Rettung und Charakterisierung des rekombinanten Virus aus einer neuen Welt Zika Virus Infectious Clone

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dieses Protokoll beschreibt die Wiederherstellung des infektiösen Zika-Virus aus einem zwei-Plasmid-infektiösen cDNA-Klon.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Infektiöse cDNA-Klone erlauben die genetische Manipulation eines Virus und erleichtern so die Arbeit an Impfstoffen, Pathogenese, Replikation, Übertragung und Virusentwicklung. Hier beschreiben wir den Aufbau eines infektiösen Klons für Zika Virus (ZIKV), der derzeit einen explosiven Ausbruch in Nord- und Südamerika verursacht. Um Toxizität gegenüber Bakterien zu verhindern, die häufig mit Flavivirus-abgeleiteten Plasmiden beobachtet wird, erzeugten wir ein Zwei-Plasmid-System, das das Genom am NS1-Gen trennt und stabiler ist als Volllängen-Konstrukte, die ohne Mutationen nicht erfolgreich gewonnen werden konnten. Nach der Verdauung und Ligation, um die beiden Fragmente zu verbinden, kann eine Volllängen-Virus-RNA durch in vitro- Transkription mit T7-RNA-Polymerase erzeugt werden. Nach der Elektroporation von transkribierter RNA in Zellen wurde das Virus gewonnen, das ähnliche In-vitro- Wachstumskinetiken und In-vivo- Virulenz- und Infektions-Phänotypen in Mäusen und Mücken zeigte.

Introduction

Zika-Virus (ZIKV, Familie Flaviviridae : Gattung Flavivirus ) ist ein Moskito-getragenes Flavivirus, das in Brasilien in den Jahren 2013-14 angekommen ist und anschließend mit einem massiven Ausbruch der fiebrigen Krankheit verbunden war, die sich in ganz Amerika verbreitete 1 . Darüber hinaus wurde ZIKV mit schwerwiegenden Erkrankungen wie dem Guillain-Barré-Syndrom bei Erwachsenen und Mikrozephalie bei Föten und Neugeborenen verknüpft 2 . Wenig war über ZIKV vor seiner schnellen Verbreitung in der westlichen Hemisphäre bekannt. Dazu gehört ein Mangel an molekularen Werkzeugen, was die mechanistische Forschung behindert. Molekulare Werkzeuge für Viren, wie infektiöse cDNA-Klone, erleichtern die Impfung und die antivirale therapeutische Entwicklung und ermöglichen die Bewertung von viralen genetischen Faktoren, die mit der differentiellen viralen Pathogenese, der Immunantwort und der viralen Evolution zusammenhängen.

Flavivirus-infektiöse Klone sind bekannt, dass sie in Bakterien aufgrund von cr stark instabil sindYptische prokaryotische Promotoren, die in ihren Genomen vorhanden sind 3 . Es wurden mehrere Ansätze verwendet, um dieses Problem zu lindern; Einschließlich der Insertion von Tandemwiederholungen stromaufwärts von viralen Sequenzen 4 , Mutation von mutmaßlichen prokaryotischen Promotorsequenzen 5 , Aufteilen des Genoms in mehrere Plasmide 6 , Vektoren mit niedriger Kopienzahl (einschließlich bakterieller künstlicher Chromosomen) 7 , 8 und Insertion von Introns im viralen Genom 9 . Ein einseitiges System ohne Modifikationen wurde für ZIKV beschrieben; Dieser Klon schien jedoch in der Zellkultur und bei den Mäusen 10 zu dämpfen. Andere Gruppen haben Introns in das ZIKV-Genom konstruiert, was eine Störung von instabilen Sequenzen in Bakterien ermöglicht, die in Säugetierzellen in vitro zur Herstellung von infektiösem Virus 11 gespleißt werden können, 12 Zusätzlich wurde ein PCR-basiertes System mit dem Titel Infectious-Subgenomic-Amplicons erfolgreich eingesetzt, um den Prototyp MR766-Stamm von ZIKV 13 zu retten. Der hier beschriebene Ansatz erfordert keine Fremdsequenzen, sondern stört das Genom im Bereich hoher Instabilität durch die Verwendung mehrerer Plasmide, die bisher erfolgreich mit Gelbfieber 6 , Dengue 14 , 15 und West-Nil-Viren 16 verwendet wurden. Darüber hinaus erleichtert die Zugabe der Hepatitis-D-Ribozym-Sequenz an den viralen genomischen Termini die Schaffung eines authentischen 3'-Endes ohne die Notwendigkeit der Addition einer Linearisierungsstelle. Zusätzlich werden beide Plasmide in einem Vektor mit niedriger Kopienzahl (pACYC177, ~ 15 Kopien pro Zelle) konstruiert, um jegliche Resttoxizität 17 zu mildern. Das gewonnene Virus zeigt ein vergleichbares Wachstumsprofil anElterliches Virus in in vitro Wachstumskurven in 8 Zelllinien, die eine Vielzahl von Zelltypen umfassen, die von Säugetieren und Insekten abgeleitet sind, und hat identische pathogene Profile bei Mäusen und Infektions-, Verbreitungs- und Übertragungsraten in den Mücken 18 gezeigt .

Hierin beschreiben wir ein Protokoll, in dem beschrieben wird, wie man die infektiösen Klonplasmide wächst, in vitro eine Volllängen-Virus-RNA (das virale Genom) erzeugt und in der Zellkultur ein infektiöses Virus wiederherstellt. Zuerst beschreiben wir die Ausbreitung von Plasmiden in Bakterien oder bakterienfreien Verstärkung mittels Rollkreisverstärkung (RCA). Als nächstes zeigen wir, wie die beiden Plasmide verdaut werden und dann anschließend miteinander ligiert werden, um ein Volllängenvirus zu erzeugen. Schließlich beschreiben wir die Produktion von transkribierter RNA und deren anschließende Elektroporation in Vero-Zellen, gefolgt von Titration des gewonnenen Virus (Abbildung 1 ). Der beschriebene Ansatz ist schnell, so dass foR Erholung von infektiösen Virusbeständen in 1-2 Wochen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transformation und Wiederherstellung von infektiösen Klonplasmiden

  1. Transformieren Sie beide Plasmide (getrennt) unter Verwendung eines kommerziellen Transformationsprotokolls ( z. B. NEB 5 Minute Transformation Protocol) mit einigen Modifikationen. Beide Plasmide enthalten ein für die Ampicillinresistenz kodierendes Gen, daher verwenden sie Ampicillin oder Carbenicillin zur Selektion. Carbenicillin wird bevorzugt, da es stabiler ist.
    1. Entfernen Sie die Zellen (siehe Materialtabelle) von -80 ° C Gefrierschrank und tauen Sie auf Eis für 5-10 min. Prewarm Lysogeny Brühe (LB) (mit 10 g / l NaCl und 25 μg / ml Carbenicillin, genannt LB-Carb) Platten und die Brühe mit Catabolit Repression (SOC (ohne Antibiotika) - kommen mit den Zellen) bei 37 ° C.
    2. Füge zwischen 100 pg-10 ng in 1 μl Plasmid-DNA zu einem Röhrchen hinzu, das 50 μl kompetente Zellen enthält; Mischen Sie vorsichtig, indem Sie die Tube schlagen.
    3. Röhrchen auf Eis für 5 min inkubieren.
    4. Hitzeschockrohre bei 42 ° C für 30 sIn einem wasserbad Rückkehr zum Eis für 2 min unmittelbar nach Hitzeschock.
    5. 950 μl Raumtemperatur SOC in jedes Röhrchen pipettieren und durch Pipettieren mischen. 100 μl des Bakteriengemisches auf eine LB-Carb-Platte auftragen und über Nacht bei 37 ° C inkubieren (ca. 12-14 h).
  2. Entfernen von Platten aus 37 ° C Inkubator nach 12-14 h Inkubation. Legen Sie die Platten in eine dunkle Schublade bei Raumtemperatur, damit Kolonien weiter wachsen (ca. 8-9 h).
  3. Unter Verwendung von 5 ml Terrific Brühe (TB, enthaltend 25 & mgr; g / ml Carbenicillin, genannt TB-Carb), wachsen 5-10 kleine Kolonien für jedes Plasmid über Nacht bei 30 ° C in einem Bakterienschüttler (etwa 14-16 h).
    HINWEIS: Kleine Kolonien sind ein Indikator dafür, dass das Plasmid intakt ist; Kolonien mit Plasmiden, die Deletionen, Umlagerungen oder Mutationen enthalten (hierin Instabilitätsereignisse genannt), werden schneller wachsen und sind daher größer. Deshalb sollte man versuchen, die kleinsten Kolonien auf dem Teller zu holen, namentlichT Auswahl der größten Kolonien vorhanden. Einige mittelgroße Kolonien können auch für Vollständigkeit ausgewählt werden. Die niedrigere Temperatur reduziert die Wahrscheinlichkeit, dass die Zellen überwachsen (OD 600 von größer als 0,6-0,8). Da die meisten Forscher über Nacht Wachstum durchführen, ermöglicht es mehr Kontrolle und reduzierte Chance der Überwucherung.
  4. Prüfen Sie flüssige Kulturen auf Trübungen (ca. OD 600 von 0,6-0,8). Legen Sie alle trüben Rohre auf 4 ° C und lassen Sie andere Röhrchen trüben, indem Sie länger wachsen.
    HINWEIS: Bakterien nicht auf OD 600- Werte wachsen, die größer als empfohlen sind, da Plasmid-Instabilitätsereignisse auftreten können.
  5. Extrahieren Sie Plasmid-DNA aus Bakterien mit einem handelsüblichen Plasmid-Miniprep-Kit (siehe Materialtabelle). Eluieren in 15 & mgr; l vorgewärmtem (bis 70 ° C in einem Heizblock) Elutionspuffer. Lassen Sie den Elutionspuffer 5 Minuten lang vor der Zentrifugation auf die Säule inkubieren.
    HINWEIS: Bewahren Sie mindestens 1 ml dieser Starterkultur bei 4 ° C fürWeiter im nächsten Schritt.
  6. Digg 10 & mgr; l der gewonnenen Plasmide, um zu beurteilen, ob Plasmid-Instabilitätsereignisse während der Kultur auftraten.
    HINWEIS: Digit p1 mit SalI / NheI und p2 mit BamHI / HindIII bei 37 ° C für 1 h. Bestätigen Sie die Anwesenheit der korrekten Banden nach der Verdauung (Abbildung 2a ) durch Gelelektrophorese und fahren Sie mit Schritt 2 fort. Wenn Sie Plasmid-DNA durch Walzkreisverstärkung (RCA) vorbereiten, reservieren Sie ein Teil des Miniprep-Eluats, um als Vorlage zu dienen.

2. Herstellung von ausreichend Plasmid-DNA zur Ligation

HINWEIS: Die Ligation und die anschließende Elektroporation erfordert eine ausreichende Menge an Plasmid-DNA, die entweder über Maxiprep oder RCA erzeugt werden muss. Während maxiprep der traditionell verwendete Ansatz ist, bietet RCA den Vorteil, dass keine Bakterien erforderlich sind, wodurch das Potential für die Plasmid-induzierte Toxizität in Bakterien, die zu Instabilitätsereignissen führen können, entfernt wird.

  1. Für jedes Plasmid, das im vorigen Abschnitt das korrekte Restriktionsenzym-Verdauungsmuster nachgewiesen hat, fügen Sie 500 & mgr; l Starterkultur zu 1 l TB-Carb (25 & mgr; g / ml Carbenicillin) -brühe hinzu und schütteln über Nacht bei 30 ° C (ungefähr 14-16 h , Etwa OD 600 von 0,6-0,8).
    HINWEIS: Lassen Sie die Kultur nicht über diesen OD 600- Wert wachsen. Dies führt möglicherweise zu Instabilitätsereignissen innerhalb der Plasmide.
  2. Ernten Sie die Bakterien und führen Sie maxipreps pro Hersteller-Protokoll (siehe Material-Tabelle).
  • Verwenden Sie die gespeicherten Miniprep ab Schritt 1.6, führen Sie die folgenden für die RCA-Prozedur durch.
    1. Übertragen Sie 1 & mgr; l Plasmid-DNA in ein Röhrchen, das 50 & mgr; l Probenpuffer enthält.
    2. Die Probe bei 95 ° C für 3 min erhitzen und dann bei 4 ° C inkubieren, bis sie gebrauchsfertig sind.
    3. Bereitet die kommerzielle Verstärkung vorVormischung (siehe Werkstofftabelle ). Kombinieren Sie 50 μl Reaktionspuffer mit 2 μl Enzymmischung in einem auf Eis eingesetzten Röhrchen.
      HINWEIS: Die Amplifikationsvormischung sollte bis zum Gebrauch auf Eis gehalten werden. Es ist zweckmäßig, eine Mastermischung durch Kombination von ausreichenden Reagenzien für die erforderliche Anzahl von Amplifikationsreaktionen herzustellen. Eine nicht genutzte Vormischung muss verworfen werden.
    4. Übertragen Sie 50 & mgr; l der vorbereiteten Amplifikationsvormischung auf die denaturierte Probe.
    5. Inkubieren Sie die Reaktionsröhrchen bei 30 ° C für 18 h.
    6. Inkubieren Sie die Röhrchen bei 65 ° C für 10 min, um die ø29-DNA-Polymerase zu inaktivieren.
    7. Die Reaktionsrohre bei 4 ° C oder -20 ° C bis zum Gebrauch aufbewahren.
      HINWEIS: Zu diesem Zeitpunkt sollte die Plasmid-DNA, die über beide Methoden hergestellt wurde, quantifiziert werden (unter Verwendung von Absorption bei 260 nm), und das ZIKV-Genom sollte Sanger sequenziert werden, um zu bestätigen, dass keine Instabilitätsereignisse (Deletionen und Umlagerungen) während der Präparation auftraten.
  • Primer Name Sequenz (5 '- 3')
    ZIKV PRVABC59 1Für. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV konserviert 632Für. GCCCTATGCTGGATGAGG
    ZIKV konserviert 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV konserviert 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV konserviert 1201Für. CCAACACAAGGTGAAGCCTAC
    ZIKV konserviert 1663Für. GCAGACACCGGAACTCCACACT
    ZIKV konserviert 2008Für. CAGATGGCGGTGGACATGC
    ZIKV konserviert 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV konserviert 2605Für. TACAAGTACCATCCTGACTCCC
    ZIKV konserviert 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV Konserviert 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV konserviert 4132Für. CATTTGTCATGGCCCTGG
    ZIKV konserviert 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV konserviert 4665Für. GACCACAGATGGAGTGTACAGAGT
    ZIKV konserviert 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV konserviert 5219Für. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV konserviert 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV konserviert 6119Für. GCCTCATAGCCTCGCTCTATCG
    ZIKV konserviert 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV konserviert 6769Für. CCAGCCAGAATTGCATGTGTCC
    ZIKV Konserviert 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV Konserviert 7343Für. GTTGTGGATGGAATAGTGGT
    ZIKV Konserviert 8243Für. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV konserviert 9133Für. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV konserviert 9686Für. GATGATAGGTTTGCACATGCC
    ZIKV Konserviert 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV konserviert 10455Für. CAGGAGAAGCTGGGAAACC
    ZIKV konserviert 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tabelle 1: Primer zur Sequenzierung von cDNA-Klonen. Plasmide können vollständig mit den aufgeführten Primern sequenziert werden. Primer markiert als "konserviert" indiDass sie wahrscheinlich alle Genotypen von ZIKV sequenzieren / verstärken können. Primer, die als "PRVABC59" markiert sind, sind spezifisch für diesen Stamm, können aber auch für andere asiatische Genotypstämme und möglicherweise auch andere Genotypen funktionieren.

    3. Herstellung von in vitro transkribierter RNA

    1. Richten Sie die Verdauungsreaktion von entweder maxiprep oder RCA vorbereitete DNA ein.
      1. Zur p1-Verdauung werden 10 μl 10x Reaktionspuffer, 3 μl ApaLI, 3 μl BamHI-HF, 3 μl rSAP oder CIP und 3,3 μg p1 DNA vermischt. Füge ddH 2 O zu 100 μl hinzu.
      2. Zur p2-Verdauung 10 μl 10x Reaktionspuffer, 3 μl ApaLI, 3 μl EcoRI-HF und 13,3 μg p2 DNA mischen. Füge ddH 2 O zu 100 μl hinzu.
      3. Inkubieren bei 37 ° C für 1-2 h.
      4. Reinigen Sie mit einem handelsüblichen Gel- und PCR-Clean-up-Kit (siehe Materialtabelle). Eluieren in 30 & mgr; l Elutionspuffer, der auf 70 ° C in einem Heizblock vorgeheizt ist (inkubieren derSpalte für 5 min vor dem Spinnen).
        HINWEIS: Halten Sie 1 μL auf einem Gel später.
    2. Ligationsreaktion vorbereiten.
      1. Kombinieren Sie 10 μl 10x T4-DNA-Ligationsreaktionspuffer, 3 μl T4-DNA-Ligase (400 U / μL), 29 μl gereinigtes p1 und 29 μl gereinigtes p2. Füge ddH 2 O zu 100 μl hinzu.
      2. Inkubieren bei Raumtemperatur für 2 h oder 16 ° C über Nacht.
      3. Reinigen Sie mit einem handelsüblichen Gel- und PCR-Clean-up-Kit (siehe Materialtabelle). Eluieren in 10 & mgr; l Elutionspuffer, der auf 70 ° C in einem Heizblock vorgeheizt wurde (5 Minuten vor dem Spinnen inkubieren).
        HINWEIS: Halten Sie 1 μL auf einem Gel später.
    3. Führen Sie unverdaute Plasmide, verdaute Plasmide und Ligation auf einem Agarosegel. Das Ligationsprodukt sollte eine höhere Molekulargewichtsbande (etwa 11 kb) als nur verdautes Plasmid allein aufweisen, was anzeigt, dass die Ligation erfolgreich war ( 2b ).
    4. Richten Sie T7 in vitro Transkriptionsreaktion ein.
      1. Kombinieren Sie 10 & mgr; l 2 × ARCA / NTP-Mischung, 2 & mgr; l T7-RNA-Polymerase-Mischung und 8 & mgr; l gereinigte Ligationsreaktion für ein Endvolumen von 20 & mgr; l.
        HINWEIS: Die im Mix enthaltene ARCA ist ein Cap-Analog, das exklusiv in die richtige Orientierung integriert ist. Standard-Cap-Analoga können nur ~ 50% der Transkripte mit einer Kappe in der richtigen Orientierung führen.
      2. 5 h bei 37 ° C inkubieren.
      3. Messung der RNA-Konzentration über ein UV-Spektrophotometer. Gegebenenfalls ein denaturierendes Agarosegel ausführen, um die Länge des RNA-Transkripts zu bestätigen.

    4. Rettung des Infektionsvirus durch Elektroporation

    1. Tage vor der Elektroporation, 1 T182-Kolben von Vero-Zellen herstellen (zwischen T150 und T182 ist akzeptabel, in DMEM + 10% fötalem Rinderserum (FBS) gezüchtet) pro zu ersetzendes Konstrukt. Füge 1 T182 als Mock-Transfektionskontrolle ein. CeSollte bei 70-80% Konfluenz verwendet werden.
    2. Wenn die Zellen fertig sind, legen Sie 12 ml / Reaktion von DMEM + 15% FBS + 10 mM HEPES in ein auf 37 ° C erwärmtes Wasserbad.
    3. Lösen Sie Zellen durch Trypsinisierung mit einem Standardprotokoll und gewinnen Sie Zellen in Medien mit 10% FBS, um Trypsin zu inaktivieren; Zentrifugen von Zellen bei 150 xg für 5 min bei 4 ° C.
    4. Waschen von Zellen in 1x phosphatgepufferter Kochsalzlösung (PBS), Pelletieren von Zellen bei 150 xg für 5 min bei 4 ° C. Wiederholen Sie diesen Schritt zweimal für insgesamt drei Wäschen.
    5. Resuspendieren von Zellen in 200 & mgr; l RPMI 1640 + 10 mM HEPES (steril) pro Anzahl der Proben. 200 μl Zellsuspension in ein steriles Röhrchen überführen. Zellen sollten ~ 0,5 x 10 7 Zellen / ml sein.
    6. Füge 20 μl Wasser (Mock Neg. Kontrolle) oder 20 μl RNA (vorzugsweise 5-10 μg) in Schritt 3.4 zu jedem Satz von Zellen zu. Mischen Sie vorsichtig, indem Sie das Röhrchen schlagen und den Inhalt des Röhrchens in eine 2 mm Spalt-Elektroporationsküvette übertragen.
    7. Elektrisch einstellenOporator auf 170 V LV, Omega (Widerstand) bei 0 und 950 μF (ca. 625 V / cm und 20 ms Zeitkonstante für andere Maschinen). Stellen Sie den Widerstand auf die niedrigste verfügbare Einstellung ein, entweder 0 oder ∞ falls vorhanden.
    8. Pulse einmal und fügt sofort 600 μl DMEM +15% FBS +10 mM HEPES hinzu, das in Schritt 4.2 erwärmt wurde. Innerhalb der Küvette gründlich ausspülen, um alle Zellen zu entfernen. Füge Zellen zu einem T75-Gewebekulturkolben hinzu, der 10 ml vorgewärmtes Medium enthält. Entfernen Sie zusätzliche Medien aus der Küvette, indem Sie die mit der Küvette enthaltene Tropfmaschine verwenden. Sei vorsichtig, um die Sterilität aufrechtzuerhalten.
    9. Wirbelkolben zum Mischen von Medien und Zellen und Platzieren in 37 ° C Inkubator.
    10. Überprüfen Sie den nächsten Tag auf die Lebensfähigkeit der Zellen und tun Sie es jeden Tag bis 50-75% Zelltod beobachtet wird. Der Zelltod wird durch Vergleich mit der mockelektroporierten Kontrolle beobachtet.
      HINWEIS: Der ZIKV-Zytopathie-Effekt (CPE) ist in Vero-Zellen sehr ausgeprägt, was zu aufgerundeten Zellen führt, die sich im Kulturmedium ablösen und schwimmen. Wir habenBeobachtete eine Reichweite von 8-10 Tagen als ideal für die Ernte.
    11. Ernteüberstand in einem konischen Rohr und zentrifugieren, um Zellschutt bei> 3.000 xg für 10 min bei 4 ° C zu entfernen.
    12. Den geklärten Überstand auf ein neues Röhrchen auftragen und mit einer Endkonzentration von 20% FBS (ab 100% Lager) ergänzen. Zusätzlich fügen Sie sterile HEPES in einer Endkonzentration von 10 mM als Puffermittel hinzu, um die Virusinfektiosität zu bewahren, während sie gefroren sind (aus einem 1 M sterilen Bestand).
    13. Mischen Sie das Virus durch Vortexen und Aliquot in Schraubverschluss-Durchstechflaschen. Bei -80 ° C für zukünftige Verwendung lagern.

    5. Titration des wiederhergestellten Virus

    1. Saat die passende Anzahl von 6- oder 12-Well-Platten von Vero-Zellen am Tag vor der Titration.
    2. Virus aus dem Gefrierschrank entfernen und serielle 10-fache Verdünnungen in DMEM + 2% FBS in Röhrchen oder 96-Well-Platten herstellen.
      HINWEIS: Der erwartete Titer aus wiederhergestellten Klonen liegt zwischen 1 x 10 6 und 5 x 10 7 PFU / mL.
    3. Hinzufügen 200 oR 400 & mgr; l jeder Verdünnung in Duplikat zu einer Vertiefung einer 12- bzw. 6-Well-Platte.
    4. Legen Sie Platten in 37 ° C Inkubator und Felsen alle 15 min, für insgesamt 1-1,5 h Adsorption Zeitraum.
    5. Entfernen Sie das Virus-Inokulum und fügen Sie 1 ml (12-Well) oder 2 ml (6-Well) DMEM-Tragacanth-Overlay zu jeder Vertiefung hinzu.
      HINWEIS: Hierbei können Agarose, Agar, Methylcellulose oder andere Überlagerungsmedien verwendet werden.
    6. Inkubieren von Zellen in 37 ° C Inkubator für 5 Tage. Die Zeit für die richtige Plaque-Bildung hängt von der verwendeten Überlagerung ab.
    7. Um die Zellen zu fixieren, entfernen Sie die Platten aus dem Inkubator und dekantieren Sie die Überlagerung sanft in das Desinfektionsmittel.
    8. Füge ausreichend 20% Ethanol / 0,1% Kristallviolett (CV) zu jeder Vertiefung hinzu, um zu bedecken und zu mischen zu mischen.
      HINWEIS: Viele andere Fixiermittel existieren und können hier verwendet werden. Zusätzlich kann bei Verwendung eines Agarose- oder Agar-Overlays eine zweite Overlay in Verbindung mit neutralem Rot verwendet werden, um Plaques ohne Fixierung zu visualisieren. 20% Ethanol hat sich gezeigtWirksam bei der Inaktivierung von umhüllten Viren in früheren Studien; Verwenden Sie diesen Betrag nicht für nicht umhüllte Viren, da sie nicht inaktiviert werden. 19 .
    9. Inkubieren von Platten für 30-60 min bei Raumtemperatur (in einem Klasse II Biosicherheitsschrank); CV (nach örtlichen Vorschriften) verwerfen und Platten mit Leitungswasser waschen.
    10. Lassen Sie die Platten trocknen und legen Sie Plaques manuell ein.
      HINWEIS: Referenz 20 kann als zusätzliche Referenz für die Durchführung von Plaque-Assays verwendet werden.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Das hier beschriebene Protokoll ermöglicht die Wiederherstellung von infektiösem Klon-abgeleiteten Zika-Virus. Das Manipulieren des Zwei-Plasmid-Infektios-Klonsystems ist einfach, wenn es mit Sorgfalt durchgeführt wird, im Vergleich zu Volllängen-Versionen, die sehr instabil sind (Daten nicht gezeigt). Nach der Verdauung und Ligation der beiden verschiedenen Stücke wird eine Capped-RNA unter Verwendung einer in vitro- Transkription mit T7-Polymerase hergestellt, die dann in Vero-Zellen elektroporiert wird (Abbildung 1 ). Die korrekte Plasmidsequenz kann mittels Restriktionsverdauung als Proxy nach Miniprep (Abbildung 2a ) und über Sanger-Sequenzierung nach großtechnischer DNA-Produktion mit RCA oder Maxiprep überwacht werden. Nach der Bestätigung der Klone durch Sequenzierung erfordert die Wiederherstellung des infektiösen Virus nur Verdauung, Ligation, in vitro Transkription und schließlich Elektroporation. Diese Schritte können an einem Tag durchgeführt werden. Korrigieren Sie digeStion und Ligation können durch Agarose-Gelelektrophorese überwacht werden (Abbildung 2b ), ggf. zur Fehlersuche.

    Wie in Abbildung 3 gezeigt , repliziert das infektiöse Klon-abgeleitete Virus auf ähnliche Ebenen wie das Eltern-Isolat in vitro in mehreren Zelllinien, was darauf hindeutet, dass das gewonnene Virus aus der cDNA ähnlich wie das primäre Isolat repliziert. Darüber hinaus wurden keine signifikanten Unterschiede zwischen dem infektiösen Klon-abgeleiteten Virus und dem Eltern-Isolat in den Überlebensraten bei Mäusen oder Infektionsraten, Verbreitung und Transmission in Aedes aegypti- Mücken beobachtet (Abbildung 4 ).

    Abbildung 1
    Abbildung 1: Arbeitsablauf der ZIKV-Rettung aus einem Zwei-Plasmid-cDNA-Klon.Das Genom des ZIKV-Stammes PRVABC59 wurde in zwei getrennten Stücken in ein Plasmid-Rückgrat pACYC177 kloniert. Die beiden Plasmide wurden dann verdaut und mit T4-DNA-Ligase ligiert. Capped-infektiöse RNA wurde dann über in vitro- Transkription hergestellt, gefolgt von Elektroporation in Vero-Zellen. (Abbildung nach Referenz 21 ). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    Figur 2
    Abbildung 2: Gelelektrophorese zur Überwachung der Verdauung und Ligation von cDNA-Klon. ( A ) Initiale Restriktionsverdauung von Miniprep-abgeleiteten Plasmiden zur Beurteilung der genetischen Stabilität ( B ) Beispiele für Verdauungs- und Ligationsprodukte während der Gewinnung von infektiösem Virus aus dem Zwei-Plasmid-Klonsystem. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    Abbildung 3
    Abbildung 3: In-vitro- Wachstumskinetik von Klon-abgeleiteten Viren. Die Wachstumskinetik des Wildtyps PRVABC59 und des infektiösen Klon-Virus auf menschlichen (SH-SY5Y, Jar und NTERA2 cI.D1), Moskito (C6 / 36, Aag2) und Nicht-Human-Primaten (Vero) Zelllinien wurden durch Plaque-Assay beurteilt. N = 3 Fehlerbalken stellen eine Standardabweichung vom Mittelwert dar. (Abbildung nach Referenz 21 ). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    55857fig4.jpg "/>
    Abbildung 4: In vivo Charakterisierung von Klon-abgeleiteten Virus bei Mäusen und Mücken. ( A ) 4 Wochen alten männlichen und weiblichen Interferon alpha, beta und gamma Rezeptor Knockout, AG129, wurden Mäuse intraperitoneal mit 1.000 PFU von PRVABC59 oder dem infektiösen Klon-abgeleiteten Virus inokuliert und über die Zeit zum Überleben (n = 11) überwacht. Aedes aegypti Moskitos erhielten ein infektiöses Blutmehl mit ZIKV und seziert 14 Tage später. ( B ) Plaque-Assays wurden verwendet, um Moskitokörper (Infektion), Beine (Verbreitung) oder Speichelsekrete (Übertragung) für infektiöses Virus zu beurteilen. Die Preise werden als Prozentsatz der gesamten Mücken, die getestet wurden (Abbildung angepasst aus Referenz 21 ) dargestellt. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Die Autoren haben nichts zu offenbaren.

    Acknowledgments

    Die Autoren danken Kristen Bullard-Feibelman, Milena Veselinovic und Claudia Rückert für ihre Unterstützung bei der Charakterisierung des vom Klon abgeleiteten Virus. Diese Arbeit wurde teilweise durch Zuschüsse des Nationalen Instituts für Allergie und Infektionskrankheiten, NIH unter den Stipendien AI114675 (BJG) und AI067380 (GDE) unterstützt.

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics