लिए (मस्तिष्क-हृदय आधान के साथ अगर): 3.68 ग्राम मस्तिष्क-दिल का आसंजन और 6.0 ग्राम वजन का वजन। कमान गठबंधन500 एमएल एर्लेनमेयर फ्लास्क में स्थितियां, विआयनीकृत पानी और आटोक्लेव के साथ 200 एमएल तक मात्रा समायोजित करें।
    3. आटोक्लेविंग के बाद घटक 1 के साथ कंपोनेंट 2 में डालने से दो घटकों को मिलाएं और अच्छी तरह से मिश्रण करें। 150 मिमी x 15 मिमी बाँझ पेट्री डिश में तैयार करें। दूध प्लेटें एक सप्ताह के लिए रखी जा सकती हैं जो प्लास्टिक में लिपटे रहती हैं, ढक्कन के नीचे 4 डिग्री सेल्सियस पर होती है पेट्री डिश में मिश्रित एगर मीडिया डालने से 150 मिमी x 15 मिमी बाँझ पेट्री डिश में तैयार करें।
  8. गतिशीलता एगर प्लेट्स
    1. घटक 1 (एलबी अगर) के लिए: 5.0 ग्राम ट्रिप्टन, 2.5 ग्राम खमीर निकालने, 2.5 ग्राम NaCl, और 2.0 ग्राम अजार का वजन। 1 एल एरलेमेयर फ्लास्क में घटकों को मिलाकर, विआयनीकृत पानी और आटोक्लेव के साथ 500 एमएल तक मात्रा समायोजित करें।
    2. घटक 2 के लिए (1% (डब्ल्यू / वी) ट्रिपिनिटाट्राजोलियम क्लोराइड; टीटीसी): 0.25 जी टीटीसी का वजन। एक बाँझ पुटिका में विआयनीकृत पानी के साथ 25 मिलीलीटर मात्रा को समायोजित करें और 0.22 माइक्रोन फिल्टर का उपयोग करके फ़िल्टर निष्फल। कमरे के तापमान पर 6 महीनों तक स्टोर करेंप्रकाश जोखिम को कम करने के लिए पन्नी में
    3. आटोक्लेव मीडिया के लिए 1% (डब्ल्यू / वी) बाँझ टीटीसी के 2.5 एमएल जोड़ें।
    4. बड़े 150 मिमी x 15 मिमी बाँझ पेट्री डिश में मीडिया जितना मोटी संभव हो (≥50 एमएल / प्लेट) डालें। प्लेटेड मीडिया को एक सप्ताह तक प्लास्टिक में लिपटे रखा जा सकता है, 4 डिग्री सेल्सियस पर ढक्कन के ऊपर पेट्री डिश में मिश्रित एगर मीडिया डालने से 150 मिमी x 15 मिमी बाँझ पेट्री डिश में तैयार करें।
  9. वोजेस-प्रोस्काउर (वीपी)
    1. घटक 1 (मिथाइल रेड-वोग्स-प्रॉस्काउर शोरबा; एमआर-वीपी) के लिए: 500 एमएल एर्लेनमेयर फ्लास्क में 1.7 ग्राम एमआर-वीपी माध्यम का वजन, विआयनीकृत पानी और आटोक्लेव के साथ 100 एमएल तक मात्रा समायोजित करें। बाँझ एमआर-वीपी शोरबा कमरे के तापमान पर 6 महीने तक जमा कर सकते हैं।
    2. घटक 2 (5% (w / v) अल्फा (α) नेफथोल) के लिए: 1.0 जी α-naphthol एक बाँझ पुटिका में वजन और 20% एमएल के साथ 95% इथेनॉल के लिए मात्रा को समायोजित करें। Α-naphthol को कमरे के तापमान पर 1 सप्ताह के लिए पन्नी में लपेटा जा सकता है ताकि हल्के विस्तार को कम किया जा सकेosure।
    3. घटक 3 (40% (वाय / वी) पोटेशियम हाइड्रॉक्साइड; कोओएच) के लिए: 20.0 ग्राम कोहे एक बाँझ पुटिका में, बाँझ विआयनीकृत पानी से 50 एमएल तक मात्रा समायोजित करें। कोह को एक प्लास्टिक के पोत में कमरे के तापमान पर 6 महीने तक संग्रहीत किया जा सकता है।

2. वी के रखरखाव और विकास कोलेरे स्ट्रेंन्स

  1. फ्रोजन स्टॉक संस्कृतियों की तैयारी और उपयोग
    1. पैलेट 1.8 एमएल का तरल रातोंरात संस्कृति 2 मिनट के लिए सेंट्रीफ्यूजेशन (≥8,600 xg) द्वारा बाँझ 2 मिलीलीटर माइक्रोप्रतिग्यूज ट्यूब में, सतह पर तैरनेवाला को हटा दें, और पिपेटिंग द्वारा ताजा एलबी शोरबा के 900 μL में सेल गोली को फिर से निलंबित करें।
    2. संस्कृति में 900 μL बाँझ 60% (वी / वी) ग्लिसरॉल जोड़ें और भंवर द्वारा मिलाएं।
    3. मिश्रण को बाँझ 2 एमएल क्रायोजेनिक ट्यूब में ट्रांसफ़र करें और अनिश्चितकाल -80 डिग्री सेल्सियस पर स्टोर करें।
    4. उपयोग करने के लिए, जब्त की एक छोटी राशि को एक बाँझ inoculating लूप और एलबी एजी पर एकल कॉलोनियों के लिए लकीर का उपयोग करें।एआर प्लेटें पूरी तरह से विगलन से संस्कृतियों को रोकने के लिए उपयोग में तुरंत -80 डिग्री सेल्सियस तक जमे हुए स्टॉक लौटाएं। प्लेटें ढक्कन के नीचे से 12 से 16 घंटे 37 डिग्री सेल्सियस पर सेते हैं।
  2. लिक्विड माध्यम में ओवरराइट कल्चर का विकास
    1. जमी स्टॉक से एकल कॉलोनियों (खंड 2.1.4 के अनुसार) के लिए स्ट्रीक एलबी अगर प्लेट्स पर। प्लेटें ढक्कन के नीचे से 12 से 16 घंटे 37 डिग्री सेल्सियस पर सेते हैं।
    2. तरल शोरबा में कॉलोनी को बाँझ लगाने वाला एक स्टिक के साथ एकल कॉलोनी की सतह को छूकर और एकल कॉलोनी के साथ एक बाँझ 10 मिलीलीटर संस्कृति ट्यूब में 4 एमएल तरल एलओबी की सूजन डालना।
    3. 37 डिग्री सेल्सियस पर 12 से 16 घंटे के लिए 225 आरपीएम पर एक प्रकार के बरतन इनक्यूबेटर में वातन के साथ सेते हैं।
  3. ग्रोथ वक्र
    1. तरल एलबी शोरबा में रातोंरात संस्कृति तैयार करें जैसा कि पहले प्रोटोकॉल 2.2 में बताया गया था।
    2. रातोंरात संस्कृति के 250 μL को 2 से स्थानांतरित करके 1: 100 रातोंरात संस्कृति का कमजोर पड़नाएक बाँझ 250 एमएल Erlenmeyer फ्लास्क में ताजा LB शोरबा 5 एमएल।
    3. टीकाकरण (टी 0 ) के समय 600 घन मीटर ( 600 आयुध डिपो) पर प्रति घंटे की तरल संस्कृतियों के ऑप्टिकल घनत्व को मापें।
    4. 375 डिग्री सेल्सियस पर 30 घंटे तक, या जब तक संस्कृति अधिक से अधिक घनत्व तक पहुंच न हो, 225 आरपीएम पर एक प्रकार के बरतन इनक्यूबेटर में वातन में एक 1: 100 कमजोर पड़ना।
    5. ओडी 600 बनाम टाइम को ग्राफ़ करें और प्रत्येक तनाव के लिए लगभग दोहरीकरण समय निर्धारित करने के लिए रैखिक प्रतिगमन का उपयोग करें।
  4. एल टोरी बायोटाइप अस्थिरता उत्पत्ति स्थितियां
    1. जमी स्टॉक से एकल कॉलोनियों के लिए एलबी अगर प्लेट्स पर स्ट्रीक। प्लेटों के ढक्कन की तरफ सेते हैं, जो कि 12 से 16 घंटे 37 डिग्री सेल्सियस पर होता है।
    2. एकल कॉलोनी के साथ 0.03% (w / v) NaHCO 3 वाला एकेआई माध्यम के 10 एमएल का टीका लगाना।
    3. वायुहीनता के बिना 37 डिग्री सेल्सियस 3.5 घंटे के लिए संस्कृति सेते।
    4. संस्कृति के 7 एमएल निकालें और शेष 3 एमएल संस्कृतियों को लेंएक अतिरिक्त 4 घंटे के लिए 225 आरपीएम पर एक प्रकार के बरतन इनक्यूबेटर में वातन के साथ।
  5. क्लासिकल बायोटाइप वीरियलेंस इंड्यूटिंग स्थितियां
    1. जमी स्टॉक से एकल कॉलोनियों के लिए एलबी अगर प्लेट्स पर स्ट्रीक। प्लेटें ढक्कन के नीचे से 12 से 16 घंटे 37 डिग्री सेल्सियस पर सेते हैं।
    2. एकल कॉलोनी के साथ 4 एमएल तरल एलबी ब्रोथ (पीएच 6.5) को टीका डालना
    3. 22 से 25 डिग्री सेल्सियस पर 12 से 16 घंटे के लिए 225 आरपीएम पर एक प्रकार के बरतन इनक्यूबेटर में वातन के साथ सेते हैं।
  6. 1x पीबीएस में सेल गोली धुलाई
    1. पैलेट 1.8 एमएल का रातोंरात संस्कृति के लिए 2 मिनट सेंट्रिफ्यूगेशन (≥8,600 xg) द्वारा बाँझ 2 मिलीलीटर माइक्रोप्रतिग्यूज ट्यूब में और एक विंदुक का उपयोग कर सतह पर तैरनेवाला को हटा दें। 1.8 एमएल 1x पीबीएस pipetting में सेल गोली फिर से निलंबित।
    2. दो बार दोबारा धोने की प्रक्रिया दो बार 1.8 एमएल 1x पीबीएस में अंतिम पुन:

3. वी । कोलरे बायोटाइप

  1. पीसीटीएक्सबी और टीसीपीए का इस्तेमाल करते हुए सीआर-आधारित जेनेटिक स्क्रीन
    1. प्राइमरों का एक सेट डिज़ाइन करें, जो क्रमशः लगभग 50-70 बीपी अपस्ट्रीम और अनुवादित शुरूआत की बहाव और सीटीएक्सबी और टीसीपीए की जगहों को रोकता है।
    2. तरल एलबी शोरबा में रातोंरात संस्कृति तैयार करें जैसा कि पहले प्रोटोकॉल 2.2 में बताया गया था।
    3. ग्राम-नकारात्मक बैक्टीरिया के लिए तैयार वाणिज्यिक रूप से उपलब्ध किट का उपयोग करते हुए गुणसूत्र डीएनए अलग। शुद्ध क्रोमोसोमल डीएनए को -20 डिग्री सेल्सियस पर अनिश्चित काल तक संग्रहीत किया जा सकता है व्यावसायिक रूप से उपलब्ध किट का उपयोग करते हुए क्रोमोसोमल डीएनए अलगाव आम तौर पर लगभग 4 घंटे लगते हैं।
    4. क्रोमोसोमल डीएनए नमूना उच्च गुणवत्ता (एक 260/280 > 1.8) की है यह सुनिश्चित करने के लिए एक माइक्रो-वॉल्यूम स्पेक्ट्रोफोटोमीटर का प्रयोग करें।
    5. प्रत्येक गुणसूत्र डीएनए को अलग करने के लिए, बाँझ 200 μL पीसीआर ट्यूब (एस) में बर्फ पर पोलीमरेज़ श्रृंखला प्रतिक्रिया (पीसीआर) तैयार करें और मानक पीसीआर घटकों का उपयोग कर सीटीएक्सबी और टीसीपीए के क्षेत्रों को बढ़ाएं: Taq polymerase और buएफफेर (या समतुल्य), डीएनटीपी समाधान, और आगे / रिवर्स प्राइमरों मानक पीसीआर पैरामीटर (~ 3 एच) का उपयोग करें उदाहरण के लिए, निम्न प्रोटोकॉल का उपयोग करें:
      1. 120 डिग्री के लिए 95 डिग्री सेल्सियस पर प्रारंभिक विकृत
      2. डेन्चर में 95 डिग्री सेल्सियस के लिए 60 एस
      3. 45 एस के लिए 60 डिग्री सेल्सियस पर एनील प्राइमरों
      4. 90 डिग्री सेल्सियस के लिए 72 डिग्री सेल्सियस पर विस्तार करें
      5. 34 चक्रों के लिए 3.1.5.2 से 3.1.5.4 चरणों को दोहराएं।
      6. 600 एस के लिए अंतिम विस्तार 72 डिग्री सेल्सियस
      7. अनंत पकड़ 4 डिग्री सेल्सियस
    6. एक मानक 6x डीएनए जेल लदान डाई का उपयोग करके संबंधित पीसीआर उत्पाद (ओं) के 5 μ एल डाई करें और 1 केबी की सीढ़ी के लगभग 10 μL और पीसी के उत्पाद के 10 μL को 1x ट्राइस-बोरेट-ईडीटीए (टीबीई) में 1% agarose जेल पर लोड करें। बफर।
    7. जेल वैद्युतकणसंचलन को 130 वी में भागो, जब तक डाई सामने अंत तक पहुंचता है, लेकिन जेल (लगभग 90 मिनट) तक नहीं पहुंचता। निरंतर निगरानी की सिफारिश की जाती है क्योंकि वोल्टेज और चलने का समय उपकरण के आधार पर भिन्न हो सकता है।
    8. सत्यापन के बादअपेक्षित आकार पर सफल पीसीआर प्रवर्धन, शेष 45 μL पीसीआर उत्पाद (एस) को व्यावसायिक रूप से उपलब्ध डीएनए क्लीन एंड कन्स्ट्रक्टर किट का उपयोग करके शुद्ध करें।
    9. अनुक्रम पीसीआर प्रवर्धन के लिए प्रयुक्त एक ही प्राइमरों का उपयोग करके पीसीआर उत्पाद (एस) को साफ किया गया, और प्रति स्थानीय अनुक्रमण सुविधा दिशानिर्देशों के अनुसार तैयार किया गया।
    10. एनसीबीआई वेबसाइट (http://www.ncbi.nlm.nih.gov/gene/) पर उपलब्ध प्रकाशित अनुक्रमों के प्रत्येक से अलग जीन अनुक्रमों के फास्टए प्रारूप की तुलना करें, खोज क्वेरी बॉक्स में निम्नलिखित परिग्रहण संख्याओं को खोज कर।
    11. CtxB : (शास्त्रीय) क्षेत्र VC0395_A1059 के बीच VC0395_A1060 (एल टोरी) VC_1456
    12. टीसीपीए : (शास्त्रीय) VC0395_A0353 (एल तोर) वीसी_0828
  2. खोज के माध्यम से बायोटाइप वर्गीकरण के लिए फीनोटाइपिक एसे
    1. तरल एलबी शोरबा में रातोंरात संस्कृति तैयार करें जैसा कि पहले प्रोटोकॉल 2.2 में बताया गया था।
    2. प्रोटोकॉल 2.6 में निर्दिष्ट के रूप में सेल गोली (एस) धो लें
    3. एक विंदुक का प्रयोग करेंसंबंधित मध्यम पर धोया गया संस्कृति का स्थान 1 μL। मध्यम चयन और ऊष्मायन विनिर्देशों के लिए, तालिका 2 का संदर्भ लें
  3. गतिशीलता परख
    1. तरल एलबी शोरबा में रातोंरात संस्कृति तैयार करें जैसा कि पहले प्रोटोकॉल 2.2 में कहा गया था।
    2. प्रोटोकॉल 2.6 में निर्दिष्ट के रूप में सेल गोली (एस) धो लें
    3. धुँधली तरल संस्कृति में चाकू inoculating और मीडिया में खड़ी "छप" डालने द्वारा गतिशीलता अगर प्लेटों टीका लगाने। प्रत्येक टीकाकरण के बीच में, एक बूनसेन बर्नर का प्रयोग करके तार की थैली को बाँधना, और जब आग लग जाती है, तो सुनिश्चित करें कि इनकोलेटिंग चाकू झुकता नहीं है, क्योंकि यह परिणाम को बदल सकता है।
    4. प्लेटें ढक्कन के ऊपर से 14 से 24 घंटे 37 डिग्री सेल्सियस पर सेते हैं। 14 घंटे के बाद, मॉनिटर गतिशीलता प्लेटें संस्कृतियों के अतिवृद्धि को रोकने के लिए बारीकी से हैं।
  4. वोजेस-प्रोस्काउर (वीपी) परख
    1. तरल एलबी शोरबा में रातोंरात संस्कृति तैयार करें जैसा कि पहले प्रोटोकॉल 2.2 में कहा गया था।
    2. 4 इंजेक्शन करेंपहले से तैयार रातोंरात संस्कृति के 10 μL pipetting द्वारा एक बाँझ संस्कृति ट्यूब में एमआर- VP शोरबा pipetting द्वारा मिथाइल लाल वोग्स- Proskauer या एमआर-वीपी शोरबा एमएल, 12 से 16 के लिए 225 आरपीएम पर एक प्रकार के बरतन इनक्यूबेटर में वातन के साथ सेते हैं घंटे 37 डिग्री सेल्सियस
    3. क्रमशः बाँझ संस्कृति ट्यूबों में एमआर-वीपी रातोंरात संस्कृति के 1 एमएल अलक्षकों को 5% (डब्लू / वी) α-naphthol और 50 μL 40% (w / v) KOH के 150 μL जोड़ें।
    4. संक्षेप में भंवर और रंग परिवर्तन के विकास के लिए कमरे के तापमान पर 4 घंटे तक खड़े हो जाओ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

उचित रखरखाव और किसी भी जीवाणु तनाव का उपयोग करने के लिए, यह ब्याज की तनाव (ओं) के दोगुनी समय को जानने की सिफारिश की जाती है। इस प्रकार, सामान्यतः उपयोग किए जाने वाले वी के अलग-अलग विकास दर कोलरे के तनाव का विकास वक्र के माध्यम से किया गया, और रैखिक प्रतिगमन के द्वारा लगभग दोहरीकरण की गणना की गई। डब्ल्यूटीएल एल टोर एन 16961 और एल टोर संस्करण एमक्यू 1 9 5 (WT) शास्त्रीय ओएल 5 5 (~ 2 एच) ( चित्रा 1 ; तालिका 2 ) की तुलना में कम दोहरीकरण समय (क्रमशः ~ 1 एच और ~ 1 एच) का प्रदर्शन किया।

वी। कोलरे आनुवंशिक हेरफेर और बाद में विश्लेषण अक्सर बायोटाइप के बीच अंतर करने की क्षमता पर निर्भर करता है। पीसीआर आधारित आनुवंशिक स्क्रीन और फ़िनोटीपीक assays सामूहिक रूप से वी के biotype पृष्ठभूमि के बीच भेद के लिए एक विश्वसनीय प्रणाली के रूप में लागू किया गया था। कोलरे नैदानिक ​​और पर्यावरणsolates; प्रतिनिधित्व के लिए, बायोटाइप संदर्भ उपभेदों (डब्लूटी शास्त्रीय ओ 3 9 5, डब्लूटी एल टोर सी 6706, और डब्लूटी एल-टोर एन 1 9 61) और प्रतिनिधि एल टॉर वेरिएंट (एमक्यू 1 9 5 और बीए -2163) शामिल थे ( तालिका 1 )। डब्ल्यूटी शास्त्रीय 3 9 5 शास्त्रीय सीटीएक्सबी और टीसीपीए सीक्वेंस का प्रदर्शन किया। इसके विपरीत, डब्ल्यूटीएल एल टोर नैन एन 16961 और सी 6706 ने एलओआर सीटीएक्सबी और टीसीपीए सीक्वेंस का प्रदर्शन किया। दिलचस्प बात यह है कि, एमक्यू 1 9 5 और बीएए -2163 में शास्त्रीय बायोटाइप सीटीएक्सबी सबयूनिट को ओए 3 9 से तुलनीय किया गया था, फिर भी एलओओ के दोनों प्रकार में एलओएल बायोटाइप पृष्ठभूमि ( टेबल 1 ) का टीसीपीए संकेत दिया गया। डब्ल्यूटीटी शास्त्रीय बायोटाइप तनाव O395 ने पॉलीमीक्सिन बी के प्रति संवेदनशीलता दिखायी, जबकि डब्ल्यूटीएल एल टोर बायोटाइप स्ट्रेंन्स (सी 6706 और एन 1 6 661) ने प्रतिरोध दिखाया और पॉलीमीक्सिन बी के पूरक एलबी अगर प्लेटों पर विकास का प्रदर्शन किया। प्रतिनिधि एल तोर वैरिएंट स्ट्रेन (एमक्यू 1 9 5 और बीएए -2163) का प्रदर्शन डब्ल्यूटीएल एल टोर बायोटाइपस्ट्रा के एंटीबायोटिक रिश्तेदार के समान प्रतिरोधइन (सी 6706 और एन 1 9 61) ( चित्रा 2 ; तालिका 2 )। डब्ल्यूटीटी शास्त्रीय बायोटाइप तनाव O395 न्यूनतम साइट्रेट मीडिया पर नहीं उगता था, जबकि डब्ल्यूटीएल एल टोर स्ट्रेन (सी 6706 और एन -16961) कार्ट्रोन स्रोत के रूप में साइट्रेट का उपयोग करने में सक्षम थे और न्यूनतम साइट्रेट मीडिया पर प्रदर्शन को प्रदर्शित करने में सक्षम थे। प्रतिनिधि एल तोर वैरिएट बायोटाइप स्ट्रेन (एमक्यू 1 9 5 और बीएए -2163) ने डब्ल्यूटीएल एल टोर बायोटाइप स्ट्रेंन्स (सी 6706 और एन 1 6 661) ( चित्रा 3 ; तालिका 2 ) के मुकाबले विकास का प्रदर्शन किया। डब्ल्यूटी शास्त्रीय तनाव O395 और डब्ल्यूटीएल एल तोर तनाव N16961 के पास एक गैर-कार्यात्मक एचएपीआर है, और इस प्रकार एचएपीआर-विनियमित प्रोटीज गतिविधि का प्रदर्शन नहीं किया गया; डब्लूटी एल टोर स्ट्रेन सी 6706, और प्रतिनिधि एल तोर वेरिएंट (एमक्यू 1 9 5 और बीएए -2163) एचपीआर -प्रोजेक्टिव-विज़ुअलाइजेशन के रूप में टीका के बिंदु से निकलने वाली निकासी के क्षेत्र के रूप में ( चित्रा 4 ; तालिका 2 )। डब्ल्यूटी शास्त्रीय तनाव O395 हेमोलिटेक एंजाइम को छिपाना नहीं है और इसके लिए थाई γ-हेमोलीटिक, जबकि डब्ल्यूटीएल एल टोर बायोटाइप तनाव (सी 6706 और एन 1 6 661) और प्रतिनिधि एल तोर वैरिएंट स्ट्रेन (एमक्यू 1 9 5 और बीए -2163) हेमोलिटिक एंजाइम को छिपाना जो पूरी तरह से टीका के बिंदु के आसपास लाल रक्त कोशिकाओं को छूटे और बीओ-हेमोलाइज़िस ( चित्रा 5 ; तालिका 2 ) गतिशीलता बहती है, और भीतर, बायोटाइप तनाव; हालांकि, डब्ल्यूटीएल एल टोर नैन एन 16961 और एल टोर वेरिएंट्स (एमक्यू 1 9 5 और बीए -2163) ने अपेक्षाकृत कम गतिशील डब्ल्यूटीटी शास्त्रीय तनाव O395 और डब्ल्यूटीएल एल टोर तनाव C6706 ( चित्रा 6 ; तालिका 2 ) की तुलना में अति-गतिशीलता का प्रदर्शन किया। डब्ल्यूटीटी शास्त्रीय तनाव O395 और प्रतिनिधि एल टोर वेरिएंट्स ने एसिटोन बनाने के लिए ग्लूकोज का चयापचय नहीं किया, जबकि डब्ल्यूटीएल एल टॉर बायोटाइप तनाव ने ग्लूकोस किण्वन के उप-उत्पाद के रूप में एसिटोन का उत्पादन किया था, जैसा कि वोग्स-प्रोस्काउर परख के दौरान गहरे लाल रंग के विकास के द्वारा दर्शाया गया है ( चित्रा 7 ; तालिका 2 )।

तनाव सीटीएक्सबी जीन TCPA संदर्भ
बेस 115 बेस 203 बायोटाइप बायोटाइप
O395 सी सी क्लासिक क्लासिक 8
C6706 टी टी एल टोर एल टोर 8
N16961 टी टी एल टोर एल टोर 8
MQ1795 सी सी क्लासिक एल टोर 13
BAA-2163 सी सी क्लासिक एल टोर 8

सारणी 1: विब्रियो कोलरे के संदर्भ बायोटिपिप आश्रित आनुवंशिक डिस्टेंस इस तालिका में दिखाया गया डीएनए बेस परिवर्तन और जीन सीटीएक्सबी और टीसीपीए में रिश्तेदार स्थितियां हैं । डब्ल्यूटी शास्त्रीय ओ 3 9 5 और डब्ल्यूटीएल एल टोर नस्लों N16961 और सी 6706 सामान्यतः बायोटाइप संदर्भ उपभेदों का उपयोग किया जाता है। MQ1795 और बीएए -2163 एल टोर नाम से जाना जाता है।

परख आवेदन मध्यम चयन ऊष्मायन अपेक्षित परिणाम
O395 C6706 N16961 MQ1795 BAA-2163
2.3) ग्रोथ वक्र 27 विभिन्न वी। कोलेरे उपभेदों के दोहरीकरण के समय का निर्धारण करता है 1.2) तरल एलबी ब्रोथ अप करने के लिए 30 घंटे (वातन के साथ 37 डिग्री सेल्सियस) ~ 2 घंटे एन डी * ~ 1 घंटे ~ 1 घंटे एन डी *
3.1) सीटीएक्सबी और टीसीपीए 8 का इस्तेमाल करते हुए पीसीआर आधारित जेनेटिक स्क्रीन सीटीएक्सबी के शास्त्रीय और एल टोरी बायोटाइप पृष्ठभूमि के बीच अंतर एन / ए एन / ए क्लासिक एल टोर एल टोर क्लासिक क्लासिक
टीसीपीए के शास्त्रीय और एल टोरी बायोटाइप पृष्ठभूमि के बीच अंतर एन / ए एन / ए क्लासिक एल टोर एल टोर एल टोर एल टोर
3.2) पॉलीमीक्सिन बी प्रतिरोध 21 एंटीबायोटिक पॉलीमीक्सिन बी को संवेदनशीलता 1.5) पॉलीमीक्सिन बी के साथ पूरक एलबी अगर प्लेटें 18 घंटे (37 डिग्री सेल्सियस) - + + + +
3.2) साइटट्रेट मेटाबोलीज़म 22 एकमात्र कार्बन स्रोत के रूप में साइट्रेट को सीटेट करने की योग्यता 1.6) न्यूनतम साइट्रेट मध्यम अगर प्लेटें 24 घंटे (37 डिग्री सेल्सियस) - + + + +
3.2) कैसिइन हाइड्रोलिसिस 23 एचएपीआर-विनियमित प्रोटीज गतिविधि 1.7) दूध अगर प्लेटें 18 घंटे (37 डिग्री सेल्सियस) - - + + +
3.2) हेमोलिसिस 23 उपाय हेमोलाइटिक गतिविधि रक्त अगर प्लेटें 48 घंटे (37 डिग्री सेल्सियस) गामा बीटा बीटा बीटा बीटा
3.3) गतिशीलता 23 गतिशीलता के उपाय डिग्री 1.8) गतिशीलता अगर प्लेटें 14-24 घंटे (37 डिग्री सेल्सियस) 10 मिमी 15 मिमी 21 मिमी 25 मिमी 29 मिमी
3.4) वाोग्स-प्रोस्कॉयर 21 ग्लोकोस को उबालने और उप-उत्पाद के रूप में एसिटिओन का उत्पादन करने की क्षमता 1.9) तरल वाोग्स-प्रोस्काउर मध्यम 4 घंटे तक (कमरे के तापमान) - + + - -
नोट: "एनडी *" का अर्थ निर्धारित नहीं है; "+" एक सकारात्मक परिणाम दर्शाता है; "-" नकारात्मक परिणाम दर्शाता है

तालिका 2: आनुवंशिक और फीनोटाइपिक एसेस के सारांश के लिए उपयोग किया जाता है रिंग > विब्रियो कोलरे बायोटाइप भेद। इस सारणी में विभिन्न आनुवंशिक और फेनोटाइपिक assays, अनुप्रयोगों, और इस अध्ययन में प्रयुक्त शास्त्रीय और एल टोरी बायोटाइप के बीच अंतर करने के लिए सामूहिक रूप से उपयोग किए जाने वाले अपेक्षित परिणाम का सारांश दिया गया है। प्रोटोकॉल संख्याएं और विशिष्ट प्रोटोकॉल के संदर्भ को परख स्तंभ में दर्शाया गया है। "एनडी *" का अर्थ निर्धारित नहीं है; "+" एक सकारात्मक परिणाम दर्शाता है; "-" नकारात्मक परिणाम दर्शाता है

आकृति 1
चित्रा 1: वीकोलरा ग्रोथ कर्व ऑफ़ डब्ल्यूटी क्लासिकल ओ 3 9 5, डब्लूटी एल टोर एन 16961, और एल टोर वैरिएन्ट एमक्यू 1 9 5 बायोटाइप संदर्भ उपभेदों (डब्लूटी शास्त्रीय ओए 3 9 5 और डब्लूटी एल टोर एन 16961) की वृद्धि दर और 37 एल सी शोर से 37 डिग्री सेल्सियस पर उगाए जाने वाले एलओल वैरिएन्ट एमक्यू 1 9 5 का प्रतिनिधि, ओडी 600 ई को मापकर विश्लेषण किया गया।बहुत समय टी 0 से शुरुआत प्रत्येक परीक्षण के लिए एक स्वतंत्र संवर्धन समारोह का प्रतिनिधित्व प्रत्येक प्रतिकृति के साथ, 8 स्वतंत्र प्रायोगिक प्रतिकृतियों पर विकास घटता प्रदर्शन किया गया था डब्ल्यूटी एल टोर नैन एन 16961 और एल टोर वैरिएन्ट एमक्यू 1 9 5 में डब्ल्यूटीटी शास्त्रीय तनाव O395 (~ 2 एच) के सापेक्ष दोगुनी दोगुने के समय (क्रमशः ~ 1 एच और ~ 1 एच) का प्रदर्शन किया गया है, जैसा कि अब दोहरीकरण समय से देखा गया है। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र 2
चित्रा 2: पॉलीमीक्सिन बी प्रतिरोध का निर्धारण पॉलीमीक्सिन बी के साथ पूरक B. पेप्टाइड एंटीबायोटिक पॉलीमीक्सिन बी के प्रतिरोध को 50 आईयू / μL पॉलीमीक्सिन बी डब्ल्यूटीटी शास्त्रीय तनाव O395 के पूरक के साथ एलबी एगर पर विकसित होने की क्षमता से निर्धारित किया गया था। supplपॉलीमीक्सिन बी के साथ पेश किया गया था और एंटीबायोटिक के प्रति संवेदनशील माना जाता था। जबकि डब्ल्यूटीएल एल टोर स्ट्रेन (सी 6706 और एन 1 9 61) और प्रतिनिधि एल तोर वेरिएंट (एमक्यू 1 9 5 और बीए -2163) ने एंटीबायोटिक की उपस्थिति में वृद्धि का प्रदर्शन किया और पॉलीमीक्सिन बी को प्रतिरोधी माना जाता था। प्लेट्स को 18 डिग्री के लिए 37 डिग्री सेल्सियस पर लगाया गया था। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र तीन
चित्रा 3: न्यूनतम साइट्रेट मीडिया का उपयोग करना सीटेट मेसाबोलिज़्म मापना सीटेट को एकमात्र कार्बन स्रोत के रूप में इस्तेमाल करने की क्षमता को कम साइटेट मीडिया पर बढ़ने की अलग-अलग क्षमता से निर्धारित किया गया था। डब्ल्यूटी शास्त्रीय तनाव O395 न्यूनतम साइटेट मीडिया (नकारात्मक) पर नहीं बढ़ता। सभी डब्ल्यूटीएल एल टोर नस्लों (सी 6706 और एन 1 9 61) और प्रतिनिधि एल द्वारा विकास स्पष्ट थाटॉर वेरिएंट (एमक्यू 1 9 5 और बीएए -2163), जिसमें सीटेट को एकमात्र कार्बन स्रोत (पॉजिटिव) के रूप में इस्तेमाल करने की क्षमता का प्रदर्शन किया गया था। 18 घंटे के लिए प्लेट्स 37 डिग्री सेल्सियस पर थे। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्रा 4
चित्रा 4: दूध एगर मीडिया का इस्तेमाल करते हुए एचएपीआर-विनियमित प्रोटेओलेटिक कैसिइन हाइड्रोलिसिस को मापना। एचएपीआर-विनियमित प्रोटीज गतिविधि के माध्यम से कैसिइन हाइड्रोलिसिस को दूध की अगरत पर टीका के आसपास के निकासी के दृश्य क्षेत्र द्वारा निर्धारित किया गया था। डब्ल्यूटीटी शास्त्रीय तनाव O395 और डब्ल्यूटीएल एल टोर नैन एन 66961 जैसी गैर-कार्यात्मक एचएपीआर युक्त तनाव, टीकाकरण ( एचएपीआर- नकारात्मक ) के आसपास के निकासी के एक क्षेत्र का उत्पादन नहीं करता था। डब्लूटी एल टोर स्ट्रेन सी 6706 और प्रतिनिधि एल तोर वेरिएंट (एमक्यू1795 और बीएए -2163) में एक कार्यात्मक एचएपीआर है, जिसे क्लीयरेंस ( एचएपीआर- प्रोजेक्टिव) के आकार के अलग-अलग क्षेत्रों के रूप में देखा जा सकता है। 18 घंटे के लिए प्लेट्स 37 डिग्री सेल्सियस पर थे। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्रा 5
चित्रा 5: ब्लड एगर मीडिया का उपयोग करते हुए हेमोलाइटिक गतिविधि को मापना Hemolytic गतिविधि भेड़ के रक्त के साथ पूरक अगर प्लेटों का उपयोग कर मापा गया था। डब्ल्यूटीटी शास्त्रीय तनाव O395 एंजाइमों को छिपाना नहीं करता है जो कि लाल रक्त कोशिकाओं को (γ-hemolytic) कहते हैं। डब्ल्यूटीएल एल टोर (N16961 और सी 6706) उपभेदों और प्रतिनिधि एल तोर वेरिएंट (एमक्यू 1 9 5 और बीए -2163) हेमोलिटिक एंजाइम को छिपाना, जिसके परिणामस्वरूप टीकाकरण (β-हेमोलीटिक) के आस-पास के निकासी के एक पारभासी क्षेत्र का परिणाम हुआ। प्लेट्स 37 पर incubated थे48 घंटे के लिए डिग्री सेल्सियस इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्रा 6
चित्रा 6: गतिशीलता एगर प्लेट्स का प्रयोग करके गतिशीलता निर्धारित करना। गतिशीलता का क्षेत्र नमक टीटीसी के दृश्य रंग परिवर्तन से संकेत दिया गया था, जो मेटाबोलाइज होने पर स्पष्ट होकर लाल हो जाता है, यह दर्शाता है कि बैक्टीरिया कहाँ चले गए हैं डब्ल्यूटी शास्त्रीय तनाव O395 (10 मिमी) और डब्ल्यू टी एल टोर स्ट्रेन सी 6706 (15 मिमी) ने न्यूनतम गतिशीलता का प्रदर्शन किया, जबकि एल टोर नैन एन 66961 (21 मिमी) और प्रतिनिधि एल तोर वेरिएंट (एमक्यू 1 9 5 (25 मिमी) और बीएए -2163 (2 9 मिमी) ) O395 और C6706 के संबंध में अति-गतिशीलता का प्रदर्शन किया 18 घंटे के लिए प्लेट्स 37 डिग्री सेल्सियस पर थे। फिर से लॉगिन करने के लिएयहाँ इस आंकड़े के एक बड़े संस्करण को देखने के लिए।

चित्रा 7
चित्रा 7: वाोग्स-प्रोस्केवर परख ग्लूकोज किण्वन के माध्यम से एसिटिन उत्पादन को वोग्स-प्रॉस्काउर परख का उपयोग करके निर्धारित किया गया था। डब्ल्यूटीटी शास्त्रीय तनाव O395 और प्रतिनिधि एल तोर वेरिएंट (एमक्यू 1 9 5 और बीएए -2163) ने ग्लूकोज किण्वन (नकारात्मक) के परिणामस्वरूप एसिटोन का उत्पादन नहीं किया। डब्ल्यूटीएल एल टोर नस्लें (एन -16961 और सी 6706) उप-उत्पाद एसीटोन का उत्पादन करती हैं और इसे गहरे लाल रंग परिवर्तन (सकारात्मक) द्वारा देखा जा सकता है। ट्यूब्स कमरे के तापमान पर 4 घंटे के लिए incubated थे इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

Subscription Required. Please recommend JoVE to your librarian.

Discussion

200 से अधिक की पहचान वी । कोलरे सरोग्रुप, केवल O1 और O139 में महामारी संभावित है ओ 1 सरोग्रुप को दो बायोटाइप में विभाजित किया जा सकता है: शास्त्रीय और एल टोर। हालांकि, एल टोर 13 , 17 के रूप में वर्णित हाइब्रिड उपभेदों में उभरा है जो कि एल टोरी की बायोटाइप पृष्ठभूमि वाले हैं, और शास्त्रीय विशेषताओं 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 के बंदरगाहों पर हैं। इस पांडुलिपि में वर्णित प्रोटोकॉल जांचकर्ताओं को प्रदान करने के लिए डिज़ाइन किए गए हैं, जो वी। कोलरा के विभिन्न नैदानिक ​​और गैर-क्लिनिकल आइसोलेट्स को वर्णनात्मक और / या विभेदित करने में रुचि रखते हैं।बहु-परख पहचान प्रणाली वैकल्पिक रूप से एक भरोसेमंद बहु-परख पहचान प्रणाली का उपयोग पहले से स्थापित एकल परख पहचान प्रणालियों और श्रम-गहन आनुवंशिक स्क्रीन पर एक सुधार है। सभी जीनोटाइपिक और फ़िनोटीपिक assays में WT शास्त्रीय तनाव O395 और WT एल टोर तुलना C6706 और N16961 तुलना ( तालिका 1 ) के लिए शामिल करना चाहिए। जबकि शास्त्रीय और एल टोरी बायोटाइप उपभेदों को संदर्भ के लिए शामिल किया गया है, जैसे एमक्यू 1 9 5 और बीएए -2163 जैसे हमारे अध्ययनों में शामिल है, या तो जीनोटाइप ( चित्रा 2 , चित्रा 3 , चित्रा 4 , चित्रा 5 , चित्रा 6 , चित्रा 7 ; तालिका 2 ), भरोसेमंद लक्षण वर्णन के लिए कई जीनोटाइपिक और फ़िनोटीपिक लक्षणों के विश्लेषण की आवश्यकता को दर्शाती है। सभी प्रोटोकॉल को अयोग्यकमरे के तापमान पर 26 , जब तक कि अन्यथा निर्दिष्ट न हो। वी । कोलरे एक बायोसॉफेटी लेवल 2 (बीएसएल -2) रोगज़नक है जो संभावित घातक गैस्ट्रोइंटेस्टाइनल रोग हैजा के एटिऑलजिक एजेंट है; सभी सामग्रियों और अपशिष्ट उत्पादों के उचित नियंत्रण और निपटान को प्रत्येक संस्थागत, स्थानीय, राज्य और संघीय नियमों पर लागू किया जाना चाहिए।

सभी मीडिया और अभिकर्मकों की तैयारी विश्लेषणात्मक ग्रेड अभिकर्मकों और ultrapure पानी का उपयोग करना चाहिए 18 एम.एम.-सेमी की एक न्यूनतम संवेदनशीलता के लिए deionized प्रसंस्करण से पहले, मीडिया को तैयार किया जाना चाहिए और पर्याप्त सूखा (1-2 दिनों) की अनुमति होगी; प्लेटों को सूखा माना जाता है जब कोई अवशिष्ट तरल अगर की सतह पर मौजूद नहीं होती है। मोटीइल रेंज और जीवाणु विकास, गतिशीलता और दूध की प्लेटों के आस-पास के निकासी के क्षेत्रों को बड़े पेट्री डिश (150 मिमी x 15 मिमी) में प्रति प्लेट 50 एमएल तक तैयार किया जाना चाहिए, और इसे प्लास्टिक में लिपटे 1 सप्ताह तक संग्रहीत किया जा सकता है। , लीडी-साइड डाउन 4 डिग्री सेल्सियस इसके अतिरिक्त, गतिशीलता प्लेटों की अगर एकाग्रता को गतिशीलता को धीमा करने के लिए समायोजित किया जा सकता है; हालांकि, 500 एमएल समाधान के लिए अगर प्रति 3 ग्राम से अधिक की सिफारिश नहीं की जाती है, क्योंकि इससे समग्र गतिशीलता में काफी कमी आएगी जैसे कि मतभेद स्पष्ट नहीं होंगे। सभी प्लेट प्लेट मीडिया मानक आकार के पेट्री डिश (100 मिमी x 15 मिमी) में लगभग 25 मिलीलीटर प्रति प्लेट के लिए तैयार होनी चाहिए और प्लास्टिक में लिपटे छह महीने तक 4 डिग्री सेल्सियस पर रखी जा सकती है। पॉलीमीक्सिन बी प्लेटों की तैयारी के लिए, पॉलीमीक्सिन बी जोड़ने से पहले पिघला हुआ मीडिया को आटोक्लेविंग के बाद शांत करने की अनुमति देना महत्वपूर्ण है, क्योंकि अत्यधिक गर्मी एंटीबायोटिक दवाओं को विघटित कर सकती है। पॉलीमीक्सिन बी प्लेट्स को प्लास्टिक में लिपटे 3 महीनों तक संग्रहीत किया जा सकता है, ढक्कन के नीचे 4 डिग्री सेल्सियस पर। इस पांडुलिपि में चर्चा की जाने वाली बैठक में एकल कालोनियों की वृद्धि (12-16 घंटे) के लिए दिन की आवश्यकता होती है, रातोंरात संस्कृतियों (12-16 घंटे) के विकास के लिए एक अतिरिक्त दिन, और जीनोटाइपिक के विचारों के लिए तीसरे दिन (क्रोमोसोमल डीएनएक अलगाव और पीसीआर के लिए ~ 3 एच) या फेनोटाइपिक एश्ले (18-48 घंटे; तालिका 2 )। इस पांडुलिपि में वर्णित phenotypic assays के जैवरासायनिक विश्लेषण से पहले संस्कृतियों को 1x पीबीएस में धोया जाना चाहिए ताकि स्क्विंग परिणाम से अवशिष्ट संस्कृति मीडिया वाहक को रोक दिया जा सके। इसके अतिरिक्त, पॉलीमीक्सिन बी, साइटेट, प्रोटीज गतिविधि, हेमोलाइज़िस, और गतिशीलता एसेल्स को एक साथ धोया रातोंरात संस्कृति के साथ एक साथ टीका लगाया जा सकता है। जब प्लेटेड मीडिया को खोलते हैं, तो संस्कृतियों का छिड़काव हो सकता है और नस्लों के बीच में संदूषण हो सकता है। पप्पी को रोकने के लिए, विंदुक से पूरी तरह से संस्कृति को निकालने से बचें, बजाय विंदुक के पहले स्टॉप पर संस्कृति को बाहर करना बंद करो। इसके अतिरिक्त, ऊष्मायन से पहले की सतह को पूरी तरह अवशोषित करने की अनुमति दें, और सावधानी बरतें कि अगर नतीजों का परिणाम प्रभावित हो सकता है, तो इसका परिणाम प्रभावित हो सकता है। फीनोटाइपिक assays जिसके परिणामस्वरूप निकासी के क्षेत्र ( चित्रा 4 ; चित्रा 5 ; तालिका 2) और / या गतिशीलता ( चित्रा 6 ; तालिका 2 ) टीका लगाने के बिंदु के आसपास, क्रमशः निकासी या विकास के क्षेत्रों में विलय को रोकने के लिए अधिकतर दूरी चाहिए, जिस पर संबंधित व्यास तुलनात्मक विश्लेषण के लिए मापा जा सकता है। संकेतित ऊष्मायन समय के बाद, पृथक को बायोटाइप संदर्भ तनाव (डब्लूटी शास्त्रीय O395, डब्ल्यूटी एल एल सीआर 6706, और डब्लूटी एल टोर एन 16961) के सापेक्ष इमेजेट और विश्लेषण किया जा सकता है।

इस पांडुलिपि में वर्णित अनुक्रमण के माध्यम से पीसीआर-आधारित आनुवंशिक स्क्रीन का उपयोग सीटीएक्सबी और टीसीपीए के संबंध में पृथक बायोटाइप पृष्ठभूमि को पहचानने के लिए किया जा सकता है, प्रारंभिक पीसीआर प्रवर्धन के बाद। मानक अनुक्रमण दिशानिर्देशों के लिए प्रवर्धित क्षेत्र के आकार ( सीटीएक्सबी के लिए 580 बीपी और टीसीपीए के लिए 1420 बीपी) के आधार पर पीसीआर उत्पाद की एक विशिष्ट राशि की आवश्यकता होती है, और प्रतिक्रियाओं को स्थापित करने के लिए, स्थापित प्रोटोकॉल का पालन किया जा सकता है। संक्षेप में, व्यक्तिगत आगे और आरeverse उन्हें क्रमबद्ध प्रतिक्रियाओं प्राइमर / प्रतिक्रिया के 3-5 pmol साथ तैयार किया जाना चाहिए, और वॉल्यूम एक 1.5 एमएल microcentrifuge ट्यूब में बाँझ ultrapure पानी के साथ 20 μl करने के लिए समायोजित किया जाना चाहिए। पीसीआर प्रवर्धन और अनुक्रमण दोनों के लिए प्राइमर डिजाइन में सहायता के लिए, एन सी बी आई प्राइमर डिजाइन उपकरण http://www.ncbi.nlm.nih.gov/tools/primer-blast/ उपयोग किया जा सकता। सफल प्रवर्धन और ctxB और TCPA का अनुक्रमण निम्नलिखित प्राइमरों का उपयोग कर पूरा किया जा चुका है (5 '→ 3'): ctxB- आगे GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB -reverse CATCATCGAACCACAAAAAAGCTTACTGAGG, TCPA -forward CCGCACCAGATCCACGTAGGTGGG, TCPA -reverse GTCGGTACATCACCTGCTGTGGGGGCAG। यह ध्यान देने योग्य है कि ctxB की पूरी कोडिंग क्षेत्र दोनों biotypes भर में संरक्षित है सिवाय आधार के लिए स्थिति 115 और 203 (दोनों अल टो में शास्त्रीय में साइटोसिन और थाइमिन)। साथ ही, TCPA में एकाधिक आधार परिवर्तन biotypes कि d के बीच संरक्षित कर रहे हैंदो बायोटाइप्स ( तालिका 1 ) के पार अगर आफ़ल होना, जो बायोटाइप के बीच भेद करने में मदद के लिए इस्तेमाल किया जा सकता है।

कई प्रयोगशाला के अध्ययन में मॉडल जीव V शामिल हैकोलरा , उचित रखरखाव और संवर्धन तकनीक महत्वपूर्ण हैं 27 आमतौर पर इस्तेमाल किए जाने वाले वी के विकास दर कोलरा बायोटाइप रेफरेंस स्ट्रेन, जैसे डब्ल्यूटी शास्त्रीय तनाव O395 और डब्ल्यूटीएल एल टोर स्ट्रेन एन 16961, एल टोर आइसोलेट्स ( चित्रा 1 ; तालिका 2 ) के लक्षण वर्णन में उपयोगी अंतर्दृष्टि प्रदान कर सकते हैं। V में विविध विकास दर के कारण कोलरे पृथक, हर घंटे तक स्पेक्ट्रोफोटोमीटर शोषक रीडिंग लेना महत्वपूर्ण है, जब तक कि संस्कृतियां देर से स्थिर चरण के दौरान अधिकतम गड़बड़ी तक नहीं पहुंचती हैं। अधिक से सेलुलर मलबे के परिणामस्वरूप मंदता में पठार के कारण मिड-टू-डेथ डेथ चरण की कल्पना नहीं की जा सकती। एल 1: 4 संस्कृति के कमजोर पड़ने पर बाँझ एल बी शोरबा पूरी तरह से विकास वक्र प्राप्त करने के लिए किया जाना चाहिए और साधन की शुद्धता बनाए रखना चाहिए, क्योंकि ओडी 600 ≈ 1.0 पर शोषक रीडिंग शिखर। कई उपभेदों पर विकास घटता प्रदर्शन करते समय, अवशोषण रीडिंग रीडिंग्स के बीच स्थिरता सुनिश्चित करने के लिए प्रत्येक तनाव के लिए लगभग 5 मिनट का समय हो जाना चाहिए। वी को समझना विरस जीन अभिव्यक्ति अध्ययन, चयापचय गतिविधियों का विश्लेषण, और उचित संवर्धन और भंडारण की स्थिति सहित कई जांच के लिए कोलेरे बायोटाइप विकास दर महत्वपूर्ण हैं। बाद के विश्लेषण के लिए, रातोंरात संस्कृतियां विकास के प्रारंभिक चरण (12-16 एच) तक देर से लॉग इन पर संसाधित की जानी चाहिए ताकि सेल की वृद्धि को अधिकतम किया जा सके, फिर भी सेलुलर अखंडता बनाए रखा जा सके।

शास्त्रीय और एल टोरी बायोटाइप उपभेदों के लिए संवर्धित परिस्थितियां समान हैं, तथापि, वी में विषाणु जीन अभिव्यक्ति का विश्लेषण। कोलेरे को बायोटाइप-विशिष्ट खतरा पैदा करने की स्थिति की आवश्यकता होती हैरिफ "> 1 9। दो मुख्य विषाणु कारक सीटी और टीसीपी, मास्टर नियामक टोक्सटी द्वारा नियंत्रित होते हैं, और विशिष्ट विकास की स्थिति के तहत बेहतर रूप से व्यक्त किया जाता है; उदाहरण के लिए, एलओएल वायरलेंस उत्प्रेरण की स्थिति के तहत टोक्सटी को पूरे सेल निकालने की प्रक्रिया से विश्लेषण किया जा सकता है डब्ल्यूसीई) या सेल गोली, 3.5 एच पर है, जबकि सीटी और टीसीपी अभिव्यक्ति का परीक्षण क्रमशः 7.5 एच में सेल-मुक्त सतह पर तैरने वाले और WCE पर किया जा सकता है। इस पांडुलिपि में अलग-अलग जीनोटाइपिक और फ़िनोटाइपिक लक्षण दिखाते हैं कि कैसे विविध विकोलरा बायोटाइप, हो सकता है, और पहले उपयोग किए गए एकल-परख बायोटाइप लक्षण वर्णन के लिए एक विकल्प की आवश्यकता को समझा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgements

एनआईएच के नेशनल इंस्टीट्यूट ऑफ मेडिकल साइंसेज से एक संस्थागत विकास पुरस्कार (आईडीईए), पी 20GM103506 के माध्यम से न्यू हैम्पशायर-इनब्रे द्वारा समर्थित अनुसंधान

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics