Räddning och karaktärisering av rekombinant virus från en ny världsinfektiös klon från Zika Virus

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Detta protokoll beskriver återhämtningen av infektiös Zika-virus från en infektion med två plasmider med cDNA-klon.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Infektiösa cDNA-kloner möjliggör genetisk manipulation av ett virus, vilket underlättar arbetet med vacciner, patogenes, replikation, överföring och viral utveckling. Här beskriver vi konstruktionen av en infektiös klon för Zika-virus (ZIKV), som för närvarande orsakar ett explosivt utbrott i Amerika. För att förhindra toxicitet för bakterier som vanligen observeras med flavivirus-härledda plasmider genererade vi ett två-plasmidsystem som separerar genomet hos NS1-genen och är stabila än konstruktioner i full längd som inte lyckades återvinnas utan mutationer. Efter digestion och ligering för att ansluta till de två fragmenten, kan viralt RNA i full längd alstras genom in vitro transkription med T7 RNA-polymeras. Efter elektroporation av transkriberad RNA i celler erhölls virus som uppvisade liknande in vitro- tillväxtkinetik och in vivo virulens- och infektionsfenotyper hos respektive mus och myggor.

Introduction

Zika-virus (ZIKV; Family Flaviviridae : Genus Flavivirus ) är ett myggburen flavivirus som anlände till Brasilien 2013-14 och var därefter associerat med ett massivt utbrott av febril sjukdom som spred sig över hela Amerika 1 . Dessutom har ZIKV kopplats till svåra sjukdomsutfall, såsom Guillain-Barré-syndrom hos vuxna och mikrocefali hos foster och nyfödda 2 . Lite var känt om ZIKV före dess snabba spridning på västra halvklotet. Detta innebar en brist på molekylära verktyg, vilket hindrade mekanisk forskning. Molekylära verktyg för virus, såsom infektiösa cDNA-kloner, underlättar vaccin och antiviral terapeutisk utveckling och möjliggör bedömning av virala genetiska faktorer relaterade till differentiell viral patogenes, immunsvar och viral utveckling.

Flavivirus-infektiösa kloner är kända att vara mycket instabila i bakterier på grund av crYptiska prokaryota promotorer närvarande i deras genomer 3 . Flera metoder har använts för att förbättra problemet. Innefattande införande av tandemrepetitioner uppströms virala sekvenser 4 , mutation av förmodade prokaryota promotorsekvenser 5 , splittring av genomet i multipla plasmider 6 , vektorer med låg kopiantal (inklusive bakteriella artificiella kromosomer) 7 , 8 och införande av introner i virusgenomet 9 . Ett heltidssystem utan modifikationer har beskrivits för ZIKV; Emellertid tycks denna klon dämpas i cellodling och hos möss 10 . Andra grupper har konstruerat introner i ZIKV-genomet, vilket möjliggör störning av instabila sekvenser i bakterier som kan spliceras ut i däggdjursceller in vitro för framställning av infektiöst virus 11, 12 . Dessutom har ett PCR-baserat system med titeln Infektiösa-Subgenomic-Amplicons använts framgångsrikt för att rädda prototypen MR766-stammen av ZIKV 13 . Tillvägagångssättet som beskrivs här kräver inga främmande sekvenser, men förvränger snarare genomet i regionen med hög instabilitet genom att använda flera plasmider, som tidigare har använts framgångsrikt med gul feber 6 , dengue 14 , 15 och västnilevirus 16 . Vidare underlättar tillägget av hepatit D-ribozym-sekvensen vid den virala genomiska terminen skapandet av en autentisk 3'-ände utan behovet av tillsats av en linjäriseringsplats. Dessutom konstrueras båda plasmiderna i en vektor med låg kopiantal (pACYC177, ~ 15 kopior per cell) för att mildra eventuell återstående toxicitet 17 . Viruset som återvinns visar en tillväxtprofil som kan jämföras medFöräldravirus i in vitro -tillväxtkurvor i 8 cellinjer innefattande en mångfald celltyper härledda från både däggdjur och insekter och har uppvisat identiska patogena profiler i möss och infektion, spridning och överföringshastigheter i myggor 18 .

Här beskriver vi ett protokoll som beskriver hur man odlar de infektiösa klonplasmiderna, genererar viruslängder med full längd (virusgenomet) in vitro och återställer infektiöst virus i cellodling. Först beskriver vi propagation av plasmider i bakterier eller bakteriefri amplifiering med användning av rullcirkelförstärkning (RCA). Därefter visar vi hur de två plasmiderna smälts och sedan ligeras tillsammans för att generera virus i full längd. Slutligen beskriver vi produktionen av transkriberat RNA och dess efterföljande elektroporation i Vero-celler, följt av titrering av återvunnet virus ( Figur 1 ). Tillvägagångssättet som beskrivs är snabbt, vilket möjliggör foR återhämtning av infektiösa virusbestånd i 1-2 veckor.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transform och återvinning av smittsamma klonplasmider

  1. Transformera båda plasmiderna (separat) med hjälp av ett kommersiellt transformationsprotokoll ( t.ex. NEB 5 Minute Transformation Protocol) med några modifieringar. Båda plasmiderna innehåller en gen som kodar för ampicillinresistens, använd därför ampicillin eller karbenicillin för selektion. Carbenicillin är föredraget, eftersom det är mer stabilt.
    1. Ta bort celler (se materialbord) från -80 ° C frys och tina på is i 5-10 min. Prewarm lysogeny buljong (LB) (innehållande 10 g / l NaCl och 25 μg / ml karbenicillin, kallad LB-carb) plattor och buljongen med katabolitundertryckning (SOC (utan antibiotika) - kommer med cellerna) vid 37 ° C.
    2. Tillsätt mellan 100 pg-10 ng i 1 pi plasmid-DNA till ett rör innehållande 50 pi kompetenta celler; Blanda försiktigt genom att bläddra i röret.
    3. Inkubera rör på is i 5 min.
    4. Värmechockrör vid 42 ° C i 30 sI ett vattenbad. Återgå till is i 2 minuter omedelbart efter värmestock.
    5. Pipettera 950 μL rumstemperatur SOC i varje rör och blanda genom pipettering. Sprid 100 μL av bakterieblandningen på en LB-karb-platta och inkubera över natten vid 37 ° C (ungefär 12-14 timmar).
  2. Ta bort plattor från 37 ° C inkubator efter 12-14 h inkubation. Placera tallrikarna i en mörk låda vid rumstemperatur så att kolonierna fortsätter att växa (ungefär 8-9 timmar).
  3. Använd 5 ml Terrific buljong (TB, innehållande 25 μg / ml karbenicillin, kallad TB-karb), växa 5-10 små kolonier för varje plasmid över natten vid 30 ° C i en bakteriell skakare (ungefär 14-16 h).
    OBS: Små kolonier är en indikator på att plasmiden är intakt; Kolonier med plasmider innehållande deletioner, omarrangemang eller mutationer (häri kallade instabilitetshändelser) kommer att växa snabbare och därmed vara större. Därför bör man försöka välja de minsta kolonierna på plattan, specifikt nejT välja de största kolonierna som är närvarande. Vissa medelstorlek kolonier kan också väljas för fullständighet. Den lägre temperaturen som används minskar sannolikheten för att cellerna kommer att växa över (OD 600 större än 0,6-0,8). Eftersom de flesta forskare bedriver tillväxt över natten tillåter det ökad kontroll och minskad risk för överväxt.
  4. Kontrollera flytande kulturer för grumlighet (ungefär OD 600 på 0,6-0,8). Placera några grumliga rör vid 4 ° C och låt andra rör bli grumliga genom att växa längre.
    OBS! Växa inte bakterier till OD 600- värden som är större än rekommenderade, eftersom instabilitetshändelser kan inträffa.
  5. Extrahera plasmid-DNA från bakterier med ett kommersiellt plasmidminiprep-kit (se materialtabell). Eluera i 15 | il av förvärmd (till 70 ° C i en värmeblock) elueringsbuffert. Låt elueringsbufferten inkubera på kolonnen i 5 min före centrifugering.
    OBS: Bevara minst 1 ml av denna startkultur vid 4 ° C förVidare användning i nästa steg.
  6. Digestera 10 jil av de utvunna plasmiderna för att bedöma huruvida plasmidinstabilitetshändelser inträffade under odling.
    ANMÄRKNING: Digest p1 med SalI / NheI och p2 med BamHI / HindIII vid 37 ° C i 1 h. Bekräfta närvaron av de korrekta banden efter matsmältning ( Figur 2a ) genom gelelektrofores och fortsätt till steg 2. Om du bereder plasmid-DNA genom rullecirkelförstärkning (RCA), reservera några av miniprepeluatet för att fungera som en mall.

2. Framställning av tillräckligt plasmid DNA för ligering

OBS: Ligation och efterföljande elektroporation kräver en tillräcklig mängd plasmid-DNA som måste genereras via antingen maxiprep eller RCA. Medan maxiprep är det traditionellt använda tillvägagångssättet, erbjuder RCA fördelen att det inte krävs bakterier, vilket eliminerar potentialen för plasmidinducerad toxicitet i bakterier som kan leda till instabilitetshändelser.

  1. För varje plasmid som visade det korrekta restriktionsenzym digestionsmönstret i föregående avsnitt, tillsätt 500 | il startkultur till 1 liter TB-Carb (25 | ig / ml karbenicillin) buljong och skaka över natten vid 30 ° C (ungefär 14-16 h , Ungefär OD 600 på 0,6-0,8).
    OBS! Låt inte kulturen växa över detta OD 600- värde. Detta kommer potentiellt att resultera i instabilitetshändelser inom plasmiderna.
  2. Skörda bakterierna och utföra maxipreps per tillverkarens protokoll (se materialtabell).
  • Använd den sparade miniprepen från steg 1.6, utför följande för RCA-proceduren.
    1. Överför 1 μL plasmid-DNA till ett rör innehållande 50 μl provbuffert.
    2. Värmebehandla provet vid 95 ° C i 3 minuter och inkubera därefter vid 4 ° C tills det är färdigt att använda.
    3. Förbered den kommersiella förstärkningenPremix (se material tabell ). Kombinera 50 μl reaktionsbuffert med 2 μl enzymblandning i ett rör satt på is.
      ANMÄRKNING: Förstärkningspixeln bör hållas på is tills den är klar för användning. Det är lämpligt att framställa en masterblandning genom att kombinera tillräckliga reagens för det erforderliga antalet amplifieringsreaktioner. Eventuell oanvänd premix måste kasseras.
    4. Överför 50 μl preparerad amplifieringsblandning till det denaturerade provet.
    5. Inkubera reaktionsrören vid 30 ° C i 18 h.
    6. Inkubera rören vid 65 ° C under 10 minuter för att inaktivera ö29 DNA-polymeraset.
    7. Förvara reaktionsrören vid 4 ° C eller -20 ° C tills de är klara för användning.
      ANMÄRKNING: Vid denna punkt bör plasmid-DNA som framställts via båda metoderna kvantifieras (med användning av absorbans vid 260 nm) och ZIKV-genomet bör vara sekvenserad av Sanger helt för att bekräfta att inga instabilitetshändelser (borttagningar och omarrangemang) inträffade under framställning.
  • Primer Name Sekvens (5 '- 3')
    ZIKV PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV konserverad 632For. GCCCTATGCTGGATGAGG
    ZIKV konserverade 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV konserverade 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV konserverade 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV konserverade 1663For. GCAGACACCGGAACTCCACACT
    ZIKV konserverade 2008For. CAGATGGCGGTGGACATGC
    ZIKV konserverad 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV konserverade 2605For. TACAAGTACCATCCTGACTCCC
    ZIKV konserverade 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV konserverade 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV konserverade 4132For. CATTTGTCATGGCCCTGG
    ZIKV konserverade 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV konserverade 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV konserverade 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV konserverade 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV konserverade 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV konserverade 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV konserverade 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV konserverade 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV konserverad 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV konserverad 7343For. GTTGTGGATGGAATAGTGGT
    ZIKV konserverade 8243For. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV konserverade 9133For. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV konserverad 9686For. GATGATAGGTTTGCACATGCC
    ZIKV konserverade 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV konserverad 10455For. CAGGAGAAGCTGGGAAACC
    ZIKV konserverade 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tabell 1: Primers för sekvensering av cDNA-kloner. Plasmider kan sekvenseras helt med de angivna primersna. Primers märkta som "konserverade" indiCate att de sannolikt kan sekvensera / förstärka alla genotyper av ZIKV. Primers märkta som "PRVABC59" är specifika för denna stam men kan också fungera för andra asiatiska genotypstammar och möjligen andra genotyper.

    3. Framställning av in vitro- transkriberad RNA

    1. Ställ upp matsmältningsreaktion av antingen maxiprep eller RCA-preparat DNA.
      1. För pl-digerering, blanda 10 μl 10x reaktionsbuffert, 3 | il av ApaLI, 3 | il BamHI-HF, 3 | il rSAP eller CIP och 3,3 μg p1-DNA. Tillsätt ddH20 till 100 pl.
      2. För p2-digestion blanda 10 μl 10x reaktionsbuffert, 3 | il ApaLI, 3 | il EcoRI-HF och 13,3 | ig p2-DNA. Tillsätt ddH20 till 100 pl.
      3. Inkubera vid 37 ° C i 1-2 h.
      4. Rening med användning av en kommersiell gel- och PCR-rengöringskit (se materialtabell). Eluera i 30 | il av elueringsbuffert förvärmd till 70 ° C i ett uppvärmningsblock (inkuberaKolonn i 5 min innan spinning).
        OBS: Håll 1 μL för att springa på en gel senare.
    2. Förbered ligeringsreaktion.
      1. Kombinera 10 μl 10x T4 DNA-ligeringsreaktionsbuffert, 3 | il T4-DNA-ligas (400 U / μl), 29 | il renad pl och 29 | il renad p2. Tillsätt ddH20 till 100 pl.
      2. Inkubera vid rumstemperatur i 2 timmar eller 16 ° C över natten.
      3. Rening med användning av en kommersiell gel- och PCR-rengöringskit (se materialtabell). Eluera i 10 | il av elueringsbuffert förvärmd till 70 ° C i ett uppvärmningsblock (inkubatkolonn i 5 minuter före spinning).
        OBS: Håll 1 μL för att springa på en gel senare.
    3. Kör ouppgjorda plasmider, digererade plasmider och ligering på en agarosgel. Ligeringsprodukten bör ha ett band med högre molekylvikt (omkring 11 kb) än antingen den digererade plasmiden ensam, vilket indikerar att ligationen lyckades ( Figur 2b ).
    4. Ställ in T7 in vitro transkriptionsreaktion.
      1. Kombinera 10 | il 2x ARCA / NTP-mix, 2 | il T7 RNA-polymerasblandning och 8 | il renad ligeringsreaktion för en slutlig volym av 20 | il.
        OBS! Den ARCA som ingår i mixen är en cap-analog som exklusivt ingår i rätt orientering. Standard-cap-analoger kan resultera i att endast ~ 50% av transkripten har ett lock i rätt orientering.
      2. Inkubera i 4 timmar vid 37 ° C.
      3. Mät RNA-koncentrationen via en UV-spektrofotometer. Eventuellt kör en denaturerande agarosgel för att bekräfta längden av RNA-transkriptet.

    4. Räddning av smittsam virus genom elektroporation

    1. Dagar före elektroporation, bereda 1 T182-kolv avVero-celler (mellan T150 och T182 är acceptabelt, odlat i DMEM + 10% fetalt bovint serum (FBS)) per konstruktion som skall utvinnas. Inkludera 1 T182 som en mocktransfektionskontroll. ceLls bör användas vid 70-80% konfluens.
    2. När cellerna är klara, placera 12 ml / reaktion av DMEM + 15% FBS + 10 mM HEPES i ett vattenbad uppvärmt till 37 ° C.
    3. Lossa celler genom trypsinisering med ett standardprotokoll och återställ celler i media med 10% FBS för att inaktivera trypsin; Centrifugera celler vid 150 xg i 5 min vid 4 ° C.
    4. Tvätta celler i 1x fosfatbuffrad saltlösning (PBS), pelleteringsceller vid 150 xg i 5 min vid 4 ° C. Upprepa detta steg två gånger för totalt tre tvättar.
    5. Resuspendera celler i 200 pl RPMI 1640 + 10 mM HEPES (steril) per antal prov. Överför 200 μl cell suspension till ett sterilt rör. Cellerna bör vara ~ 0,5 x 107 celler / ml.
    6. Tillsätt 20 μl vatten (mock negkontroll) eller 20 μl RNA (företrädesvis 5-10 μg) som produceras i steg 3.4 till varje uppsättning celler. Blanda försiktigt genom att bläddra i röret och överför innehållet i röret till en 2 mm spalt elektroporationskuvett.
    7. Ställ in en elektrOporator till 170 V LV, omega (motstånd) vid 0 och 950 μF (ungefär 625 V / cm och 20 ms tidskonstant för andra maskiner). Ställ in motstånd till lägsta tillgängliga inställning, antingen 0 eller ∞ om det finns tillgängligt.
    8. Pulsen tillsätter en gång omedelbart 600 μl DMEM +15% FBS + 10 mM HEPES som värmdes i steg 4.2. Skölj inuti kyvetten noggrant för att ta bort alla celler. Tillsätt celler till en T75 vävnadsodlingskolv innehållande 10 ml förvärmt medium. Ta bort ytterligare media från kyvetten med hjälp av droppen som ingår i kyvetten. Var försiktig med att bibehålla sterilitet.
    9. Virvelkolv för att blanda media och celler och placera i 37 ° C inkubator.
    10. Kontrollera nästa dag för cellleabilitet, och gör det varje dag tills 50-75% celldöd observeras. Celldöd observeras genom att jämföra med den mocka elektroporerade kontrollen.
      OBS: ZIKV-cytopatisk effekt (CPE) är ganska uttalad i Vero-celler, vilket resulterar i rundade celler som lossnar och flyter i odlingsmediet. Vi harObserverade ett intervall på 8-10 dagar som idealisk för skörd.
    11. Skörd supernatant i ett koniskt rör och centrifugera för att avlägsna cellulär skräp vid> 3000 xg i 10 min vid 4 ° C.
    12. Ta bort klarerad supernatant till ett nytt rör och komplettera med en slutlig koncentration på 20% FBS (från 100% lager). Dessutom tillsätt sterila HEPES vid en slutlig koncentration av 10 mM som ett buffertmedel för att bevara virusinfektivitet medan fryst (från ett 1 M sterilt lager).
    13. Blanda virus genom virvelbildning och alikvot i skruvflaskor. Förvaras vid -80 ° C för framtida användning.

    5. Titrering av återvunnet virus

    1. Se till lämpligt antal 6- eller 12-brunnsplattor av Vero-celler dagen före titrering.
    2. Ta bort virus från frysen och gör seriella 10-faldiga utspädningar i DMEM + 2% FBS i rör eller plattor med 96 brunnar.
      OBS: Den förväntade titeren från utvunna kloner är mellan 1 x 10 6 och 5 x 10 7 PFU / ml.
    3. Lägg till 200 oR 400 μl av varje utspädning i duplikat till en brunn av en 12- eller 6-brunnsplatta.
    4. Placera plattorna i 37 ° C inkubator och rocka var 15: e minut, i totalt ~ 1-1,5 h adsorptionsperiod.
    5. Ta bort viral inokulum och sätt 1 ml (12 brunn) eller 2 ml (6 brunn) DMEM-Tragacanth-överlägg till varje brunn.
      OBS! Det är möjligt att använda agaros, agar, metylcellulosa eller andra överlagringsmedia här.
    6. Inkubera celler i 37 ° C inkubator i 5 dagar. Tiden för korrekt plackbildning kommer att variera beroende på det använda överlagret.
    7. För att fixa celler, ta bort plattor från inkubator och dekantera överlag försiktigt i desinfektionsmedel.
    8. Lägg till tillräckligt med 20% etanol / 0,1% kristallviolett (CV) till varje brunn för att täcka och virvla för att blanda.
      OBS! Många andra fixativ finns och kan användas här. Om en agaros- eller agaröverlagring används kan dessutom en andra överlag användas tillsammans med neutralröd för att visualisera plack utan fixering. 20% etanol har visat sig varaEffektivt vid inaktivering av omslutna virus i tidigare studier; Använd inte detta belopp för icke-omslutna virus eftersom de inte kommer att inaktiveras 19 .
    9. Inkubera plattor i 30-60 minuter vid rumstemperatur (i ett klass II biosäkerhetsskåp); Kassera CV (enligt lokala föreskrifter) och tvätta plattor med kranvatten.
    10. Låt plattorna torka och räkna plack manuellt.
      OBS: Referens 20 kan användas som en ytterligare referens för att utföra plackanalyser.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Protokollet som beskrivs här möjliggör återhämtning av infektiöst klon-härledd Zika-virus. Manipulering av infektiösa klonsystemet med två plasmider är rakt framåt när det utförs med försiktighet, jämfört med fulllängdsversioner som är mycket instabila (data ej visade). Efter matsmältning och ligering av de två distinkta bitarna framställs kapslat RNA genom in vitro- transkription med T7-polymeras, som sedan elektroporeras i Vero-celler ( Figur 1 ). Korrekt plasmidsekvens kan övervakas med användning av restriktionsmältning som en proxy efter miniprep ( Figur 2a ) och via Sanger-sekvensering efter storskalig DNA-produktion med RCA eller maxiprep. Efter bekräftelse av klonerna genom sekvensering kräver återvinning av infektiöst virus endast digestion, ligering, in vitro transkription och slutligen elektroporation. Dessa steg kan utföras på en dag. Rätt digeStion och ligering kan övervakas med agarosgelelektrofores ( Figur 2b ), vilket möjliggör felsökning vid behov.

    Som visas i figur 3 replikerar infektiöst klon-härlett virus till liknande nivåer som föräldraisolatet in vitro i flera cellinjer, vilket tyder på att det återvunna viruset från cDNA replikerar på liknande sätt som primärisolatet. Dessutom observerades inga signifikanta skillnader mellan det infektiösa klonavledda viruset och föräldraisolatet i överlevnadshastigheter hos möss eller infektionshastigheter, spridning och överföring i Aedes aegypti myggor ( Figur 4 ).

    Figur 1
    Figur 1: Arbetsflöde av ZIKV-räddning från en två-plasmid-cDNA-klon.Genomet av ZIKV-stammen PRVABC59 klonades i två separata bitar i en pACYC177 plasmidskelett. De två plasmiderna digererades sedan och ligerades med T4 DNA-ligas. Capped-infectious RNA producerades sedan via in vitro transkription följt av elektroporation i Vero-celler. (Figur anpassad från referens 21 ). Vänligen klicka här för att se en större version av denna figur.

    Figur 2
    Figur 2: Gelelektrofores för att övervaka digestion och ligering av cDNA-klon. ( A ) Initial restriktionsmältning av miniprep härledda plasmider för att bedöma genetisk stabilitet. ( B ) Exempel på digestions- och ligeringsprodukter under återvinning av infektiöst virus från plasmidklonsystemet med två plasmider. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Vänligen klicka här för att se en större version av den här siffran.

    Figur 3
    Figur 3: In vitro- tillväxtkinetik av klon-härlett virus. Tillväxtkinetik av vild typ PRVABC59 och infektiös klonavledande virus på människa (SH-SY5Y, Jar och NTERA2 cI.D1), mygg (C6 / 36, Aag2) och icke-humana primater (Vero) cellinjer utvärderades genom plackanalys. N = 3 Felstänger representerar standardavvikelse från medelvärdet. (Figur anpassad från referens 21 ). Vänligen klicka här för att se en större version av denna figur.

    55857fig4.jpg "/>
    Figur 4: In vivo karakterisering av klon-härlett virus i möss och myggor. ( A ) 4 veckor gammal, manlig och kvinnlig interferon alfa-, beta- och gamma-receptorknockout, AG129, möss injicerades intraperitonealt med 1000 PFU av PRVABC59 eller det infektiösa klonavledda viruset och övervakades över tiden för överlevnad (n = 11). Aedes aegypti mygg fick ett infektiöst blodmjöl som innehöll ZIKV och dissekerades 14 dagar senare. ( B ) Plackanalyser användes för att bedöma myggkroppar (infektion), ben (spridning) eller salivsekretioner (överföring) för infektiöst virus. Priser presenteras som procent av de totala myggor som testades (Figur anpassad från referens 21 ). Vänligen klicka här för att se en större version av denna figur.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Författarna har ingenting att avslöja.

    Acknowledgments

    Författarna vill tacka Kristen Bullard-Feibelman, Milena Veselinovic och Claudia Rückert för deras hjälp för att karakterisera det klonbaserade viruset. Detta arbete stöddes delvis genom bidrag från National Institute of Allergy and Infectious Diseases, NIH under bidrag AI114675 (BJG) och AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics