Técnicas de laboratório usadas para manter e diferenciar biótipos de * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este manuscrito descreve as técnicas adequadas de manutenção de Vibrio cholerae , além de uma série de ensaios bioquímicos, utilizados coletivamente para a diferenciação rápida e confiável entre a V clínica e ambiental. Biótipos de cholerae em um ambiente de laboratório.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

A bactéria aquática Gram-negativa Vibrio cholerae é o agente etiológico da doença gastrointestinal infecciosa cólera. Devido à prevalência global e à gravidade desta doença, V. Cholerae tem sido amplamente estudado em ambientes ambientais e laboratoriais, exigindo técnicas adequadas de manutenção e cultura. Classical e El Tor são dois biótipos principais que compõem o V. Serogrupo de cholerae O1, cada um apresentando características genotípicas e fenotípicas únicas que fornecem mecanismos confiáveis ​​para a caracterização de biótipos e requerem indução de condições de cultivo que induzem a virulência. Independentemente do biótipo da tensão causadora para qualquer infecção ou surto, o tratamento padrão para a doença envolve a terapia de reidratação suplementada com um regime de antibióticos. No entanto, a classificação do biótipo pode ser necessária para estudos laboratoriais e pode ter impactos mais amplos no campo biomédico.No início de 2000, foram identificados isolados clínicos que exibem traços genotípicos e fenotípicos de biótipos clássicos e El Tor. Os híbridos recentemente identificados, denominados variantes de El Tor, fizeram com que a identificação de biótodos isolados clínicos e ambientais se tornasse mais complexa do que os protocolos tradicionais de identificação de ensaio simples. Além de descrever V. Técnicas de manutenção e cultura geral de cholerae , este manuscrito descreve uma série de ecrãs genéticas baseadas em PCR específicas para genes ( ctxB e tcpA ) e testes fenotípicos (resistência a polimixina B, metabolismo de citrato, atividade proteolítica, atividade hemolítica, motilidade e metabolismo de glicose através de Voges- Ensaio Proskauer) usado coletivamente para caracterizar e / ou distinguir entre biótipos clássicos e El Tor. Juntos, esses ensaios fornecem uma abordagem sistemática eficiente para ser usada como alternativa ou, além disso, em experiências caras e intensivas em mão-de-obra na caracterizaçãoÇão de V. Isolados clínicos (e ambientais) de cholerae .

Introduction

A cólera é uma doença do intestino delgado distal causada pelo consumo de alimentos contaminados ou água contendo a bactéria Gram-negativa Vibrio cholerae aquática. Os sintomas da cólera incluem vômitos e diarréia aquosa incontrolável, levando a desidratação severa, que, se não for tratada adequadamente, resultará em morte. V. Cholerae pode ser dividido em mais de 200 serogrupos com base na estrutura do antígeno O de lipopolissacarídeo de superfície celular. No entanto, apenas 2 sorogrupos, O1 e O139, mostraram potencial epidêmico ou pandêmico 1 , 2 . Além disso, o serogrupo O139 foi isolado principalmente no Sudeste Asiático 3 , 4 , enquanto o serogrupo O1 está distribuído em todo o mundo. Além disso, o sorogrupo O1 pode ser dividido em 2 biótipos principais: clássico e El Tor. O biótipo clássico foi responsável pela primeira pandemia de cólera 6Entre 1817 e 1923. A sétima pandemia em curso é resultado do biótipo El Tor, que deslocou globalmente o biótipo clássico no ambiente 5 , 6 , 7 . Recentemente, surgiram tensões que contêm características distintivas dos biótipos clássicos e El Tor 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 e desde então foram denominadas variantes 13 , 17 de El Tor. Algumas variantes de El Tor demonstraram capacidades de virulência elevadas com progressão de doença mais rápida e grave do que a observada anteriormente, enfatizandoA necessidade de uma abordagem mais abrangente para identificação de agentes e prevenção e tratamento de doenças 8 , 9 , 18 . Embora a identificação do biótipo não dê de imediato o tratamento, os avanços no desenvolvimento da vacina e nos futuros agentes terapêuticos podem beneficiar da distinção biótipo.

A primeira série de protocolos listados aqui permitirá que os investigadores mantenham corretamente V. Cepas de cólera em um ambiente de laboratório. Consistência e análise subseqüente requerem a preparação de estoque e o crescimento de isolados, o que não é biótipo-dependente. No entanto, para induzir de forma otimizada a expressão de genes de virulência, são necessárias técnicas de cultura de bioótipo independentes 19 . Além disso, a preparação para vários ensaios genéticos e bioquímicos é descrita neste manuscrito.

A toxina da cólera (CT) e a toxina co-rePilula gulosa (TCP) são dois principais fatores de virulência controlados pelo regulador mestre ToxT em ambos biótipos do V. Serogrupo 20 de cholerae O1. CT é uma toxina bipartida composta por cinco CtxB Subunidades envolvendo uma única subunidade CtxA, e é responsável pela perda rápida de eletrólito associada à cólera. TCP é um pilus tipo IV codificado pelo operão tcp ( tcpABQCRDSTEF ), e está envolvido na fixação e colonização do intestino delgado distal. TcpA é o primeiro gene do operão tcp que codifica as subunidades individuais de pilina essenciais para a construção do pilus 8 . A sequência de genes para ctxA é completamente conservada entre biótipos clássicos e El Tor, enquanto ctxB e tcpA diferem entre os dois biótipos, mas são conservados dentro de cada biótipo 8 . CtxB é completamente conservado entre biótipos, exceto em dois pontos básicos(115 e 203). No biótipo de El Tor, a timina reside nas posições de base 115 e 203, enquanto o biótipo clássico contém citosina nestas bases. TcpA é completamente conservado dentro de cada biótipo, mas diferem em bases múltiplas entre biótipos. Essas distinções genéticas servem como marcadores primários de identificação de biótipo e, depois de seqüenciar o produto de amplificação da reação em cadeia da polimerase (PCR), incluindo esses locais, as seqüências isoladas podem ser comparadas com O395 ou WT El Tor N16961 de tipo selvagem (WT) para determinar o fundo do biótipo De CT e TCP, respectivamente, em um isolado de V. cholerae .

Numerosos protocolos foram desenvolvidos para caracterizar as distinções fenotípicas entre os biótipos clássicos e El Tor 21 , 22 , 23 . A polimixina B é um antibiótico peptídico que compromete a integridade da membrana celular externa em bactérias Gram-negativasE a resistência à polimixina B podem ser visualizadas através do ensaio de resistência à polimixina B 21 . O citrato é um substrato primário do ciclo do Kreb e a capacidade de metabolizar o citrato como única fonte de carbono pode ser determinada utilizando o ensaio de metabolismo de citrato 22 . HapR codifica um regulador global e o regulador mestre de sensor de quorum em V. cholerae, HapR, que se liga a várias regiões promotoras e regula a expressão de genes e operões 24 . Algumas cepas patogênicas de V. cholerae têm uma mutação de mudança de quadro natural no gene hapR que causou a perda da densidade da expressão de genes da virulência 24 , 25 . Medir a atividade de protease regulada por HapR usando meios de agar de leite permite ao pesquisador identificar se um isolado particular contém um HapR 23 funcional. oTestes de análise de hemólise para a capacidade de uma cepa de secretar enzimas hemolíticas que lisam glóbulos vermelhos; O grau de hemólise pode ser visualizado em placas de agar de sangue 23 . A mobilidade é freqüentemente associada à virulência em V. cholerae e pode ser analisada usando placas de ágar de motilidade 23 . O teste de Voges-Proskauer prova a capacidade de uma cepa para fermentar a glicose como única fonte de carbono e produzir o acetato de subproduto 21 . Com o surgimento de variantes de El Tor, é difícil prever os resultados de qualquer teste fenotípico dado sem rastreio genotípico extensivo e antes de deduzir o fundo biótipo de V. Isolados de cholerae , recomenda-se a realização desta montagem de ensaios 23 e compare os resultados com as cepas de referência como na Tabela 2 .

Aqui, avançamos uma série de protocolos, utilizando coletivamente o referidoEnsaios fenotípicos e fenotípicos referentes a uma abordagem mais abrangente para a caracterização de V. Biótipos de cólera . Além disso, descrevemos as distinções genotípicas e fenotípicas do V conhecido. Variantes de cholerae El Tor (MQ1795 e BAA-2163), em comparação com as estirpes de referência de biótopos comummente usadas (WT clássico O395, WT El Tor C6706 e WT El Tor N16961, Tabela 1 ). O surgimento de variantes de El Tor apresentou desafios à confiabilidade de protocolos de caracterização de bióto simples de ensaio previamente empregados; No entanto, este sistema de identificação de múltiplos ensaios permitirá uma caracterização mais confiável do V clínico e ambiental. Isolados de cólera .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: As considerações de tempo para cada ensaio devem ser feitas uma vez que as preparações de mídia individuais exigem tempos diferentes. Por exemplo, meios sólidos de placas de ágar devem ser deixados suficientemente arrefecer e secar (1-2 dias). Considerações de tempo adicionais ( isto é, colônia única e crescimento da cultura durante a noite) são especificadas em cada protocolo e são encontradas na Tabela 2 .

1. Preparação de mídia

  1. 1x solução salina tamponada com fosfato (PBS)
    1. Pesar 4,0 g de NaCl, 0,1 g de KCl, 0,72 g de Na2HPO4 e 0,12 g de KH2PO4. Combine os constituintes em um frasco Erlenmeyer de 1 L, ajuste o volume para 500 mL com água desionizada, ajuste o pH para 7,2 usando um medidor de pH e adicione HCl gota a gota à solução, e autoclave ou filtre a esterilização usando um filtro de 0,22 μm. 1x PBS pode ser armazenado à temperatura ambiente indefinidamente.
      CUIDADO: O HCl é um ácido concentrado e deve ser manuseado de acordo comPara regulamentos institucionais, locais, estaduais e federais. Para obter as orientações de manuseio adequadas, consulte a ficha de dados de segurança fornecida pelo fabricante.
  2. Luria-Bertani (LB) Caldo
    1. Pesar 5,0 g de triptona, 2,5 g de extrato de levedura e 2,5 g de NaCl. Combine os constituintes em uma garrafa de 1 L, ajuste o volume para 500 mL com água desionizada, autoclave e armazene à temperatura ambiente por até 6 meses. Para condições clássicas de indução de virulência de biótipo, ajuste o pH para 6,5 ​​usando HCl antes do autoclave.
  3. Meio AKI contendo 0,03% (p / v) de NaHCO3
    1. Para Componente 1 (meio AKI): pesa 7,5 g de peptona, 2,0 g de extracto de levedura e 2,5 g de NaCl. Combine os constituintes em uma garrafa de 1 L, ajuste o volume para 450 mL com água desionizada e autoclave. O meio AKI pode ser armazenado à temperatura ambiente por até 6 meses.
    2. Para Componente 2 (NaHCO 3 ): pesa 1,5 g de NaHCO 3 e ajuste o volumeA 50 mL com água desionizada em uma vesícula estéril. Filtre a esterilização de NaHCO 3 usando um filtro de 0,22 μm. NaHCO 3 deve ser preparado imediatamente antes da utilização.
    3. Combine aspticamente os dois componentes criando uma relação de 1:10, filtrando o Componente 2 no Componente 1 antes de usar.
  4. Placas de agar de Luria-Bertani (LB)
    1. Pesar 5,0 g de triptona, 2,5 g de extracto de levedura, 2,5 g de NaCl e 7,5 g de ágar. Combine os constituintes em um frasco Erlenmeyer de 1 L, ajuste o volume para 500 mL com água desionizada, autoclave e prepare-se em placas de Petri esterilizadas de tamanho normal de 100 mm x 15 mm. A mídia chapeada pode ser armazenada em plástico por até 6 meses, com a tampa aberta a 4 ° C.
  5. Placas de Agar LB suplementadas com polimixina B
    1. Para Componente 1 (agar LB): pesa 5,0 g de triptona, 2,5 g de extracto de levedura, 2,5 g de NaCl e 7,5 g de ágar. Combine os constituintes em um frasco Erlenmeyer de 1 L, ajuste o volume para 500 mL wiÁgua desionizada e autoclave.
    2. Para o Componente 2 (polimixina B): dissolver a polimixina B em água desionizada em um tubo de microcentrífuga estéril de 2 mL até uma concentração de 50 000 UI / μL e esterilizar o filtro usando um filtro de 0,22 μm.
    3. Uma vez que o Componente 1 é frio ao toque, mas ainda não solidificado, adicione assépticamente 500 μL de Componente 2 ao Componente 1 criando uma concentração final de 50 UI / μL e misture bem. Prepare-se em placas de Petri estéril padrão de 100 mm x 15 mm, despejando meios misturados de agar nos pratos de Petri. A mídia revestida pode ser armazenada em plástico por até 3 meses, com a tampa aberta a 4 ° C.
  6. Pratos de Agar Médio de Citrato Mínimo
    1. Para Componente 1 (agar com azul de bromotimol): pesa 7,5 g de ágar e 0,02 g de azul de bromotimol. Combine os constituintes em um frasco Erlenmeyer de 1 L, ajuste o volume para 450 mL com água desionizada e autoclave a mistura.
    2. Para Componente 2 (10x VBMM): pesa 10,00 g de MgSO4 7H2O, 10,0 g de ácido cítrico H2O, 50,0 g de K 2 HPO 4 anidro e 17,5 g de NaNH 4 HPO 4 4H 2 O. Combine os constituintes em um frasco Erlenmeyer de 1 L, ajuste o volume para 500 mL Com água desionizada e autoclave ou filtro esterilizado usando um filtro de 0,22 μm. VBMM 10x pode ser armazenado a temperatura ambiente até 6 meses.
    3. Adicione 50 mL do Componente 2 ao Componente 1 e prepare-se em placas de Petri esterilizadas de tamanho padrão de 100 mm x 15 mm, despejando meios de agar misturados nas placas de Petri. A mídia chapeada pode ser armazenada em plástico por até 6 meses, com a tampa aberta a 4 ° C.
  7. Pratos de Agar de Leite
    1. Para o Componente 1 (leite): pesar 8,0 g de leite seco sem gordura instantânea em um frasco Erlenmeyer de 1 L, ajuste o volume para 200 mL com água desionizada e autoclave.
    2. Para Componente 2 (agar com infusão cérebro-coração): pesa 3.68 g de infusão cérebro-coração e 6,0 g de ágar. Combine o conEm um balão Erlenmeyer de 500 mL, ajuste o volume para 200 mL com água desionizada e autoclave.
    3. Combine os dois componentes despejando o Componente 2 no Componente 1, depois de se autoclavar e misture bem. Prepare em placas de Petri estéril de 150 mm x 15 mm. As placas de leite podem ser armazenadas por até uma semana em plástico, lado da tampa para baixo a 4 ° C. Prepare-se em placas de Petri estéril de 150 mm x 15 mm, despejando meios de agar misturados nas placas de Petri.
  8. Placas de Agar Motilidade
    1. Para o Componente 1 (agar LB): pesa 5,0 g de triptona, 2,5 g de extracto de levedura, 2,5 g de NaCl e 2,0 g de ágar. Combine os constituintes em um frasco Erlenmeyer de 1 L, ajuste o volume para 500 mL com água desionizada e autoclave.
    2. Para o Componente 2 (cloreto de trifeniltetrazólio de 1% (p / v); TTC): pesar 0,25 g TTC. Ajuste o volume para 25 mL com água desionizada em uma vesícula estéril e filtre-se esterilizando usando um filtro de 0,22 μm. Armazenar até 6 meses a temperatura ambiente embrulhadoEm papel alumínio para minimizar a exposição à luz.
    3. Adicione 2,5 mL de TTC estéril a 1% (p / v) a mídia autoclavada.
    4. Despeje a mídia tão grossa quanto possível (≥50 mL / placa) em grandes placas de Petri estéril de 150 mm x 15 mm. A mídia revestida pode ser armazenada em plástico por até uma semana, com a tampa aberta a 4 ° C. Prepare-se em placas de Petri estéril de 150 mm x 15 mm, despejando meios de agar misturados nas placas de Petri.
  9. Voges-Proskauer (VP)
    1. Para o Componente 1 (caldo Metil Red-Voges-Proskauer, MR-VP): pesa 1,7 g de meio MR-VP em um balão Erlenmeyer de 500 mL, ajuste o volume para 100 mL com água desionizada e autoclave. O resíduo esterilizado MR-VP pode ser armazenado à temperatura ambiente por até 6 meses.
    2. Para Componente 2 (5% (p / v) alfa (α) naftol): pesa 1,0 g de a-naftol em uma vesícula estéril e ajuste o volume para 20 mL com etanol a 95%. O α-naftol pode ser armazenado à temperatura ambiente por até 1 semana envolvido em papel alumínio para minimizar a luz expOsure.
    3. Para o Componente 3 (40% (p / v) de hidróxido de potássio; KOH): pesar 20,0 g de KOH em uma vesícula estéril, ajustar o volume para 50 mL com água desionizada estéril. KOH pode ser armazenado por até 6 meses a temperatura ambiente em um recipiente de plástico.

2. Manutenção e crescimento de V. Cepas de cólera

  1. Preparação e Uso de Culturas de Stockes Frozen
    1. Pellet 1,8 mL de cultura líquida durante a noite por 2 min por centrifugação (≥8,600 xg) em um tubo de microcentrífuga estéril de 2 mL, remover o sobrenadante e voltar a suspender o sedimento celular em 900 μL de caldo LB fresco por pipetagem.
    2. Adicione 900 μL de glicerol esterilizado a 60% (v / v) à cultura e misture por vortex.
    3. Transfira a mistura para um tubo criogênico esterilizado de 2 mL e armazene indefinidamente a -80 ° C.
    4. Para usar, remova uma pequena quantidade de estoque congelado usando um loop de inoculação estéril e uma série para colônias individuais em LB agAr chapas. Volte imediatamente o estoque congelado a -80 ° C após o uso para evitar que as culturas descongelam completamente. Incube as placas do lado da tampa para baixo durante 12 a 16 h a 37 ° C.
  2. Crescimento de culturas durante a noite em meio líquido
    1. Streak para colônias únicas (de acordo com a seção 2.1.4) de estoque congelado em placas de agar LB. Incube as placas do lado da tampa para baixo durante 12 a 16 h a 37 ° C.
    2. Inocule 4 mL de caldo LB líquido em um tubo de cultura estéril de 10 mL com uma única colônia, tocando a superfície da colônia única com uma vara de aplicador estéril e transferindo a colônia para o caldo líquido.
    3. Incubar com aeração em uma incubadora de agitador a 225 rpm durante 12 a 16 h a 37 ° C.
  3. Curva de crescimento
    1. Prepare a cultura durante a noite em caldo LB líquido, conforme descrito anteriormente no protocolo 2.2.
    2. Faça uma diluição 1: 100 de cultura durante a noite transferindo 250 μL de cultura durante a noite para 25 mL de caldo LB fresco num balão Erlenmeyer esterilizado de 250 mL.
    3. Medir a densidade óptica das culturas líquidas a 600 nm (OD 600 ) a cada hora a partir do momento da inoculação (T 0 ).
    4. Incubar uma diluição 1: 100 de cultura durante a noite com aeração em uma incubadora de agitador a 225 rpm até 30 h a 37 ° C, ou até que a cultura alcance a densidade máxima.
    5. Grafique o OD 600 vs. Tempo e use regressão linear para determinar o tempo de duplicação aproximado para cada estirpe.
  4. El Tor Biotype Virulence Inducing Conditions
    1. Streak para colônias únicas de estoque congelado em placas de agar LB. Incube as placas com o lado da tampa para baixo, durante 12 a 16 h a 37 ° C.
    2. Inocular 10 mL de meio AKI contendo 0,03% (p / v) de NaHCO3 com uma única colónia.
    3. Incubar cultura sem aeração a 37 ° C durante 3,5 h.
    4. Remova 7 mL de cultura e incuba os 3 mL restantes de cultuRe com aeração em uma incubadora de agitador a 225 rpm por mais 4 h.
  5. Condições Clínicas de Indução de Virulência de Biótipo
    1. Streak para colônias únicas de estoque congelado em placas de agar LB. Incube as placas do lado da tampa para baixo durante 12 a 16 h a 37 ° C.
    2. Inocule 4 ml de caldo líquido LB (pH 6,5) com uma única colônia.
    3. Incubar com aeração em uma incubadora de agitação a 225 rpm durante 12 a 16 h a 30 ° C.
  6. Pellet de células de lavagem em 1x PBS
    1. Pellet 1,8 mL de cultura durante a noite por 2 min por centrifugação (≥8,600 xg) num tubo de microcentrífuga estéril de 2 mL e remova o sobrenadante usando uma pipeta. Re-suspender o sedimento celular em 1,8 mL 1x PBS por pipetagem.
    2. Repita o procedimento de lavagem três vezes seguido de uma ressuspensão final em 1,8 mL 1x PBS.

3. Caracterizando V. Biótipos de cólera

  1. PTelas genéticas baseadas em CR usando ctxB e tcpA
    1. Desenhe um conjunto de primers, que recozem aproximadamente 50-70 pb a montante e a jusante dos locais de inicialização e parada de translação de ctxB e tcpA , respectivamente.
    2. Prepare a cultura durante a noite em caldo LB líquido, conforme descrito anteriormente no protocolo 2.2.
    3. Isolar DNA cromossômico usando um kit comercialmente disponível projetado para bactérias Gram-negativas. O DNA cromossômico purificado pode ser armazenado indefinidamente a -20 ° C. O isolamento de DNA cromossômico usando kits comercialmente disponíveis geralmente leva cerca de 4 h.
    4. Use um espectrofotômetro de micro-volume para garantir que a amostra de DNA cromossômico seja de alta qualidade (A 260/280 > 1,8).
    5. Para cada isolado de DNA cromossômico, prepare a (s) reação (s) em cadeia da polimerase (PCR) no gelo em tubos de PCR de 200 μL estéreis e amplifique as regiões de ctxB e tcpA usando componentes de PCR padrão: Taq polymerase and buFfer (ou equivalentes), solução dNTP e primers forward / reverse. Use parâmetros de PCR padrão (~ 3 h). Por exemplo, use o seguinte protocolo:
      1. Desnaturação inicial a 95 ° C por 120 s.
      2. Desnaturação a 95 ° C por 60 s.
      3. Imprima os iniciadores a 60 ° C por 45 s.
      4. Estende-se a 72 ° C por 90 s.
      5. Repita as etapas 3.1.5.2 até 3.1.5.4 para 34 ciclos.
      6. Extensão final 72 ° C por 600 s.
      7. Suporte infinito a 4 ° C.
    6. Dye 5 μL de produto (s) de PCR respectivo (s) utilizando um corante de carga de gel de ADN 6x padrão e carrega aproximadamente 10 μL de escada de 1 kb e 10 μL de produto de PCR num gel de agarose a 1% em 1x Tris-Borate-EDTA (TBE) amortecedor.
    7. Execute a eletroforese em gel a 130 V até a frente do corante atingir a extremidade, mas não desligada, do gel (aproximadamente 90 min). O monitoramento constante é recomendado porque a tensão e os tempos de funcionamento podem variar dependendo do equipamento.
    8. Após verificação deAmplificação de PCR bem sucedida no tamanho esperado, purifique os demais produtos de PCR de 45 μL usando um kit de limpeza e concentrado de DNA comercialmente disponível.
    9. Produto (s) de PCR limpo de seqüência usando os mesmos primers utilizados para amplificação por PCR e prepara-se por diretrizes de facilidade de seqüenciamento local.
    10. Compare o formato FASTA das sequências de genes de cada isolado para a seqüência publicada disponível no site do NCBI (http://www.ncbi.nlm.nih.gov/gene/), pesquisando os seguintes números de acesso na caixa de consulta de pesquisa.
    11. CtxB : região (clássica) entre VC0395_A1059 a VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (clássico) VC0395_A0353 (El Tor) VC_0828
  2. Ensaios fenotípicos para a classificação do biótipo através da mancha
    1. Prepare a cultura durante a noite em caldo LB líquido, conforme descrito anteriormente no protocolo 2.2.
    2. Lavar a (s) pastilha (s) de células conforme especificado no protocolo 2.6.
    3. Use uma pipeta paraDetectar 1 μL de cultura lavada no respectivo meio. Para as especificações de seleção e incubação médias, consulte a Tabela 2.
  3. Ensaio de Motilidade
    1. Prepare a (s) cultura (s) durante a noite no caldo LB líquido, como indicado anteriormente no protocolo 2.2.
    2. Lavar a (s) pastilha (s) de células conforme especificado no protocolo 2.6.
    3. Inocule as placas de agar de motilidade inserindo inoculação de facada na cultura líquida lavada e "stab" verticalmente na mídia. Entre cada inoculação, esterilize a faca através de um queimador de Bunsen e, quando apanhar agar, assegure-se de que a faca de inoculação não se dobre, pois isso pode alterar os resultados.
    4. Incubar as placas do lado da tampa para cima durante 14 a 24 h a 37 ° C. Após 14 h, monitore as placas de motilidade de perto para evitar o crescimento excessivo de culturas.
  4. Ensaio Voges-Proskauer (VP)
    1. Prepare a (s) cultura (s) durante a noite no caldo LB líquido, como indicado anteriormente no protocolo 2.2.
    2. Inocular 4ML de caldo de Voges-Proskauer de metal vermelho ou caldo MR-VP, por pipetagem de 10 μL de cultura durante a noite previamente preparada em 4 mL de caldo de MR-VP em um tubo de cultura estéril e incuba com aeração em uma incubadora de agitador a 225 rpm por 12 a 16 H a 37 ° C.
    3. Adicionar 150 μL de α-naftol a 5% (p / v) e 50 μL de KOH a 40% (p / v) a 1 mL de alíquotas de RM-VP durante a noite, em tubos de cultura estéril, respectivamente.
    4. Em breve vortex e deixe repousar a temperatura ambiente por até 4 h até a mudança de cor se desenvolver.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Para uma manutenção e uso adequados de qualquer tensão bacteriana, recomenda-se conhecer o tempo de duplicação da (s) tensão (ões) de interesse. Aqui, as taxas de crescimento variáveis ​​dos V comummente utilizados . As cepas de colesterol foram demonstradas através de uma curva de crescimento, e tempos de duplicação aproximados foram calculados usando regressão linear. WT El Tor N16961 e a variante El Tor MQ1795 demonstraram tempos de duplicação mais curtos (~ 1 h e ~ 1 h, respectivamente) do que WT clássico O395 (~ 2 h) ( Figura 1 , Tabela 2 ).

A manipulação genética de V. cholerae e análises subseqüentes freqüentemente dependem da habilidade de distinguir adequadamente entre biótipos. As telas genéticas baseadas em PCR e os ensaios fenotípicos foram implementados coletivamente como um sistema confiável para distinguir entre os fundos bióticos de V. Cholerae clínico e ambiental iSolados; Para a representação, foram incluídas as estirpes de referência de biótipo (WT clássico O395, WT El Tor C6706 e WT El Tor N16961) e as variantes representativas de El Tor (MQ1795 e BAA-2163) ( Tabela 1 ). WT clássico O395 demonstrou as seqüências clássicas ctxB e tcpA. Por outro lado, WT El Tor estirpe N16961 e C6706 demonstraram El Tor ctxB e tcpA sequências. Curiosamente, MQ1795 e BAA-2163 continham a subunidade clássica de biótipo ctxB comparável ao O395, no entanto ambas as variantes de El Tor continham o indicador tcpA do fundo do biotipo El Tor ( Tabela 1 ). A estirpe de biótipo clássico WT O395 mostrou sensibilidade à polimixina B, enquanto que as estirpes de biótipo de WT El Tor (C6706 e N16961) apresentaram resistência e exibiram crescimento em placas de agar LB suplementadas com polimixina B. As cepas variáveis ​​representativas de El Tor (MQ1795 e BAA-2163) demonstraram Resistência semelhante ao antibiótico em relação ao biótipo WT El TorIns (C6706 e N16961) ( Figura 2 ; Tabela 2 ). A estirpe de biótipo clássico WT O395 não cresceu em meios de citrato mínimos, enquanto as estirpes de WT El Tor (C6706 e N16961) puderam utilizar o citrato como fonte de carbono e exibiam crescimento em meios de citrato mínimos. As estirpes representativas do biótipo da variante de El Tor (MQ1795 e BAA-2163) demonstraram crescimento comparável ao das estirpes de biótipo WT El Tor (C6706 e N16961) ( Figura 3 , Tabela 2 ). A estirpe clássica WT O395 e a estirpe N16961 de WT El Tor possuem um HapR não funcional e, portanto, não demonstraram atividade de protease regulada por HapR; A estirpe C6706 de WT El Tor e as variantes representativas de El Tor (MQ1795 e BAA-2163) são visualizadas positivamente em hapR como uma zona de depuração que emana do ponto de inoculação ( Figura 4 , Tabela 2 ). A estirpe clássica WT O395 não secreta enzimas hemolíticas e foi por issoE γ-hemolítico, enquanto que as estirpes de biótipos de WT El Tor (C6706 e N16961) e as estirpes representativas de El Tor (MQ1795 e BAA-2163) secretam enzimas hemolíticas que liam completamente os glóbulos vermelhos em torno do ponto de inoculação e mostraram hemólise β ( figura 5 ; Tabela 2 ). A mobilidade varia em toda e dentro de cepas de biótipos; No entanto, WT El Tor estirpe N16961 e El Tor variantes (MQ1795 e BAA-2163) demonstraram hiper-motilidade quando comparados com o relativamente menos móvel WT clássico estirpe O395 e WT El Tor estirpe C6706 ( Figura 6 , Tabela 2 ). A estirpe clássica WT O395 e as variantes representativas de El Tor não metabolizaram a glicose para produzir acetoin, enquanto as estirpes do biótipo de WT El Tor produziram acetoin como subproduto da fermentação da glicose, como indicado pelo desenvolvimento de uma cor vermelha profunda durante o ensaio de Voges-Proskauer ( Figura 7 Tabela 2 ).

Tensão Gene ctxB TcpA Referência
Base 115 Base 203 Biótipo Biótipo
O395 C C clássico clássico 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C clássico El Tor 13
BAA-2163 C C clássico El Tor 8

Tabela 1: Distinções genéticas dependentes de biótipo de cepas de referência de Vibrio cholerae . Mostrado nesta tabela são as mudanças de base de DNA e posições relativas nos genes ctxB e tcpA . As estirpes WT clássicas O395 e WT El Tor N16961 e C6706 são estirpes de referência de biótipos comumente usadas. MQ1795 e BAA-2163 são conhecidas variantes de El Tor.

Ensaio Aplicação Seleção média Incubação resultados esperados
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Curva de crescimento 27 Determina os tempos de duplicação de várias cepas de V. cholerae 1.2) Caldo líquido LB Até 30 h (37 ° C com aeração) ~ 2 h ND * ~ 1 h ~ 1 h ND *
3.1) Tela genética baseada em PCR usando ctxB e tcpA 8 Diferencia entre os fundos do biótipo clássico e El Tor de ctxB N / D N / D clássico El Tor El Tor clássico clássico
Diferencia entre os fundos do biótipo clássico e El Tor de tcpA N / D N / D clássico El Tor El Tor El Tor El Tor
3.2) Resistência à polimixina B 21 Sensibilidade ao antibiótico polimixina B 1,5) placas de agar LB suplementadas com polimixina B 18 h (37 ° C) - + + + +
3.2) Metabolismo Citrato 22 Capacidade de metabolizar o citrato como única fonte de carbono 1.6) Placas de ágar de citrato mínimas 24 h (37 ° C) - + + + +
3.2) Hidrólise da Caseína 23 Atividade de protease regulada por HapR 1.7) Pratos de agar de leite 18 h (37 ° C) - - + + +
3.2) Hemólise 23 Mede a atividade hemolítica Pratos de agar sangue 48 h (37 ° C) Gama Beta Beta Beta Beta
3.3) Motilidade 23 Mede o grau de motilidade 1.8) Placas de ágar de motilidade 14-24 h (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Mede a capacidade de fermentar glocose e produzir acetoin como um subproduto 1.9) Líquido Voges-Proskauer médio Até 4 h (temperatura ambiente) - + + - -
Nota: "ND *" indica não determinado; "+" Denota um resultado positivo; "-" denota um resultado negativo

Tabela 2: Resumo dos Ensaios Genéticos e Fenotípicos Usados ​​para Vibrio cholerae Biotype Distinction. Esta tabela resume os vários ensaios genéticos e fenotípicos, aplicações e resultados esperados coletivamente utilizados para diferenciar os biótipos clássicos e El Tor utilizados neste estudo. Números de protocolo e referências a protocolos específicos são indicados na coluna Ensaio. "ND *" indica Não Determinado; "+" Denota um resultado positivo; "-" indica um resultado negativo.

figura 1
Figura 1: V. Cholerae Growth Curve of WT Classical O395, WT El Tor N16961 e El Tor Variant MQ1795. As taxas de crescimento de cepas de referência de biótopos (WT clássico O395 e WT El Tor N16961) e a Variante El Tor representativa MQ1795, cultivadas em caldo LB com aeração a 37 ° C, foram analisadas medindo a OD 600 eMuito hora começando em T 0 . As curvas de crescimento foram realizadas em 8 repetições experimentais independentes, sendo cada repetição representando um evento de cultivo independente para cada teste. A estirpe WT El Tor N16961 e a variante El Tor MQ1795 demonstraram tempos de duplicação mais curtos (~ 1 h e ~ 1 h, respectivamente) em relação à estirpe clássica WT O395 (~ 2 h), conforme observado por um tempo de duplicação mais longo. Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Determinação da resistência à polimixina B utilizando agar LB suplementado com polimixina B. A resistência ao antibiótico peptídico polimixina B foi determinada pela capacidade de crescer em agar LB suplementado com 50 UI / μL de polimixina B. A deformação clássica O395 de WT não mostrou crescimento em ágar SupplEmenteado com polimixina B e foi considerado sensível ao antibiótico. Enquanto as estirpes de WT El Tor (C6706 e N16961) e as variantes representativas de El Tor (MQ1795 e BAA-2163) apresentaram crescimento na presença do antibiótico e foram consideradas resistentes à polimixina B. As placas foram incubadas a 37 ° C durante 18 h. Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Medindo Metabolismo de Citrato Usando Metais de Citrato Minimal. A capacidade de utilizar citrato como única fonte de carbono foi determinada pela capacidade do isolador de crescer em meios citrato mínimos. A estirpe clássica WT O395 não cresceu em meios citratos mínimos (negativos). O crescimento foi evidente por todas as estirpes de WT El Tor (C6706 e N16961) e representante ElTor variantes (MQ1795 e BAA-2163), que demonstrou a capacidade de utilizar citrato como uma única fonte de carbono (positivo). As placas foram incubadas a 37 ° C durante 18 h. Clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4: Medição da hidrólise de caseína proteolítica regulada por HapR com meio de Agar de Leite. A hidrólise da caseína através da actividade de protease regulada por HapR foi determinada por uma zona visual de depuração em torno do ponto de inoculação no agar do leite. As estirpes contendo um HapR não funcional, como a estirpe clássica WT O395 e a estirpe N16961 de WT El Tor, não produziram uma zona de depuração em torno do ponto de inoculação ( hapR negativo). Estirpe C6706 de WT El Tor e variantes representativas de El Tor (MQ1795 e BAA-2163) contêm um HapR funcional, que pode ser visualizado como zonas de depuração de tamanho variável ( hapR -positive). As placas foram incubadas a 37 ° C durante 18 h. Clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5: Medindo a atividade hemolítica usando a mídia de Agar de sangue. A actividade hemolítica foi medida utilizando placas de agar suplementadas com sangue de ovelha. WT clássica estirpe O395 não segrega enzimas que lisam glóbulos vermelhos (γ-hemolítico). As estirpes de WT El Tor (N16961 e C6706) e as variantes representativas de El Tor (MQ1795 e BAA-2163) secretam enzimas hemolíticas, o que resultou em uma zona translúcida de depuração em torno do ponto de inoculação (β-hemolítico). As placas foram incubadas às 37° C durante 48 h. Clique aqui para ver uma versão maior desta figura.

Figura 6
Figura 6: Determinação da Motilidade Usando Placas de Agar Motilidade. A zona de motilidade foi indicada por uma mudança de cor visual do TTC de sal que se transforma de claro para vermelho quando metabolizado, indicando onde a bactéria se moveu. A estirpe clássica WT O395 (10 mm) e a estirpe C6706 de WT El Tor (15 mm) demonstraram motilidade mínima, enquanto a torção El Tor N16961 (21 mm) e as variantes representativas de El Tor (MQ1795 (25 mm) e BAA-2163 (29 mm) ) Demonstrou hiper-motilidade em relação ao O395 e C6706. As placas foram incubadas a 37 ° C durante 18 h. Por favor cliqueAqui para ver uma versão maior desta figura.

Figura 7
Figura 7: Ensaio Voges-Proskauer. A produção de acetaína através da fermentação com glicose foi determinada utilizando o ensaio Voges-Proskauer. A estirpe clássica WT O395 e as variantes representativas de El Tor (MQ1795 e BAA-2163) não produziram acetoin como resultado da fermentação de glicose (negativa). As estirpes de WT El Tor (N16961 e C6706) produziram acetona do subproduto e podem ser visualizadas por uma mudança de cor vermelha profunda (positiva). Os tubos foram incubados à temperatura ambiente durante 4 h. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dos mais de 200 V identificados. Sorogrupos de colesterol, apenas O1 e O139 têm potencial de epidemia. O serogrupo O1 pode ser dividido em dois biótipos: clássico e El Tor. No entanto, emergiram as variedades híbridas, denominadas Variantes 13 , 17 de El Tor , que possuem o fundo do biótipo El Tor e apresentam características clássicas 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . Os protocolos descritos neste manuscrito são projetados para fornecer pesquisadores, interessados ​​em caracterizar e / ou distinguir vários isolados clínicos e não clínicos de V. cholerae , com uma confiançaSistema de identificação multi-teste. O uso de um sistema confiável de identificação de vários ensaios como alternativa é uma melhoria em relação aos sistemas de identificação de ensaio único previamente estabelecidos e às telas genéticas intensivas em mão-de-obra. Todos os ensaios genotípicos e fenotípicos devem incluir a cepa clássica WT O395 e WT El Tor C6706 e N16961 para comparação ( Tabela 1 ). Enquanto as cepas de biótipos clássicos e El Tor estão incluídas para referência, isolados, como MQ1795 e BAA-2163 incluídos em nossos estudos, podem exibir perfis fenotípicos de qualquer biótipo ( Figura 2 , Figura 3 , Figura 4 , Figura 5 , Figura 6 , Figura 7 , Tabela 2 ), que ilustra a necessidade de análise de múltiplos traços genotípicos e fenotípicos para caracterização confiável. Todos os protocolos devem ser realizados de forma asséptica.26 a temperatura ambiente, a menos que especificado de outra forma. V. Cholerae é um patógeno de Nível de Biossegurança Nível 2 (BSL-2) que é o agente etiológico da doença gastrointestinal potencialmente fatal cólera; O manuseio e disposição adequados de todos os materiais e produtos de resíduos devem ser aplicados por regulamentos institucionais, locais, estaduais e federais.

A preparação de todos os meios e reagentes deve ser realizada com reagentes de grau analítico e água ultrapura desionizada com uma sensibilidade mínima de 18 MΩ-cm. Antes do processamento, a mídia deve ser preparada e permitir secar suficientemente (1-2 dias); As placas são consideradas suficientemente secas quando não há líquido residual na superfície do ágar. Devido ao alcance móvel e às zonas de folga que rodeiam o crescimento bacteriano, a motilidade e as placas de leite devem ser preparadas em grandes placas de Petri (150 mm x 15 mm) até 50 mL por placa e podem ser armazenadas por até 1 semana em plástico , LiD-side para baixo a 4 ºC. Além disso, a concentração de agar das placas de motilidade pode ser ajustada para diminuir a mobilidade; No entanto, não é recomendado exceder 3 g de agar por solução de 500 mL, pois isso reduzirá significativamente a motilidade global, de modo que as diferenças não serão observáveis. Todas as outras mídias de placas devem ser preparadas para aproximadamente 25 mL por placa em placas de Petri de tamanho padrão (100 mm x 15 mm) e podem ser armazenadas por até seis meses embaladas em plástico, lado da tampa para baixo a 4 ºC. Para a preparação de placas de polimixina B, é importante permitir que a mídia fundida esfrie após o autoclave antes de adicionar a polimixina B, pois o calor excessivo pode degradar os antibióticos. As placas de polimixina B podem ser armazenadas por até 3 meses embaladas em plástico, lado da tampa para baixo a 4 ºC. Os ensaios discutidos neste manuscrito exigem um dia para o crescimento de uma única colônia (12-16 h), um dia adicional para o crescimento de culturas durante a noite (12-16 h) e um terceiro dia para considerações genotípicas (~ 4 h para DN cromossômicoUm isolamento e ~ 3 h para PCR) ou ensaios fenotípicos (18-48 h, Tabela 2 ). Antes da análise bioquímica dos ensaios fenotípicos descritos neste manuscrito, as culturas devem ser lavadas em 1x PBS para evitar a reversão dos meios de cultura de resíduos dos resultados esticados. Além disso, os ensaios de polimixina B, citrato, atividade protease, hemólise e motilidade podem ser inoculados simultaneamente usando uma única cultura durante a noite lavada. Ao detectar meios revestidos, podem surgir salpicos de culturas e podem resultar em contaminação cruzada entre as cepas. Para evitar salpicos, evite a ejetar completamente a cultura da pipeta e, em vez disso, pare de expulsar a cultura na primeira parada da pipeta. Além disso, permita que os pontos se absorvam totalmente na superfície do ágar antes da incubação e tenha cuidado para não perfurar o agar, o que pode afetar os resultados. Ensaios fenotípicos resultando em zonas de depuração ( Figura 4 ; Figura 5 ; Tabela 2) E / ou motilidade ( Figura 6 ; Tabela 2 ) em torno do ponto de inoculação, devem ser espaçados ao máximo para evitar a fusão de áreas de depuração ou crescimento, respectivamente, sobre as quais os respectivos diâmetros podem ser medidos para análise comparativa. Após os tempos de incubação indicados, os isolados podem ser analisados ​​e analisados ​​em relação às cepas de referência do biótipo (WT clássico O395, WT El Tor C6706 e WT El Tor N16961).

As telas genéticas baseadas em PCR através do seqüenciamento delineadas neste manuscrito podem ser usadas para identificar o fundo do biótipo do isolamento em relação ao ctxB e ao tcpA , após a amplificação inicial da PCR. As diretrizes padrão de seqüenciamento requerem uma quantidade específica de produto de PCR dependendo do tamanho da região amplificada (580 pb para ctxB e 1420 pb para tcpA ), e para a configuração das reações, os protocolos estabelecidos podem ser seguidos. Em resumo, a frente e a frente individuaisAs reações de seqüenciamento em everse devem ser preparadas com 3-5 pmol de primário / reação, e o volume deve ser ajustado para 20 μl com água estéril ultrapura em um tubo de microcentrífuga de 1,5 mL. Para obter ajuda no desenho de iniciadores tanto para amplificação e seqüenciamento de PCR, a ferramenta de design de iniciador NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/ pode ser utilizada. A amplificação e seqüenciamento bem sucedidos de ctxB e tcpA foram realizados usando os seguintes primers (5 '→ 3'): ctxB- forward GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB -recorrido CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA -forward CCGCACCAGATCCACGTAGGTGGG, tcpA- reverso GTCGGTACATCACCTGCTGTGGGGGCAG. Deve-se notar que toda a região de codificação de ctxB é conservada em ambos os biótipos, exceto para as posições de base 115 e 203 (ambas citosina em clássico e timina em El Tor). Além disso, em tcpA , as várias mudanças de base são conservadas entre os biótipos que dAtravés dos dois biótipos ( Tabela 1 ), que pode ser usado para ajudar a distinguir entre biótipos.

Em muitos estudos de laboratório envolvendo o organismo modelo V. Cholerae, manutenção adequada e técnicas de cultivo são críticas 27 . As taxas de crescimento dos V comummente utilizados . As cepas de referência de biótipos de cholerae , como a estirpe clássica WT O395 e a estirpe N16961 de WT El Tor, podem fornecer informações úteis sobre a caracterização de isolados de variantes de El Tor ( Figura 1 , Tabela 2 ). Devido às taxas de crescimento variáveis em V. Isolados de cólera , é importante levar as leituras de absorvência do espectrofotômetro a cada hora até que as culturas atinjam a turbidez máxima durante a fase estacionária tardia. A fase de morte média a tardia pode não ser visualizada devido a um platô na turbidez resultante do excesso de detritos celulares. Uma diluição 1: 4 de cultura para L estéril O caldo B deve ser realizado para obter uma curva de crescimento completa e manter a precisão do instrumento, uma vez que as leituras de absorção atingem o pico em uma OD 600 ≈ 1,0. Ao executar curvas de crescimento em múltiplas estirpes, as leituras de absorvência devem ser cronometradas aproximadamente 5 minutos de distância para cada estirpe para garantir consistência entre as leituras. Entendendo V. As taxas de crescimento do biótipo de cholerae são cruciais para muitas investigações, incluindo estudos de expressão de genes de virulência, análise de atividades metabólicas e condições adequadas de cultivo e armazenamento. Para análise subseqüente, as culturas durante a noite devem ser processadas no registro tardio até a fase inicial de crescimento estacionário (12-16 h) para maximizar o crescimento celular, mantendo a integridade celular.

As condições de cultura para estirpes de biótipos clássicos e El Tor são semelhantes, no entanto, a análise da expressão do gene de virulência em V. Cholerae exige condições de indução de virulência específicas de biótipoOs dois principais fatores de virulência CT e TCP, são controlados pelo regulador mestre ToxT e são expressos otimamente sob condições de crescimento específicas, por exemplo, sob condições de indução de virulência de Tor Tor, o ToxT pode ser analisado processando extrato de células inteiras ( WCE), ou o sedimento celular, a 3,5 h, enquanto a expressão CT e TCP pode ser analisada processando o sobrenadante celular e WCE a 7,5 h, respectivamente 8 , 20. Os traços genotípicos e fenotípicos variáveis ​​demonstrados ao longo deste manuscrito indicam como Vários biótipos de V. Cholerae podem ser, e ilustram a necessidade de uma alternativa à caracterização de bióto de ensaio único anteriormente utilizada.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgements

Pesquisa apoiada por New Hampshire-INBRE através de um Prêmio de Desenvolvimento Institucional (IDeA), P20GM103506, do Instituto Nacional de Ciências Médicas Gerais do NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics