Redning og karakterisering av rekombinant virus fra en ny verden Zika Virus smittsom klon

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokollen beskriver utvinningen av smittsomt Zika-virus fra en to-plasmidinfeksjonell cDNA-klon.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Infeksiøse cDNA kloner tillater genetisk manipulering av et virus, og dermed letter arbeidet med vaksiner, patogenese, replikasjon, overføring og viral evolusjon. Her beskriver vi konstruksjonen av en smittsom klon for Zika virus (ZIKV), som for tiden forårsaker et eksplosivt utbrudd i Amerika. For å forhindre toksisitet for bakterier som vanligvis observeres med flavivirus-avledede plasmider, genererte vi et to-plasmidsystem som separerer genomet ved NS1-genet og er stabile enn full lengdekonstruksjoner som ikke kunne bli vellykket gjenopprettet uten mutasjoner. Etter fordøyelse og ligering for å bli med i de to fragmentene, kan full lengde viralt RNA genereres ved in vitro transkripsjon med T7 RNA polymerase. Etter elektroporering av transkribert RNA i celler ble virus gjenvunnet som utviste tilsvarende in vitro vekstkinetikk og in vivo virulens- og infeksjonsfenotyper hos henholdsvis mus og mygg.

Introduction

Zika-virus (ZIKV; Family Flaviviridae : Genus Flavivirus ) er et mygg-båret flavivirus som kom til Brasil i 2013-14 og ble senere assosiert med et massivt utbrudd av feber sykdom som spredte seg over hele Amerika 1 . I tillegg har ZIKV vært knyttet til alvorlige sykdomsutfall, slik som Guillain-Barré syndrom hos voksne og mikrocefali hos foster og nyfødte 2 . Det var lite kjent om ZIKV før den raske spredningen i den vestlige halvkule. Dette innebar mangel på molekylære verktøy, og dermed hindret mekanistisk forskning. Molekylære verktøy for virus, som infeksiøse cDNA kloner, lette vaksine og antiviral terapeutisk utvikling, og tillate vurdering av virale genetiske faktorer relatert til differensiell viral patogenese, immunrespons og viral evolusjon.

Flavivirusinfeksjonelle kloner er kjent for å være svært ustabile i bakterier på grunn av crYptiske prokaryote promotorer tilstede i deres genomene 3 . Flere tilnærminger har blitt brukt til å lette dette problemet; Inkludert innføring av tandemrepetater oppstrøms for virussekvenser 4 , mutasjon av antatte prokaryotiske promotorsekvenser 5 , splittelse av genomet i flere plasmider 6 , lavkopi-talvektorer (inkludert bakterielle kunstige kromosomer) 7 , 8 og innsetting av introner i virusgenomet 9 . Et full lengdesystem uten endringer er beskrevet for ZIKV; Denne klonen syntes imidlertid å bli dempet i cellekultur og hos mus 10 . Andre grupper har konstruert introner i ZIKV-genomet, som tillater forstyrrelse av ustabile sekvenser i bakterier som kan spaltes ut i pattedyrceller in vitro for produksjon av smittsomt virus 11, 12 . I tillegg er et PCR-basert system med navnet infektiøse-subgenomic-Amplicons blitt brukt med hell for å redde prototypen MR766-stammen av ZIKV 13 . Tilnærmingen beskrevet her krever ingen utenlandske sekvenser, men forstyrrer snarere genomet i regionen med høy ustabilitet ved bruk av flere plasmider, som tidligere har blitt brukt med hell med feber 6 , dengue 14 , 15 og West Nile-virus 16 . Videre letter tilsetningen av hepatitt D-ribozym-sekvensen ved den virale genomiske termini opprettelsen av en autentisk 3'-ende uten behov for tilsetning av et lineariseringssted. I tillegg er begge plasmidene konstruert i en vektor med lav kopi-tall (pACYC177, ~ 15 kopier per celle) for å redusere eventuell gjenværende toksisitet 17 . Viruset som er gjenopprettet, viser en vekstprofil som kan sammenlignes medForeldringsvirus i in vitro vekstkurver i 8 cellelinjer omfattende en rekke celletyper avledet fra både pattedyr og insekter, og har utvist identiske patogene profiler i mus og infeksjon, spredning og overføringshastigheter i mygg 18 .

Her beskriver vi en protokoll som beskriver hvordan man dyrker de smittsomme klonplasmidene, genererer full lengde viralt RNA (det virale genomet) in vitro, og gjenoppretter smittsomt virus i cellekultur. Først beskriver vi forplantning av plasmider i bakterier eller bakteriefri forsterkning ved bruk av rullesirkelforsterkning (RCA). Deretter viser vi hvordan de to plasmidene blir fordøyd og deretter ligert sammen for å generere fulllengdsvirus. Til slutt beskriver vi produksjonen av transkribert RNA og dets etterfølgende elektroporation i Vero-celler, etterfulgt av titrering av gjenvunnet virus ( Figur 1 ). Tilnærmingen beskrevet er rask, slik at foR gjenoppretting av smittsomme viruslagre i 1-2 uker.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transformasjon og gjenvinning av smittsomme klonplasmider

  1. Transform begge plasmidene (separat) ved hjelp av en kommersiell transformasjonsprotokoll ( f.eks . NEB 5 Minute Transformation Protocol) med noen modifikasjoner. Begge plasmidene inneholder et gen som koder for ampicillinresistens, derfor bruk ampicillin eller carbenicillin for seleksjon. Carbenicillin er foretrukket, da det er mer stabilt.
    1. Fjern celler (se materialetabell) fra -80 ° C fryser og tine på is i 5-10 min. Prewarm lysogeny buljong (LB) (inneholdende 10 g / l NaCl og 25 μg / ml karbenicillin, kalt LB-carb) plater og buljongen med katabolittundertrykkelse (SOC (uten antibiotika) - kommer med cellene) ved 37 ° C.
    2. Tilsett mellom 100 pg-10 ng i 1 ul plasmid DNA til et rør som inneholder 50 ul kompetente celler; Bland forsiktig ved å bla på røret.
    3. Inkuber rør på is i 5 min.
    4. Varm støt rør ved 42 ° C i 30 sI et vannbad. Gå tilbake til is i 2 min umiddelbart etter varmestokk.
    5. Pipetter 950 μL romtemperatur SOC i hvert rør og bland ved pipettering. Spred 100 μl av bakterieblandingen på en LB-karb-plate og inkuber natten over ved 37 ° C (omtrent 12-14 timer).
  2. Fjern plater fra 37 ° C inkubator etter 12-14 h inkubasjon. Plasser plater i en mørk skuff ved romtemperatur for å tillate kolonier å fortsette å vokse (omtrent 8-9 timer).
  3. Ved bruk av 5 ml Terrific bouillon (TB, inneholdende 25 μg / ml karbenisillin, kalt TB-carb), vokser 5-10 små kolonier for hvert plasmid over natten ved 30 ° C i en bakteriell rister (omtrent 14-16 timer).
    MERK: Små kolonier er en indikator på at plasmidet er intakt; Kolonier med plasmider som inneholder deletjoner, omarrangeringer eller mutasjoner (heri kalt ustabilitetshendelser) vil vokse raskere og dermed være større. Derfor bør man forsøke å velge de minste koloniene på platen, spesielt nrT velge de største koloniene som er tilstede Noen mellomstore kolonier kan også velges for fullstendighet. Den lavere temperaturen som brukes reduserer sannsynligheten for at cellene vil vokse (OD 600 større enn 0,6-0,8). Som de fleste forskere utfører over natten vekst, det gir mer kontroll og redusert sjanse for overgrov.
  4. Kontroller flytende kulturer for turbiditet (omtrent OD 600 på 0,6-0,8). Plasser noen uklare rør ved 4 ° C og la andre rør bli grumle ved å vokse lenger.
    MERK: Ikke dyrk bakterier til OD 600- verdier som er større enn anbefalt, da det kan oppstå plasmidstabilitetshendelser.
  5. Ekstraher plasmid DNA fra bakterier med et kommersielt plasmid miniprep kit (Se Material Table). Avløp i 15 ul forvarmet (til 70 ° C i en oppvarmingsblokk) elueringsbuffer. La elueringsbufferen inkuberes på kolonnen i 5 minutter før sentrifugering.
    MERK: Behold minst 1 ml av denne startkulturen ved 4 ° C forVidere bruk i neste trinn.
  6. Fordel 10 μl av de gjenvunnede plasmidene for å vurdere om plasmidinstabilitetshendelser skjedde under dyrking.
    MERK: Fordel p1 med SalI / NheI og p2 med BamHI / HindIII ved 37 ° C i 1 time. Bekreft tilstedeværelsen av de riktige båndene etter fordøyelsen ( Figur 2a ) ved gelelektroforese og fortsett til trinn 2. Hvis du lagrer plasmid-DNA ved hjelp av rullesirkelforsterkning (RCA), reserver litt av miniprepeluatet for å fungere som en mal.

2. Fremstilling av tilstrekkelig plasmid DNA for ligning

MERK: Ligation og påfølgende elektroporation krever en tilstrekkelig mengde plasmid DNA som må genereres via enten maxiprep eller RCA. Mens maxiprep er den tradisjonelt brukte tilnærmingen, gir RCA fordelen av ikke å kreve bakterier, og dermed fjerner potensialet for plasmidinducert toksisitet i bakterier som kan føre til ustabilitetshendelser.

  1. For hver plasmid som demonstrerte det korrekte restriktionsenzym fordøyelsesmønster i forrige seksjon, tilsett 500 μl starterkultur til 1 liter TB-Carb (25 μg / ml karbenicillin) buljong og rist over natten ved 30 ° C (omtrent 14-16 timer , Omtrent OD 600 på 0,6-0,8).
    MERK: Ikke la kulturen vokse over denne OD 600- verdien. Dette vil potensielt føre til ustabilitetshendelser i plasmidene.
  2. Høst bakteriene og utfør maxipreps per produsentens protokoll (Se Materialebord).
  • Bruk den lagrede miniprep fra trinn 1.6, utfør følgende for RCA-prosedyren.
    1. Overfør 1 μl plasmid-DNA til et rør som inneholder 50 μl prøvebuffer.
    2. Varm-denaturer prøven ved 95 ° C i 3 minutter, og inkuber deretter ved 4 ° C til klar for bruk.
    3. Forbered den kommersielle forsterkningenPremix (se materialetabell ). Kombiner 50 μl reaksjonsbuffer med 2 μl enzymblanding i et rørsett på is.
      MERK: Forsterkning forblandingen skal oppbevares på is til klar for bruk. Det er hensiktsmessig å forberede en mesterblanding ved å kombinere tilstrekkelige reagenser for det nødvendige antall amplifikasjonsreaksjoner. Eventuell ubrukt premix må kasseres.
    4. Overfør 50 μl preparert amplifikasjons premix til den denaturerte prøven.
    5. Inkuber reaksjonsrørene ved 30 ° C i 18 timer.
    6. Inkuber rørene ved 65 ° C i 10 minutter for å inaktivere ø29 DNA polymerase.
    7. Oppbevar reaksjonsrørene ved 4 ° C eller -20 ° C til klar for bruk.
      MERK: På dette tidspunkt bør plasmid DNA fremstilt via begge metoder kvantifiseres (ved bruk av absorbans ved 260 nm) og ZIKV-genomet bør være Sanger sekvensert helt for å bekrefte at det ikke oppstod ustabilitetshendelser (deletjoner og omarrangementer) under forberedelsen.
  • Primernavn Sekvens (5 '- 3')
    ZIKV PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV Konserverte 632For. GCCCTATGCTGGATGAGG
    ZIKV Conserved 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV Konserverte 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV konserverte 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV konserverte 1663For. GCAGACACCGGAACTCCACACT
    ZIKV Konserverte 2008For. CAGATGGCGGTGGACATGC
    ZIKV konserverte 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV Konserverte 2605For. TACAAGTACCATCCTGACTCCC
    ZIKV konserverte 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV konserverte 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV konserverte 4132For. CATTTGTCATGGCCCTGG
    ZIKV konserverte 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV konserverte 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV konserverte 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV konserverte 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV konserverte 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV konserverte 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV konserverte 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV konserverte 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV konserverte 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV konserverte 7343For. GTTGTGGATGGAATAGTGGT
    ZIKV konserverte 8243For. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV konserverte 9133For. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV konserverte 9686For. GATGATAGGTTTGCACATGCC
    ZIKV konserverte 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV konserverte 10455For. CAGGAGAAGCTGGGAAACC
    ZIKV konserverte 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tabell 1: Primerer for sekvensering av cDNA kloner. Plasmider kan sekvenseres helt med de oppførte primere. Primers merket som "bevart" indiCate at de sannsynligvis er i stand til å sekvensere / forsterke alle genotyper av ZIKV. Primers merket "PRVABC59" er spesifikke for denne stammen, men kan også fungere for andre asiatiske genotypestammer og muligens andre genotyper.

    3. Fremstilling av in vitro- transkribert RNA

    1. Opprett fordøyelsesreaksjon av enten maxiprep eller RCA-preparert DNA.
      1. For p1-fordøyelse blandes 10 μl 10x reaksjonsbuffer, 3 μl ApaLI, 3 μl BamHI-HF, 3 μL rSAP eller CIP og 3,3 μg p1 DNA. Tilsett ddH20 til 100 μl.
      2. For p2-fordøyelse blandes 10 μl 10x reaksjonsbuffer, 3 μl ApaLI, 3 μl EcoRI-HF og 13,3 μg p2 DNA. Tilsett ddH20 til 100 μl.
      3. Inkuber ved 37 ° C i 1-2 timer.
      4. Rens med bruk av et kommersielt gel- og PCR-opprydningssett (Se Materialebord). Eluer i 30 μl elueringsbuffer forvarmet til 70 ° C i en oppvarmingsblokk (inkuber denKolonne i 5 minutter før spinning).
        MERK: Hold 1 μL for å kjøre på en gel senere.
    2. Forbered ligasjonsreaksjonen.
      1. Kombiner 10 μl 10x T4 DNA ligeringsreaksjonsbuffer, 3 μl T4 DNA ligase (400 U / μl), 29 μl renset p1 og 29 μl renset p2. Tilsett ddH20 til 100 μl.
      2. Inkuber ved romtemperatur i 2 timer eller 16 ° C over natten.
      3. Rens med bruk av et kommersielt gel- og PCR-opprydningssett (Se Materialebord). Avløp i 10 μl elueringsbuffer forvarmet til 70 ° C i en oppvarmingsblokk (inkubatkolonne i 5 minutter før spinning).
        MERK: Hold 1 μL for å kjøre på en gel senere.
    3. Kjør ufordøyede plasmider, fordøyede plasmider og ligering på en agarosegel. Ligasjonsproduktet bør ha et høyere molekylvektbånd (ca. 11 kb) enn enten fordøyd plasmid alene, hvilket indikerer at ligeringen var vellykket ( figur 2b ).
    4. Sett opp T7 in vitro transkripsjonsreaksjon.
      1. Kombiner 10 μl 2x ARCA / NTP-blanding, 2 μl T7 RNA-polymerase-blanding og 8 μl renset ligeringsreaksjon for et sluttvolum på 20 μl.
        MERK: ARCA som er inkludert i blandingen, er en hueanalog som bare er innarbeidet i riktig retning. Standard-cap-analoger kan resultere i bare ~ 50% av transkripsjonene har en hette i riktig retning.
      2. Inkuber i 4 timer ved 37 ° C.
      3. Mål RNA-konsentrasjon via et UV-spektrofotometer. Alternativt kan du kjøre en denaturerende agarosegel for å bekrefte lengden på RNA-transkripsjonen.

    4. Redning av smittsomt virus ved elektroporasjon

    1. Dager før elektroporasjon, lag 1 T182-kolbe avVero-celler (mellom T150 og T182 er akseptabelt, dyrket i DMEM + 10% føtalt bovint serum (FBS)) per konstruksjon som skal utvinnes. Inkluder 1 T182 som en mock transfeksjonskontroll. ceLls bør brukes ved 70-80% sammenfletting.
    2. Når celler er klare, plasser 12 ml / reaksjon av DMEM + 15% FBS + 10 mM HEPES i et vannbad oppvarmet til 37 ° C.
    3. Løsne celler ved trypsinisering med en standardprotokoll, og gjenvinne celler i media med 10% FBS for å inaktivere trypsin; Sentrifuger celler ved 150 xg i 5 minutter ved 4 ° C.
    4. Vask celler i 1x fosfatbuffert saltvann (PBS), pelleteringsceller ved 150 xg i 5 minutter ved 4 ° C. Gjenta dette trinnet to ganger for totalt tre vasker.
    5. Resuspender celler i 200 μl RPMI 1640 + 10 mM HEPES (steril) pr. Antall prøver. Overfør 200 μL cellesuspensjon til et sterilt rør. Celler bør være ~ 0,5 x 107 celler / ml.
    6. Tilsett 20 μl vann (mock negkontroll) eller 20 μL RNA (fortrinnsvis 5-10 μg) produsert i trinn 3.4 til hvert sett av celler. Bland forsiktig ved å flippe røret og overfør innholdet av røret til en 2 mm gap elektroporasjonskvette.
    7. Sett en elektrOporator til 170 V LV, omega (motstand) ved 0 og 950 μF (omtrent til 625 V / cm og 20 ms tidskonstant for andre maskiner). Still motstand mot laveste tilgjengelige innstilling, enten 0 eller ∞ hvis tilgjengelig.
    8. Pulsen tilsetter øyeblikkelig 600 μL DMEM +15% FBS + 10 mM HEPES som ble oppvarmet i trinn 4.2. Skyll innsiden av kyvetten grundig for å fjerne alle cellene. Tilsett celler til en T75 vevskulturkolbe som inneholder 10 ml forvarmet medium. Fjern ekstra medier fra kuvetten ved å bruke droperen som følger med kyvetten. Vær forsiktig med å opprettholde sterilitet.
    9. Virvelkolbe for å blande media og celler og plassere i 37 ° C inkubator.
    10. Sjekk neste dag for celleevnen, og gjør det hver dag til 50-75% celledød blir observert. Celledød blir observert ved å sammenligne med den mock elektroporated kontrollen.
      MERK: ZIKV-cytopatisk effekt (CPE) er ganske uttalt i Vero-celler, noe som resulterer i avrundede celler som løsner og flyter i kulturmediet. Vi harObservert et område på 8-10 dager som ideelt for høsting.
    11. Harvest supernatant i et konisk rør og sentrifuger for å fjerne cellulært avfall ved> 3000 xg i 10 minutter ved 4 ° C.
    12. Fjern klarert supernatant til et nytt rør og tilsett med en endelig konsentrasjon på 20% FBS (fra 100% lager). I tillegg tilsett sterile HEPES ved en sluttkonsentrasjon på 10 mM som et buffermiddel for å bevare virusinfeksibilitet mens det fryses (fra en 1 M steril stamme).
    13. Bland viruset ved vortexing og alikvot i skruehetteglass. Oppbevares ved -80 ° C til senere bruk.

    5. Titrering av gjenvunnet virus

    1. Søt det riktige antall 6- eller 12-brønnsplater av Vero-celler dagen før titrering.
    2. Fjern virus fra fryseren og gjør serielle 10-ganger fortynninger i DMEM + 2% FBS i rør eller 96-brønnsplater.
      MERK: Den forventede titer fra utvunnet kloner er mellom 1 x 10 6 og 5 x 10 7 PFU / ml.
    3. Legg til 200 oR 400 μl av hver fortynning i duplikat til en brønn på henholdsvis en 12- eller 6-brønnplate.
    4. Plasser plater i 37 ° C inkubator og stein hvert 15. minutt, for totalt ~ 1-1,5 h adsorpsjonsperiode.
    5. Fjern viral inokulum og legg til 1 ml (12-brønn) eller 2 ml (6-brønn) DMEM-Tragacanth-overlegg til hver brønn.
      MERK: Det er mulig å bruke agarose, agar, metylcellulose eller andre overleggsmedier her.
    6. Inkubér celler i 37 ° C inkubator i 5 dager. Tiden for riktig plakkdannelse vil variere avhengig av det anvendte overlegget.
    7. For å fikse celler, fjern plater fra inkubator og dekanter overlag forsiktig inn i desinfeksjonsmiddel.
    8. Tilsett tilstrekkelig 20% ​​etanol / 0,1% krystallviolett (CV) til hver brønn for å dekke og virke for å blande.
      MERK: Mange andre fikseringsmidler finnes og kan brukes her. I tillegg kan et annet overlegg brukes ved bruk av agarose- eller agaroverlegg, sammen med nøytralt rød for å visualisere plaketter uten fiksering. 20% etanol har vist seg å væreEffektiv i å inaktivere innhyllede virus i tidligere studier; Ikke bruk dette beløpet for ikke-innhyllede virus, da de ikke vil bli inaktivert 19 .
    9. Inkuber plater i 30-60 minutter ved romtemperatur (i et klasse II biosikkerhetsskap); Kast CV (etter lokale bestemmelser) og vaskeplater med vann fra springen.
    10. La platene tørke og teller plakkene manuelt.
      MERK: Referanse 20 kan brukes som en ekstra referanse for å utføre plakkanalyser.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Protokollen beskrevet her muliggjør utvinning av infeksiøst klonavledet Zika-virus. Manipulering av det to-plasmidinfeksjonelle klonsystemet er rettferdig når det utføres med forsiktighet, sammenlignet med full lengdeversjoner som er svært ustabile (data ikke vist). Etter fordøyelse og ligering av de to adskilte stykkene, blir takket RNA fremstilt ved bruk av in vitro transkripsjon med T7-polymerase, som deretter elektroporeres i Vero-celler ( Figur 1 ). Korrekt plasmidsekvens kan overvåkes ved bruk av restriksjonsfordøyelse som proxy etter miniprep ( Figur 2a ) og via Sanger-sekvensering etter storskala DNA-produksjon med RCA eller maxiprep. Etter bekreftelse av klonene ved sekvensering krever gjenvinning av smittsomt virus bare fordøyelse, ligering, in vitro transkripsjon og til slutt elektroporasjon. Disse trinnene kan utføres på en dag. Riktig digeStion og ligering kan overvåkes med agarosegelelektroforese ( figur 2b ), slik at det muliggjør feilsøking.

    Som vist i figur 3 , repliserer infeksiøst klonavledet virus til lignende nivåer som foreldringsisolatet in vitro i flere cellelinjer, hvilket antyder at det gjenvunnede virus fra cDNA replikerer på lignende måte som primærisolatet. I tillegg ble det ikke observert signifikante forskjeller mellom det infeksiøse klonavledede viruset og foreldresolatet i overlevelsesgrader hos mus eller infeksjonshastigheter, spredning og overføring i Aedes aegypti mosquitoes ( figur 4 ).

    Figur 1
    Figur 1: Arbeidsflyt av ZIKV-redning fra en to-plasmid-cDNA-klon.Genomet av ZIKV-stammen PRVABC59 ble klonet i to-separate biter i en pACYC177-plasmid-ryggrad. De to plasmidene ble deretter fordøyd og ligert med T4 DNA ligase. Capped-infectious RNA ble deretter produsert via in vitro transkripsjon etterfulgt av elektroporation i Vero-celler. (Figur tilpasset fra referanse 21 ). Vennligst klikk her for å se en større versjon av denne figuren.

    Figur 2
    Figur 2: Gelelektroforese for å overvåke fordøyelse og ligering av cDNA klon. ( A ) Initial restriksjon fordøyelse av miniprep-avledede plasmider for å vurdere genetisk stabilitet. ( B ) Eksempler på fordøyelses- og ligeringsprodukter under gjenvinning av smittsomt virus fra to-plasmidklonsystemet. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Vennligst klikk her for å se en større versjon av denne figuren.

    Figur 3
    Figur 3: In vitro vekstkinetikk av klonavledet virus. Vekstkinetikk av vildtype PRVABC59 og infeksiøst klonavledet virus på mennesker (SH-SY5Y, Jar og NTERA2 cI.D1), mygg (C6 / 36, Aag2) og ikke-humant primat (Vero) cellelinjer ble vurdert ved plaque assay. N = 3 Feilstenger representerer standardavvik fra gjennomsnittet. (Figur tilpasset fra referanse 21 ). Vennligst klikk her for å se en større versjon av denne figuren.

    55857fig4.jpg "/>
    Figur 4: In vivo karakterisering av klonavledet virus i mus og mygg. ( A ) 4 uker gammel mannlig og kvinnelig interferon alfa, beta og gamma-reseptor knockout, AG129, mus ble intraperitonealt inokulert med 1000 PFU av PRVABC59 eller det smittsomme klonavledede viruset og overvåket over tid for overlevelse (n = 11). Aedes aegypti mygg ble gitt et smittsomt blodmel som inneholdt ZIKV og dissekerte 14 dager senere. ( B ) Plaque-analyser ble brukt til å vurdere mygglegemer (infeksjon), ben (spredning) eller spyttekremer (overføring) for smittsomt virus. Priser presenteres som prosent av de totale myggene som ble testet (Figur tilpasset referanse 21 ). Vennligst klikk her for å se en større versjon av denne figuren.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Forfatterne har ingenting å avsløre.

    Acknowledgments

    Forfatterne vil gjerne takke Kristen Bullard-Feibelman, Milena Veselinovic og Claudia Rückert for deres hjelp til å karakterisere klonavledet virus. Dette arbeidet ble delvis støttet av stipend fra National Institute of Allergy and Infectious Diseases, NIH under tilskudd AI114675 (BJG) og AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics