إنقاذ وتوصيف الفيروسات المؤتلف من عالم جديد زيكا الفيروسات استنساخ العدوى

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

يصف هذا البروتوكول انتعاش فيروس زيكا المعدية من استنساخ كدنا المعدية ثنائي البلازميد.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

استنساخ العدوى [كدنا] تسمح للتلاعب الجيني للفيروس، مما يسهل العمل على اللقاحات، المرضية، النسخ المتماثل، انتقال وتطور الفيروس. نحن هنا وصف بناء استنساخ المعدية لفيروس زيكا (زيكف)، الذي يسبب حاليا تفشي المتفجرات في الأمريكتين. لمنع السمية للبكتيريا التي لوحظت عادة مع البلازميدات المستمدة من فلافيروس، أنشأنا نظام البلازميد اثنين الذي يفصل الجينوم في الجين NS1 وأكثر استقرارا من البنيات كامل طول التي لا يمكن استردادها بنجاح دون الطفرات. بعد الهضم وربط للانضمام إلى شظيتين، يمكن أن تتولد كامل الحمض النووي الريبي الفيروسية طول عن طريق النسخ في المختبر مع T7 رنا البلمرة. بعد إليكتروبوراتيون من الحمض النووي الريبي كتب في الخلايا، تم استرداد الفيروس الذي عرضت مماثلة في حركية النمو المختبر وفي الجسم الحي الفوعة والأنماط الظاهرية العدوى في الفئران والبعوض، على التوالي.

Introduction

فيروس زيكا (زيكف؛ عائلة فلافيفريداي : جنس فلافيفيروس ) هو فيروس منقول بالبعوض الذي وصل إلى البرازيل في 2013-14، وكان مرتبطا بعد ذلك بفاشية واسعة من مرض الحمى التي انتشرت في جميع أنحاء الأمريكتين 1 . وبالإضافة إلى ذلك، تم ربط زيكف مع نتائج المرض الشديد، مثل متلازمة غيلان باريه في البالغين وصغر الرأس في الأجنة والحديثين 2 . ولم يعرف القليل عن زيكف قبل انتشاره السريع في نصف الكرة الغربي. وشمل ذلك نقص الأدوات الجزيئية، مما أعاق البحث الآلي. الأدوات الجزيئية للفيروسات، مثل الحيوانات المستنسخة كدنا المعدية، وتسهيل اللقاح والتنمية العلاجية المضادة للفيروسات، والسماح لتقييم العوامل الوراثية الفيروسية المتعلقة المرضية الفيروسية التفاضلية، والاستجابة المناعية والتطور الفيروسي.

ومن المعروف أن الحيوانات المستنسخة عدوى فيروس العوز المناعي البشري غير مستقرة للغاية في البكتيريا بسبب كريبتيك بروكاريوتيك المروجين موجودة في الجينومات الخاصة بهم 3 . وقد استخدمت عدة نهج لتحسين هذه المشكلة؛ بما في ذلك إدخال جنبا إلى جنب يكرر المنبع من تسلسل الفيروسية 4 ، طفرة من المفترضة متواليات بدائيات بدائية النواة 5 ، وتقسيم الجينوم إلى البلازميدات متعددة 6 ، ناقلات عدد النسخ المنخفضة (بما في ذلك الكروموسومات الاصطناعية البكتيرية) 7 ، 8 وإدخال الإنترونات في الجينوم الفيروسي 9 . وقد وصفت نظام كامل طول دون تعديلات ل زيكف. ومع ذلك، يبدو أن هذا الاستنساخ الموهن في ثقافة الخلايا وفي الفئران 10 . وقد قامت مجموعات أخرى بتصنيع إنترونات في جينوم زيكف، مما يسمح بتعطيل تسلسل غير مستقر في البكتيريا التي يمكن أن تقسم في خلايا الثدييات في المختبر لإنتاج الفيروس المعدية 11، 12 . بالإضافة إلى ذلك، تم استخدام نظام القائم على ير بعنوان العدوى سوبجينوميك-أمبليكونس بنجاح لإنقاذ سلالة MR766 النموذج من زيكف 13 . إن المنهج الموصوف هنا لا يتطلب أي تسلسل أجنبي، بل يعطل الجينوم في المنطقة من عدم الاستقرار العالي باستخدام البلازميدات المتعددة، والتي سبق استخدامها بنجاح مع الحمى الصفراء 6 ، حمى الضنك 14 ، 15 وفيروسات غرب النيل 16 . وعلاوة على ذلك، إضافة تسلسل ريبوزيمي التهاب الكبد D في تيرميني الجينومي الفيروسي يسهل إنشاء نهاية أصيلة 3 'دون الحاجة إلى إضافة موقع الخطي. بالإضافة إلى ذلك، يتم بناء كلا البلازميدات في ناقلات عدد منخفض نسخة (pACYC177، ~ 15 نسخة لكل خلية) للتخفيف من أي سمية المتبقية 17 . فيروس تعافى يعرض لمحة النمو مماثلة لفيروس الوالدية في منحنيات نمو المختبر في 8 خطوط الخلايا التي تضم مجموعة متنوعة من أنواع الخلايا المستمدة من كل من الثدييات والحشرات، وعرضت ملامح مماثلة المسببة للأمراض في الفئران والعدوى، ونشر ونقل معدلات في البعوض 18 .

هنا، ونحن بالتفصيل بروتوكول يصف كيفية زراعة البلازميدات استنساخ المعدية، وتوليد كامل طول الحمض النووي الريبي الفيروسي (الجينوم الفيروسي) في المختبر، واستعادة الفيروس المعدية في ثقافة الخلية. أولا، نحن تصف انتشار البلازميدات في البكتيريا أو خالية من البكتيريا التضخيم باستخدام المتداول دائرة التضخيم (رسيا). بعد ذلك، وتبين لنا كيف يتم هضم البلازميدات اثنين ومن ثم ليغاتد لاحقا معا لتوليد كامل طول الفيروس. وأخيرا، نحن تصف إنتاج الحمض النووي الريبي المنقولة وما يليه إليكتروبوراتيون في خلايا فيرو، تليها المعايرة من فيروس تعافى ( الشكل 1 ). النهج الموصوف هو سريع، مما يسمح فوr استعادة مخزونات الفيروسات المعدية في 1-2 أسابيع.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. تحويل واسترداد البلازميدات استنساخ المعدية

  1. تحويل كلا البلازميدات (بشكل منفصل) باستخدام بروتوكول التحول التجاري (على سبيل المثال ، نب 5 بروتوكول التحول دقيقة) مع بعض التعديلات. كلا البلازميدات تحتوي على ترميز الجينات لمقاومة الأمبيسلين، وبالتالي استخدام الأمبيسلين أو كاربينيسيلين للاختيار. يفضل الكاربنيسيلين، لأنه أكثر استقرارا.
    1. إزالة الخلايا (انظر المواد الجدول) من -80 درجة مئوية الفريزر وذوبان الجليد على الجليد لمدة 5-10 دقيقة. (ملبس) (يحتوي على 10 غرام / لتر كلوريد الصوديوم و 25 ميكروغرام / مل كاربينيسيلين، ودعا لب-كارب) لوحات والمرق مع القمع كابوليت (سوك (بدون المضادات الحيوية) - القادمة مع الخلايا) عند 37 درجة مئوية.
    2. إضافة ما بين 100 بغ-10 نانوغرام في 1 ميكرولتر من الحمض النووي البلازميد إلى أنبوب يحتوي على 50 ميكرولتر من الخلايا المختصة؛ مزيج بلطف عن طريق عبها أنبوب.
    3. احتضان أنابيب على الجليد لمدة 5 دقائق.
    4. أنابيب الصدمة الحرارية عند 42 درجة مئوية لمدة 30 ثانيةفي حمام مائي. العودة إلى الجليد لمدة 2 دقيقة مباشرة بعد صدمة الحرارة.
    5. ماصة 950 ميكرولتر من درجة حرارة الغرفة سوك في كل أنبوب ومزيج من قبل بيبتينغ. انتشار 100 ميكرولتر من الخليط البكتيرية على لوحة لب-كارب واحتضان بين عشية وضحاها في 37 درجة مئوية (حوالي 12-14 ح).
  2. إزالة لوحات من 37 درجة مئوية حاضنة بعد 12-14 ح الحضانة. ضع لوحات في درج مظلم في درجة حرارة الغرفة للسماح للمستعمرات أن تستمر في النمو (حوالي 8-9 ح).
  3. استخدام 5 مل من مرق رائع (السل، التي تحتوي على 25 ميكروغرام / مل كاربينيسيلين، ودعا السل كارب)، وتنمو 5-10 مستعمرات صغيرة لكل البلازميد بين عشية وضحاها في 30 درجة مئوية في شاكر البكتيرية (حوالي 14-16 ح).
    ملاحظة: المستعمرات الصغيرة هي مؤشر على البلازميد سليمة؛ المستعمرات مع البلازميدات التي تحتوي على الحذف، إعادة ترتيب أو الطفرات (هنا تسمى أحداث عدم الاستقرار) سوف تنمو بشكل أسرع، وبالتالي تكون أكبر. ولذلك، ينبغي للمرء أن محاولة لاختيار أصغر المستعمرات على لوحة، وتحديدا لاt اختيار أكبر المستعمرات الحاضر. ويمكن أيضا اختيار بعض المستعمرات متوسطة الحجم من أجل اكتمالها. انخفاض درجة الحرارة المستخدمة يقلل من احتمال أن الخلايا سوف فرط (أود 600 أكبر من 0.6-0.8). كما معظم الباحثين أداء النمو بين عشية وضحاها، فإنه يسمح لمزيد من السيطرة وتقليل فرصة فرط النمو.
  4. تحقق من الثقافات السائلة للتعكر (تقريبا أود 600 من 0.6-0.8). وضع أي أنابيب العكر في 4 درجات مئوية والسماح أنابيب أخرى لتصبح عكر من خلال النمو لفترة أطول.
    ملاحظة: لا تنمو البكتيريا إلى أود 600 قيم أكبر من الموصى بها، كما قد تحدث أحداث عدم الاستقرار البلازميد.
  5. استخراج الحمض النووي البلازميد من البكتيريا مع عدة البلازميد مينيبريب التجارية (انظر الجدول المواد). أزل في 15 ميكرولتر من قبل ساخنة (إلى 70 درجة مئوية في كتلة التدفئة) شطف العازلة. السماح المخزن المؤقت شطف لاحتضان على العمود لمدة 5 دقائق قبل الطرد المركزي.
    ملاحظة: الحفاظ على الأقل 1 مل من هذه الثقافة بداية في 4 درجات مئوية لومواصلة استخدامها في الخطوة التالية.
  6. هضم 10 ميكرولتر من البلازميدات المستردة لتقييم ما إذا كانت أحداث عدم الاستقرار البلازميد وقعت أثناء الثقافة.
    ملاحظة: هضم P1 مع سالي / نهي و P2 مع بامهي / هيندييي عند 37 درجة مئوية لمدة 1 ساعة. تأكيد وجود العصابات الصحيحة التالية الهضم ( الشكل 2A ) عن طريق الرحلان الكهربائي والانتقال إلى الخطوة 2. إذا إعداد الحمض النووي البلازميد عن طريق المتداول دائرة التضخيم (رسيا)، واحتياطي بعض من مينيبريب الشرف لتكون بمثابة قالب.

2. إعداد دنا البلازميد كافية لربط

ملاحظة: ربط واللاحقة إليكتروبوراتيون يتطلب كمية كافية من الحمض النووي البلازميد التي يجب أن تتولد عن طريق إما ماكسيبريب أو رسيا. في حين ماكسيبريب هو النهج المستخدمة تقليديا، رسيا يقدم ميزة عدم الحاجة إلى البكتيريا، وبالتالي إزالة إمكانات سمية البلازميد التي يسببها في البكتيريا التي يمكن أن تؤدي إلى أحداث عدم الاستقرار.

  1. لكل البلازميد التي أثبتت صحيح انزيم تقييد نمط الهضم في القسم السابق، إضافة 500 ميكرولتر من ثقافة بداية إلى 1 لتر من السل كارب (25 ميكروغرام / مل كاربينيسيلين) مرق ويهز بين عشية وضحاها في 30 درجة مئوية (حوالي 14-16 ساعة ، تقريبا أود 600 من 0.6-0.8).
    ملاحظة: لا تسمح للثقافة أن تنمو على هذا أود 600 قيمة. وهذا من المحتمل أن يؤدي إلى أحداث عدم الاستقرار داخل البلازميدات.
  2. حصاد البكتيريا وتنفيذ ماكسيبريبس لكل بروتوكول الشركة المصنعة (انظر الجدول المواد).
  • باستخدام مينيبريب المحفوظة من الخطوة 1.6، تنفيذ ما يلي لإجراء رسيا.
    1. نقل 1 ميكرولتر من الحمض النووي البلازميد إلى أنبوب يحتوي على 50 ميكرولتر من العازلة العينة.
    2. الحرارة تنكر العينة في 95 درجة مئوية لمدة 3 دقائق، ومن ثم احتضان في 4 درجات مئوية حتى جاهزة للاستخدام.
    3. إعداد التضخيم التجاريبريمكس (انظر جدول المواد ). الجمع بين 50 ميكرولتر من العازلة رد فعل مع 2 ميكرولتر من مزيج انزيم في أنبوب تعيين على الجليد.
      ملاحظة: يجب الاحتفاظ بريمكس التضخيم على الجليد حتى جاهزة للاستخدام. أنها مريحة لإعداد مزيج الرئيسي من خلال الجمع بين الكواشف الكافية لعدد المطلوب من ردود الفعل التضخيم. يجب التخلص من أي بريمكس غير مستخدمة.
    4. نقل 50 ميكرولتر من بريمكس التضخيم أعدت إلى عينة التشويه والتحريف.
    5. احتضان أنابيب التفاعل في 30 درجة مئوية لمدة 18 ساعة.
    6. احتضان الأنابيب عند 65 درجة مئوية لمدة 10 دقيقة لتعطيل بوليميراز الحمض النووي ø29.
    7. تخزين أنابيب التفاعل في 4 درجات مئوية أو -20 درجة مئوية حتى جاهزة للاستخدام.
      ملاحظة: عند هذه النقطة، الحمض النووي البلازميد أعدت عن طريق كل من الطرق ينبغي أن يكون كميا (باستخدام الامتصاصية في 260 نانومتر) وجينك زيكف يجب أن يكون سانجر تسلسل تماما لتأكيد أي أحداث عدم الاستقرار (الحذف وإعادة ترتيب) وقعت أثناء الإعداد.
  • اسم التمهيدي تسلسل (5 '- 3')
    زيكف PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    زيكف حفظها 632For. GCCCTATGCTGGATGAGG
    زيكف حفظ 692Rev. GGTTCCGTACACAACCCAAGTTG
    زيكف حفظ 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    زيكف كونسيرفد 1201For. CCAACACAAGGTGAAGCCTAC
    زيكف حفظها 1663For. GCAGACACCGGAACTCCACACT
    زيكف محفوظة 2008For. CAGATGGCGGTGGACATGC
    زيكف حفظ 2350Rev. GTGAGAACCAGGACATTCCTCC
    زيكف كونسيرفيد 2605For. TACAAGTACCATCCTGACTCCC
    زيكف حفظ 3499Rev. GCCTTATCTCCATTCCATACCA
    زيكف حفظ 3961Rev. TTGCCAACCAGGCCAAAG
    زيكف حفظ 4132For. CATTTGTCATGGCCCTGG
    زيكف كونسيرفد 4561Rev. CTATTGGGTTCATGCCACAGAT
    زيكف كونسيرفد 4665For. GACCACAGATGGAGTGTACAGAGT
    زيكف حفظ 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    زيكف حفظ 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    زيكف المحفوظة 6086Rev. CTTGCTTCAAGCCAGTGTGC
    زيكف كونسيرفيد 6119For. GCCTCATAGCCTCGCTCTATCG
    زيكف حفظ 6721Rev. CCATTCCAAAGCCCATCTTCCC
    زيكف حفظ 6769For. CCAGCCAGAATTGCATGTGTCC
    زيكف حفظ 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV كونسيرفد 7343For. GTTGTGGATGGAATAGTGGT
    زيكف حفظها 8243For. TGCCCATACACCAGCACTATGA
    زيكف PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    زيكف حفظ 9133For. AGCCCTTGGATTCTTGAACGAGGA
    زيكف PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    زيكف حفظ 9686For. GATGATAGGTTTGCACATGCC
    زيكف حفظ 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    زيكف كونسيرفد 10455For. CAGGAGAAGCTGGGAAACC
    زيكف حفظ 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    الجدول 1: الاشعال لتسلسل استنساخ [كدنا]. يمكن تسلسل البلازميدات تماما مع الاشعال المدرجة. الاشعال وضعت على أنها "الحفاظ" إينديأن من المحتمل أن تكون قادرة على تسلسل / تضخيم جميع الأنماط الجينية من زيكف. الاشعال المسمى "PRVABC59" هي محددة لهذه السلالة ولكن قد تعمل أيضا لسلالات النمط الجيني الآسيوية الأخرى وربما الأنواع الوراثية الأخرى.

    3. إعداد في المختبر رنا المنقولة

    1. إعداد رد فعل الهضم إما ماكسيبريب أو رسيا أعد الحمض النووي.
      1. ل p1 الهضم، مزيج 10 ميكرولتر من العازلة رد فعل 10X، 3 ميكرولتر من أبالي، 3 ميكرولتر من بامهي-هف، 3 ميكرولتر من رساب أو سيب، و 3.3 ميكروغرام من الحمض النووي p1. إضافة د 2 O إلى 100 ميكرولتر.
      2. ل p2 الهضم، مزيج 10 ميكرولتر من العازلة رد فعل 10X، 3 ميكرولتر من أبالي، 3 ميكرولتر من إكوري-هف، و 13.3 ميكروغرام من الحمض النووي P2. إضافة د 2 O إلى 100 ميكرولتر.
      3. احتضان عند 37 درجة مئوية لمدة 1-2 ساعة.
      4. تنقية باستخدام هلام التجاري و ير تنظيف كيت (انظر المواد الجدول). أزل في 30 ميكرولتر من العازلة شطف قبل ساخنة إلى 70 درجة مئوية في كتلة التدفئة (احتضانعمود لمدة 5 دقائق قبل الغزل).
        ملاحظة: حافظ على 1 ميكرولتر لتشغيل على هلام في وقت لاحق.
    2. إعداد رد فعل ربط.
      1. الجمع بين 10 ميكرولتر من 10X T4 دنا ربط رد فعل العازلة، 3 ميكرولتر من T4 دنا يغاز (400 U / ميكرولتر)، 29 ميكرولتر من P1 المنقى، و 29 ميكرولتر تنقية P2. إضافة د 2 O إلى 100 ميكرولتر.
      2. احتضان في درجة حرارة الغرفة لمدة 2 ساعة أو 16 درجة مئوية خلال الليل.
      3. تنقية باستخدام هلام التجاري و ير تنظيف كيت (انظر المواد الجدول). أزل في 10 ميكرولتر من العازلة شطف قبل ساخنة إلى 70 درجة مئوية في كتلة التدفئة (احتضان عمود لمدة 5 دقائق قبل الغزل).
        ملاحظة: حافظ على 1 ميكرولتر لتشغيل على هلام في وقت لاحق.
    3. تشغيل البلازميدات عسر الهضم، هضم البلازميدات، وربط على هلام الاغاروز. يجب أن يكون المنتج ربط أعلى الفرقة الوزن الجزيئي (حوالي 11 كيلو بايت) من إما هضم البلازميد وحدها، مشيرا إلى ربط ناجحا ( الشكل 2B ).
    4. إعداد T7 في المختبر رد فعل النسخ.
      1. الجمع بين 10 ميكرولتر 2X أركا / نتب ميكس، 2 ميكرولتر من T7 رنا مزيج البوليميراز، و 8 ميكرولتر من رد فعل تنقية تنقية لحجم النهائي من 20 ميكرولتر.
        ملاحظة: أركا المدرجة في مزيج هو التناظرية سقف التي يتم تضمينها حصرا في التوجه الصحيح. يمكن أن يؤدي النظير كاب القياسية في فقط ~ 50٪ من النصوص وجود غطاء في الاتجاه الصحيح.
      2. احتضان لمدة 4 ساعات عند 37 درجة مئوية.
      3. قياس تركيز الحمض النووي الريبي عبر طيف الأشعة فوق البنفسجية. اختياريا، تشغيل تغيير طبيعة هلام الاغاروز لتأكيد طول نص رنا.

    4. الإنقاذ من الفيروسات المعدية بواسطة إليكتروبوراتيون

    1. أيام قبل إليكتروبوراتيون، وإعداد 1 T182 قارورة أوفيرو الخلايا (بين T150 و T182 هو مقبول؛ نمت في دمم + 10٪ مصل بقري جنيني (فبس)) لكل بناء ليتم استردادها. وتشمل 1 T182 باعتبارها السيطرة ترنسفكأيشن وهمية. ميجب أن تستخدم لس في 70-80٪ كونفلنسي.
    2. عندما تكون الخلايا جاهزة، ضع 12 مل / رد فعل دمم + 15٪ فبس + 10 ملي هيبيس في حمام مائي يسخن إلى 37 درجة مئوية.
    3. فصل الخلايا عن طريق التربسينيزات مع بروتوكول القياسية، واستعادة الخلايا في وسائل الإعلام مع 10٪ فبس لتعطيل التربسين. خلايا الطرد المركزي في 150 x ج لمدة 5 دقائق في 4 درجات مئوية.
    4. غسل الخلايا في 1X الفوسفات مخزنة المالحة (بس)، وخلايا التكوير في 150 x ج لمدة 5 دقائق في 4 درجات مئوية. كرر هذه الخطوة مرتين لإجمالي ثلاثة يغسل.
    5. ريسوسبيند الخلايا في 200 ميكرولتر من رمي 1640 + 10 ملي هيبيس (العقيمة) لكل عدد من العينات. نقل 200 ميكرولتر من تعليق خلية إلى أنبوب معقمة. وينبغي أن تكون الخلايا ~ 0.5 × 10 7 خلايا / مل.
    6. إضافة 20 ميكرولتر من الماء (وهمية نيغ السيطرة) أو 20 ميكرولتر من الحمض النووي الريبي (ويفضل 5-10 ميكروغرام) المنتجة في الخطوة 3.4 إلى كل مجموعة من الخلايا. مزيج بلطف عن طريق عبها أنبوب ونقل محتويات الأنبوب إلى 2 مم كفيت الفجوة إليكتروبوراتيون.
    7. تعيين كهربائيأوبيراتور إلى 170 V لف، أوميغا (المقاومة) في 0 و 950 μF (تقريبا إلى 625 V / سم و 20 مللي ثانية ثابتة لآلات أخرى). قم بتعيين المقاومة لأدنى إعداد متاح، إما 0 أو ∞ إذا كانت متوفرة.
    8. نبض مرة واحدة وعلى الفور إضافة 600 ميكرولتر من دمم +15٪ فبس +10 ملي هيبيس التي تم تسخينها في الخطوة 4.2. شطف داخل كوفيت تماما لإزالة جميع الخلايا. إضافة الخلايا إلى T75 قارورة ثقافة الأنسجة التي تحتوي على 10 مل من وسائل الإعلام قبل تحسنت. إزالة وسائط إضافية من كوفيت باستخدام القطارة التي يتم تضمينها مع كوفيت. كن حذرا للحفاظ على العقم.
    9. دوامة دوامة لخلط وسائل الإعلام والخلايا ووضعها في 37 درجة مئوية حاضنة.
    10. تحقق في اليوم التالي لبقاء الخلية، والقيام بذلك كل يوم حتى لوحظ 50-75٪ موت الخلايا. ويلاحظ موت الخلايا عن طريق المقارنة مع السيطرة إليكتروبوراتد وهمية.
      ملاحظة: تأثير زيكف سيتوباثيك (كب) وضوحا تماما في خلايا فيرو، مما أدى إلى تقريب الخلايا التي فصل وتطفو في وسط الثقافة. لدينالاحظ مجموعة من 8-10 أيام باعتبارها مثالية للحصاد.
    11. حصاد طاف في أنبوب مخروطي وأجهزة الطرد المركزي لإزالة الحطام الخلوي في> 3000 x ج لمدة 10 دقيقة في 4 درجات مئوية.
    12. إزالة طاف توضيح إلى أنبوب جديد وتكملة مع تركيز النهائي من 20٪ فبس (من الأسهم 100٪). بالإضافة إلى ذلك، إضافة هيبيس العقيمة في تركيز النهائي من 10 ملم كعامل التخزين المؤقت للحفاظ على العدوى الفيروس بينما المجمدة (من 1 M العقيمة الأسهم).
    13. مزيج الفيروس عن طريق فورتيكسينغ وقسامة في قوارير غطاء المسمار. مخزن في -80 درجة مئوية لاستخدامها في المستقبل.

    5. معايرة الفيروسات المستردة

    1. البذور العدد المناسب من 6- أو 12 جيدا لوحات من خلايا فيرو يوم قبل المعايرة.
    2. إزالة الفيروس من الثلاجة وجعل تسلسلات التخفيف 10 أضعاف في دمم + 2٪ فبس في أنابيب أو لوحات 96 جيدا.
      ملاحظة: عيار المتوقع من الحيوانات المستنسخة المستردة ما بين 1 × 10 6 و 5 × 10 7 بفو / مل.
    3. إضافة 200 oR 400 ميكرولتر من كل تخفيف في مكررة إلى بئر من لوحة 12 أو 6 جيدا، على التوالي.
    4. لوحات مكان في 37 درجة مئوية حاضنة والصخور كل 15 دقيقة، لمجموع ~ 1-1.5 ساعة فترة الامتزاز.
    5. إزالة اللقاح الفيروسي وإضافة 1 مل من (12-جيدا) أو 2 مل (6-جيدا) دمم تراغاكانث تراكب لكل بئر.
      ملاحظة: فمن الممكن استخدام الاغاروز، أجار، ميثيلسيلولوس أو وسائل الإعلام تراكب أخرى هنا.
    6. احتضان الخلايا في 37 درجة مئوية حاضنة لمدة 5 أيام. وسوف يتغير وقت تكوين اللويحات المناسبة تبعا للتراكب المستخدم.
    7. لإصلاح الخلايا، وإزالة لوحات من الحاضنة وتراكب الصقيع بلطف في مطهر.
    8. إضافة ما يكفي من 20٪ الإيثانول / 0.1٪ البنفسجي الكريستال (كف) إلى كل بئر لتغطية ودوامة لخلط.
      ملاحظة: العديد من مثبتات أخرى موجودة ويمكن استخدامها هنا. بالإضافة إلى ذلك، إذا كان استخدام أغاروس أو أجار تراكب، تراكب الثاني يمكن استخدامها مع بالاقتران مع أحمر محايد لتصور لويحات دون التثبيت. وقد أظهرت الإيثانول 20٪ أن يكونفعالة في تعطيل الفيروسات المغلف في الدراسات السابقة؛ لا تستخدم هذا المبلغ للفيروسات غير المغلف لأنها لن تكون معطلة 19 .
    9. احتضان لوحات لمدة 30-60 دقيقة في درجة حرارة الغرفة (في مجلس الوزراء الفئة الثانية السلامة الأحيائية). تجاهل السيرة الذاتية (وفقا للوائح المحلية) وغسل لوحات مع ماء الصنبور.
    10. السماح لوحات لتجف، وحساب لويحات يدويا.
      ملاحظة: يمكن استخدام المرجع 20 كمرجع إضافي لأداء فحوص البلاك.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    بروتوكول الموصوفة هنا يسمح لاستعادة فيروس زيكا المستمدة المستنسخ استنساخ. التلاعب نظام استنساخ العدوى البلازميد اثنين هو واضح عندما يؤديها مع الرعاية، بالمقارنة مع الإصدارات كاملة الطول التي هي غير مستقرة للغاية (لا تظهر البيانات). بعد الهضم وربط قطعتين متميزة، يتم إنتاج رنا توج باستخدام النسخ في المختبر مع بوليميراز T7 الذي هو إليكتروبوراتد ثم إلى خلايا فيرو ( الشكل 1 ). يمكن رصد تسلسل البلازميد الصحيح باستخدام تقييد الهضم كما مينيبريب التالية وكيل ( الشكل 2A ) وعبر سانجر التسلسل بعد إنتاج الحمض النووي على نطاق واسع مع رسيا أو ماكسيبريب. بعد التأكد من الحيوانات المستنسخة عن طريق التسلسل، واستعادة الفيروس المعدية يتطلب الهضم فقط، ربط، في النسخ المختبر وأخيرا إليكتروبوراتيون. ويمكن تنفيذ هذه الخطوات في يوم واحد. الصحيح ديجويمكن رصد ستيون وربط بواسطة أغاروس هلام الكهربائي ( الشكل 2B )، والسماح لاستكشاف الأخطاء وإصلاحها، إذا لزم الأمر.

    كما هو مبين في الشكل 3 ، الفيروس المستنسخ المستنسخ المستنسخ يكرر إلى مستويات مماثلة لعزل الوالدين في المختبر في العديد من خطوط الخلايا، مما يشير إلى أن الفيروس المسترجع من [كدنا] يتكرر على غرار العزلة الأولية. بالإضافة إلى ذلك، لم يلاحظ وجود فروق ذات دلالة إحصائية بين الفيروس المستخلص المستنسخ المستنسخ وعزل الوالدين في معدلات البقاء على قيد الحياة في الفئران أو معدلات العدوى، ونشرها ونقلها في البعوض الزاعجة المصرية ( الشكل 4 ).

    شكل 1
    الشكل 1: سير العمل لإنقاذ زيكف من استنساخ كدنا اثنين البلازميد.تم استنساخ جينوم سلالة زيكف PRVABC59 في قطعتين منفصلتين في العمود الفقري البلازميد pACYC177. ثم هضم البلازميدات اثنين و ليغاتد مع ليغاز T4 دنا. ثم تم إنتاج الحمض النووي الريبي المعدية المعبدة عن طريق النسخ في المختبر تليها إليكتروبوراتيون في خلايا فيرو. (الشكل مقتبس من المرجع 21 ). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    الشكل 2
    الشكل 2: هلام الكهربائي لمراقبة الهضم وربط استنساخ [كدنا]. ( A ) هضم تقييد الأولي من البلازميدات المشتقة مينيبريب لتقييم الاستقرار الجيني. ( ب ) أمثلة على الهضم وربط المنتجات خلال انتعاش الفيروس المعدية من نظام استنساخ البلازميد اثنين. هريف = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" تارجيت = "_ بلانك"> الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

    الشكل 3
    الشكل 3: حركية النمو في المختبر من الفيروسات المستنسخة من استنساخ. تم تقييم حركية النمو للنوع البري PRVABC59 واستنساخ العدوى المستمدة الفيروس على الإنسان (ش-SY5Y، جرة و NTERA2 CI.D1)، البعوض (C6 / 36، Aag2) وخطوط الخلايا الرئيسيات غير البشرية (فيرو) من خلال فحص اللوحة. n = 3 أشرطة الخطأ تمثل الانحراف المعياري عن المتوسط. (الشكل مقتبس من المرجع 21 ). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    55857fig4.jpg "/>
    الشكل 4: في توصيف الجسم الحي من الفيروسات المستنسخة من استنساخ في الفئران والبعوض. ( أ ) تم تلقيح الفئران داخل البريتوني من قبل الذكور والإناث لمدة 4 أسابيع، وبيتا وغاما خروج المغلوب المستقبلي، AG129، مع 1000 بفو من PRVABC59 أو الفيروس المستنسخ المستنسخ المستنسخ ورصدها مع مرور الوقت من أجل البقاء (ن = 11). الزاعجة المصرية البعوض أعطيت دماء المعدية التي تحتوي على زيكف وتشريح بعد 14 يوما. ( ب ) استخدمت مقايسات اللويحات لتقييم أجسام البعوض (السرطانات) أو الساقين (النشر) أو الإفرازات اللعابية (انتقال العدوى) للفيروس المعدية. وتعرض المعدلات كنسبة مئوية من مجموع البعوض التي تم اختبارها (الشكل مقتبس من المرجع 21 ). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    الكتاب ليس لديهم ما يكشف.

    Acknowledgments

    ويود المؤلفون أن يشكروا كريستين بولارد-فيبلمان وميلينا فيسيلينوفيتش وكلوديا روكيرت على مساعدتهم في وصف الفيروس المستخرج من النسخ المستنسخ. وأيد هذا العمل جزئيا من المنح المقدمة من المعهد الوطني للحساسية والأمراض المعدية، المعاهد الوطنية للصحة في إطار المنح AI114675 (بجج) و AI067380 (جدي).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics