Salvamento e Caracterização do Vírus Recombinante de um Clone Infeccioso do Vírus do Novo Mundo Zika

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este protocolo descreve a recuperação do vírus Zika infeccioso a partir de um clone de cDNA infeccioso com dois plasmídeos.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Os clones de cDNA infecciosos permitem a manipulação genética de um vírus, facilitando assim o trabalho em vacinas, patogênese, replicação, transmissão e evolução viral. Aqui descrevemos a construção de um clone infeccioso para o vírus Zika (ZIKV), que atualmente está causando um surto explosivo nas Américas. Para evitar a toxicidade para bactérias comumente observadas com plasmídeos derivados de flavivírus, geramos um sistema de dois plasmídeos que separa o genoma no gene NS1 e é mais estável que as construções de comprimento total que não puderam ser recuperadas com sucesso sem mutações. Após a digestão e a ligação para unir os dois fragmentos, o ARN viral completo pode ser gerado por transcrição in vitro com polimerase de ARN T7. Após a eletroporação do ARN transcrito nas células, recuperou-se o vírus que apresentava cinética de crescimento in vitro semelhante e fenótipos de virulência e infecção in vivo em camundongos e mosquitos, respectivamente.

Introduction

O vírus Zika (ZIKV; Família Flaviviridae : Gênero Flavivírus ) é um flavivírus transmitido por mosquito que chegou ao Brasil em 2013-14 e posteriormente foi associado a um surto maciço de doença febril que se espalhou pelas Américas 1 . Além disso, o ZIKV tem sido associado a desfechos graves da doença, como a síndrome de Guillain-Barré em adultos e microcefalia em fetos e neonatos 2 . Pouco se sabia sobre ZIKV antes da sua rápida propagação no hemisfério ocidental. Isso incluiu a falta de ferramentas moleculares, dificultando assim a pesquisa mecanicista. Ferramentas moleculares para vírus, tais como clones de cDNA infecciosos, facilitam a vacina e o desenvolvimento terapêutico antiviral e permitem a avaliação de fatores genéticos virais relacionados à patogênese viral diferencial, resposta imune e evolução viral.

Os clones infecciosos de Flavivirus são conhecidos por serem altamente instáveis ​​em bactérias devido a crPromotores procarióticos ypticos presentes em seus genomas 3 . Várias abordagens têm sido usadas para melhorar esse problema; Incluindo a inserção de repetições em tandem a montante das sequências virais 4 , mutação das seqüências promotoras procarióticas putativas 5 , dividindo o genoma em múltiplos plasmídeos 6 , vetores numéricos de baixa cópia (incluindo cromossomos artificiais bacterianos) 7 , 8 e inserção de intrões no genoma viral 9 . Um sistema completo sem modificações foi descrito para ZIKV; No entanto, este clone pareceu ser atenuado na cultura celular e em camundongos 10 . Outros grupos criaram intrões no genoma de ZIKV, permitindo a interrupção de seqüências instáveis ​​em bactérias que podem ser empalmadas em células de mamíferos in vitro para a produção de vírus infecciosos 11, 12 . Além disso, um sistema baseado em PCR, intitulado Infectious-Subgenomic-Amplicons, foi utilizado com sucesso para resgatar o protótipo MR766 de ZIKV 13 . A abordagem descrita aqui não requer seqüências estranhas, mas sim interrompe o genoma na região de alta instabilidade usando múltiplos plasmídeos, que já foram utilizados com sucesso com vírus da febre amarela 6 , dengue 14 , 15 e do Nilo Ocidental 16 . Além disso, a adição da sequência de ribozima da hepatite D no terminal genômico viral facilita a criação de um autêntico final 3 'sem a necessidade de adicionar um site de linearização. Além disso, ambos os plasmídeos são construídos em um vetor de números de baixa cópia (pACYC177, ~ 15 cópias por célula) para mitigar qualquer toxicidade residual 17 . O vírus recuperado exibe um perfil de crescimento comparável aoVírus parental em curvas de crescimento in vitro em 8 linhas celulares compreendendo uma variedade de tipos de células derivadas de mamíferos e insetos e exibiu perfis patogênicos idênticos em camundongos e taxas de infecção, disseminação e transmissão em mosquitos 18 .

Aqui, detalhamos um protocolo descrevendo como cultivar os plasmídeos de clones infecciosos, gerar RNA viral completo (o genoma viral) in vitro e recuperar vírus infecciosos em cultura celular. Primeiro, descrevemos a propagação de plasmídeos em bactérias ou amplificação sem bactérias usando amplificação do círculo circulante (RCA). Em seguida, mostramos como os dois plasmídeos são digeridos e subsequentemente ligados em conjunto para gerar vírus de comprimento total. Finalmente, descrevemos a produção de ARN transcrito e sua subsequente eletroporação em células Vero, seguidas de titulação de vírus recuperado ( Figura 1 ). A abordagem descrita é rápida, permitindo queR recuperação de stocks de vírus infecciosos em 1-2 semanas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transformação e Recuperação de Plasmídeos de Clone Infecciosos

  1. Transforme ambos os plasmídeos (separadamente) usando um protocolo de transformação comercial ( por exemplo , NEB 5 Minute Transformation Protocol) com algumas modificações. Ambos os plasmídeos contêm um gene que codifica a resistência à ampicilina, portanto, use ampicilina ou carbenicilina para seleção. A carbanilhilina é preferida, pois é mais estável.
    1. Remova as células (veja a Tabela de Materiais) a partir de um congelador de -80 ° C e descongelar no gelo durante 5-10 min. Caldo de lisogenia de pré-aquecimento (LB) (contendo placas de 10 g / L de NaCl e 25 μg / mL de carbenicilina, chamadas LB-carb) e o caldo com repressão de catabolitos (SOC (sem antibióticos) - chegando com as células) a 37 ° C.
    2. Adicionar entre 100 pg-10 ng em 1 μL de ADN plasmídico a um tubo contendo 50 μL de células competentes; Misture suavemente acendendo o tubo.
    3. Incubar tubos em gelo durante 5 min.
    4. Tubos de choque térmico a 42 ° C durante 30 sEm banho-maria. Retorne ao gelo durante 2 minutos imediatamente após choque térmico.
    5. Pipetar 950 μL de temperatura ambiente COS em cada tubo e misturar por pipetagem. Distribuir 100 μL da mistura bacteriana sobre uma placa LB-carb e incubar durante a noite a 37 ° C (aproximadamente 12-14 h).
  2. Retire as placas da incubadora a 37 ° C após 12-14 h de incubação. Coloque as placas em uma gaveta escura à temperatura ambiente para permitir que as colônias continuem a crescer (aproximadamente 8-9 h).
  3. Usando 5 mL de caldo Terrific (TB, contendo 25 μg / mL de carbenicilina, chamado TB-carb), cresça 5-10 pequenas colônias para cada plasmídeo durante a noite a 30 ° C em um agitador bacteriano (aproximadamente 14-16 h).
    NOTA: As pequenas colônias são um indicador de que o plasmídeo está intacto; Colônias com plasmídeos contendo deleções, rearranjos ou mutações (aqui denominados eventos de instabilidade) crescerão mais rapidamente e, portanto, serão maiores. Portanto, deve-se tentar escolher as colônias mais pequenas na placa, especificamente nãoT selecionando as maiores colônias presentes. Algumas colônias de tamanho médio também podem ser selecionadas para integridade. A menor temperatura utilizada reduz a probabilidade de as células serem superadas (OD 600 acima de 0,6-0,8). Como a maioria dos pesquisadores realiza um crescimento durante a noite, ele permite mais controle e menor chance de crescimento excessivo.
  4. Verifique as culturas líquidas para turbidez (aproximadamente OD 600 de 0,6-0,8). Coloque os tubos turvos a 4 ° C e permita que outros tubos se tornem turvos crescendo por mais tempo.
    NOTA: Não produza bactérias para OD 600 valores maiores que o recomendado, pois podem ocorrer eventos de instabilidade plasmídica.
  5. Extrair DNA de plasmídeo de bactérias com um kit de miniprep de plasmídeo comercial (ver Tabela de Materiais). Eluir em 15 μL de tampão de eluição pré-aquecido (até 70 ° C em um bloco de aquecimento). Permitir que o tampão de eluição incuba na coluna durante 5 minutos antes da centrifugação.
    NOTA: Preserve pelo menos 1 mL desta cultura inicial a 4 ° C paraMais uma vez na próxima etapa.
  6. Digerir 10 μL dos plasmídeos recuperados para avaliar se os eventos de instabilidade plasmídica ocorreram durante a cultura.
    NOTA: digerir p1 com SalI / NheI e p2 com BamHI / HindIII a 37 ° C durante 1 h. Confirme a presença das bandas corretas após a digestão ( Figura 2a ) por eletroforese em gel e avance para o passo 2. Se estiver preparando DNA de plasmídeo por amplificação do círculo de rolamento (RCA), reserve alguns dos eluentes de miniprep para servir como modelo.

2. Preparação de ADN de plasmídeo suficiente para ligadura

NOTA: A ligação e a subsequente eletroporação requerem uma quantidade suficiente de DNA plasmídico que deve ser gerado através de maxiprep ou RCA. Embora a maxiprep seja a abordagem tradicionalmente utilizada, a RCA oferece a vantagem de não requerer bactérias, eliminando o potencial de toxicidade induzida por plasmídeos em bactérias que podem resultar em eventos de instabilidade.

  1. Para cada plasmídeo que demonstrou o padrão de digestão da enzima de restrição correto na seção anterior, adicione 500 μL de cultura de iniciador a 1 L de carbeno de TB-Carb (25 μg / mL) e agite durante a noite a 30 ° C (aproximadamente 14-16 h , Aproximadamente OD 600 de 0,6-0,8).
    NOTA: Não permita que a cultura cresça sobre este valor OD 600 . Isso irá potencialmente resultar em eventos de instabilidade dentro dos plasmídeos.
  2. Colhe as bactérias e realize maxipreps por protocolo do fabricante (veja Tabela de Materiais).
  • Usando o miniprep salvo da etapa 1.6, execute o seguinte para o procedimento RCA.
    1. Transferir 1 μL de ADN plasmídico para um tubo contendo 50 μL de tampão de amostra.
    2. Desnaturar a amostra a 95 ° C durante 3 minutos e depois incubar a 4 ° C até estar pronto para usar.
    3. Prepare a amplificação comercialPré -mistura (ver tabela de materiais ). Combine 50 μL de tampão de reação com 2 μL de mistura enzimática em um conjunto de tubos em gelo.
      NOTA: A pré-amplificação deve ser mantida em gelo até estar pronta para uso. É conveniente preparar uma mistura principal combinando reagentes suficientes para o número necessário de reações de amplificação. Qualquer pré-mistura não utilizada deve ser descartada.
    4. Transferir 50 μL de pré-mistura de amplificação preparada para a amostra desnaturada.
    5. Incubar os tubos de reação a 30 ° C durante 18 h.
    6. Incubar os tubos a 65 ° C durante 10 min para inativar a polimerase de DNA ø29.
    7. Armazene os tubos de reação a 4 ° C ou -20 ° C até estar pronto para uso.
      NOTA: Neste ponto, o DNA de plasmídeo preparado através de ambos os métodos deve ser quantificado (usando absorvância a 260 nm) e o genoma de ZIKV deve ser Sanger sequenciado inteiramente para confirmar que não ocorreram eventos de instabilidade (deleções e rearranjos) durante a preparação.
  • Nome do Primer Sequência (5 '- 3')
    ZIKV PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV Conserved 632For. GCCCTATGCTGGATGAGG
    ZIKV Conserved 692Rev. GGTTCCGTACACAACcCAAGTTG
    ZIKV Conserved 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV Conserved 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV Conserved 1663For. GCAGACACCGGAACTCCACACT
    ZIKV Conserved 2008For. CAGATGGCGGTGGACATGC
    ZIKV Conserved 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV Conserved 2605For. TACAAGTACCATCCTGACTCCC
    ZIKV Conserved 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV Conserved 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV Conserved 4132For. CATTTGTCATGGCCCTGG
    ZIKV Conserved 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV Conserved 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV Conserved 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV Conserved 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV Conserved 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV Conserved 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV Conserved 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV Conserved 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV Conserved 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV Conservado 7343Para. GTTGTGGATGGAATAGTGGT
    ZIKV Conserved 8243For. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV conservou 9133Para. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV Conserved 9686For. GATGATAGGTTTGCACATGCC
    ZIKV Conserved 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV Conserved 10455For. CAGGAGAAGCTGGGAAACC
    ZIKV Conserved 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tabela 1: Primers para sequenciação de clones de cDNA. Os plasmídeos podem ser sequenciados inteiramente com os primers listados. Primers marcados como "conservados" indiCate que provavelmente são capazes de seqüenciar / amplificar todos os genótipos de ZIKV. Os primers rotulados como "PRVABC59" são específicos desta cepa, mas também podem funcionar para outras estirpes de genótipos asiáticos e possivelmente outros genótipos.

    3. Preparação de ARN transcrito in vitro

    1. Configure a reação de digestão de DNA maxiprep ou RCA preparado.
      1. Para a digestão com p1, misture 10 μL de tampão de reação 10x, 3 μL de ApaLI, 3 μL de BamHI-HF, 3 μL de rSAP ou CIP e 3,3 μg de DNA p1. Adicione ddH 2 O a 100 μL.
      2. Para a digestão com p2, misture 10 μL de 10x de tampão de reação, 3 μL de ApaLI, 3 μL de EcoRI-HF e 13,3 μg de DNA de p2. Adicione ddH 2 O a 100 μL.
      3. Incubar a 37 ° C por 1-2 h.
      4. Purifique usando um gel comercial e um kit de limpeza de PCR (veja a Tabela de Materiais). Eluir em 30 μL de tampão de eluição pré-aquecido a 70 ° C em um bloco de aquecimento (incubar oColuna por 5 min antes de girar).
        NOTA: Mantenha 1 μL para funcionar em um gel mais tarde.
    2. Prepare a reação de ligação.
      1. Combina 10 μL de tampão de reacção de ligação de ADN T4 10x, 3 μL de T4 DNA ligase (400 U / μL), 29 μL de p1 purificado e 29 μL de p2 purificado. Adicione ddH 2 O a 100 μL.
      2. Incubar à temperatura ambiente durante 2 h ou 16 ° C durante a noite.
      3. Purifique usando um gel comercial e um kit de limpeza de PCR (veja a Tabela de Materiais). Eluir em 10 μL de tampão de eluição pré-aquecido a 70 ° C em um bloco de aquecimento (incubar coluna durante 5 minutos antes de girar).
        NOTA: Mantenha 1 μL para funcionar em um gel mais tarde.
    3. Executar plasmídeos não digeridos, plasmídeos digeridos e ligação em um gel de agarose. O produto de ligação deve ter uma banda de peso molecular mais elevado (cerca de 11 kb) do que o plasmídeo digerido isolado, indicando que a ligação foi bem sucedida ( Figura 2b ).
    4. Configure a reação de transcrição in vitro T7.
      1. Combine 10 μL de mistura ARCA / NTP 2x, 2 μL de mistura de ARN polimerase T7 e 8 μL de reação de ligação purificada para um volume final de 20 μL.
        NOTA: O ARCA incluído na mistura é um sensor analógico que é incorporado exclusivamente na orientação correta. Os análogos da capa padrão podem resultar em apenas ~ 50% dos transcritos com uma tampa na orientação correta.
      2. Incubar durante 4 h a 37 ° C.
      3. Medir a concentração de ARN através de um espectrofotômetro UV. Opcionalmente, execute um gel de agarose desnaturante para confirmar o comprimento da transcrição de RNA.

    4. Resgate de vírus infeccioso por eletroporação

    1. Dias antes da eletroporação, preparar 1 balão T182 de células Vero (entre T150 e T182 é aceitável, cultivado em DMEM + 10% de soro fetal bovino (FBS)) por construção a ser recuperada. Inclua 1 T182 como um controle de transfecção simulada. CeLls devem ser utilizados em uma confluência de 70-80%.
    2. Quando as células estão prontas, coloque 12 mL / reação de DMEM + 15% de FBS + 10 mM de HEPES em um banho de água aquecido a 37 ° C.
    3. Descarte as células por tripsinização com um protocolo padrão e recupera as células na mídia com FBS a 10% para inativar a tripsina; Centrifugação de células a 150 xg durante 5 min a 4 ° C.
    4. Lavar células em 1x solução salina tamponada com fosfato (PBS), células de sedimentação a 150 xg durante 5 min a 4 ° C. Repita este passo duas vezes para um total de três lavagens.
    5. Ressuspender células em 200 μL de RPMI 1640 + HEPES 10 mM (estéril) por número de amostras. Transfira 200 μL de suspensão celular para um tubo estéril. As células devem ser ~ 0,5 x 10 7 células / mL.
    6. Adicionar 20 μL de água (mock neg control) ou 20 μL de RNA (de preferência 5-10 μg) produzido no passo 3.4 para cada conjunto de células. Misture suavemente puxando o tubo e transfira o conteúdo do tubo para uma cubeta de eletroporação de intervalo de 2 mm.
    7. Defina um elétronOporador para 170 V LV, omega (resistência) a 0 e 950 μF (aproximadamente a 625 V / cm e 20 ms constante para outras máquinas). Configure a resistência à configuração mais baixa disponível, seja 0 ou ∞ se disponível.
    8. Pulso uma vez e imediatamente adicionar 600 μL de DMEM + 15% FBS + 10 mM HEPES que foi aquecido no passo 4.2. Enxágue dentro da cuvete cuidadosamente para remover todas as células. Adicionar células a um balão de cultura de tecido T75 contendo 10 mL de meio pré aquecido. Remova a mídia adicional da cuvete usando o conta-gotas que acompanha a cuvete. Tenha cuidado para manter a esterilidade.
    9. Balão de redemoinho para misturar meios e células e colocar em uma incubadora de 37 ° C.
    10. Verifique no dia seguinte a viabilidade celular e faça-o todos os dias até 50-75% de morte celular. A morte celular é observada comparando-se ao mock controle eletroporado.
      NOTA: O efeito citopático ZIKV (CPE) é bastante pronunciado nas células Vero, resultando em células arredondadas que se destacam e flutuam no meio de cultura. Nós temosObservou uma faixa de 8-10 dias como ideal para a colheita.
    11. Coloque o sobrenadante em um tubo cônico e centrifugue para remover detritos celulares a> 3,000 xg durante 10 min a 4 ° C.
    12. Remova o sobrenadante esclarecido para um novo tubo e adicione-o com uma concentração final de FBS a 20% (de 100% de estoque). Adicionalmente, adicione HEPES estéril a uma concentração final de 10 mM como agente tampão para preservar a infecciosidade do vírus enquanto está congelado (a partir de um estoque esterilizado de 1 M).
    13. Misture o vírus por vórtice e alíquota em frascos de tampa roscada. Armazene a -80 ° C para uso futuro.

    5. Titulação do vírus recuperado

    1. Seed o número apropriado de placas de 6 ou 12 poços de células Vero no dia anterior à titulação.
    2. Remova o vírus do congelador e faça diluições em série de 10 vezes em DMEM + 2% de FBS em tubos ou placas de 96 poços.
      NOTA: O título esperado dos clones recuperados é entre 1 x 10 6 e 5 x 10 7 PFU / mL.
    3. Adicione 200 oR 400 μL de cada diluição em duplicado para um poço de uma placa de 12 ou 6 poços, respectivamente.
    4. Coloque as placas em uma incubadora a 37 ° C e roote a cada 15 minutos, para um período total de ~ 1-1,5 h de adsorção.
    5. Remova o inóculo viral e adicione 1 mL de (12 poços) ou 2 mL (6 poços) de aderência DMGM-Tragacanto a cada poço.
      NOTA: É possível usar agarose, ágar, metilcelulose ou outro meio de sobreposição aqui.
    6. Incubar células em incubadora a 37 ° C durante 5 dias. O tempo para a formação adequada da placa irá variar dependendo da sobreposição utilizada.
    7. Para consertar células, remova as placas da incubadora e decanta a sobreposição suavemente em desinfetante.
    8. Adicione suficiente 20% de etanol / 0,1% de violeta de cristal (CV) a cada poço para cobrir e girar para misturar.
      NOTA: Muitos outros fixadores existem e podem ser usados ​​aqui. Além disso, se estiver usando uma sobreposição de agarose ou ágar, uma segunda sobreposição pode ser usada em conjunto com vermelho neutro para visualizar placas sem fixação. 20% de etanol mostrou-se serEficaz na inativação de vírus envolvidos em estudos anteriores; Não use esse valor para vírus não envolvidos, pois não serão inativados 19 .
    9. Incube as placas durante 30-60 minutos à temperatura ambiente (num gabinete de biossegurança de classe II); Descarte CV (por regulação local) e lave as placas com água da torneira.
    10. Deixe as placas secar e contamine as placas manualmente.
      NOTA: Referência 20 pode ser usado como uma referência adicional para realizar ensaios de placa.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    O protocolo aqui descrito permite a recuperação do vírus Zika infeccioso derivado de clones. Manipular o sistema de clones infecciosos de dois plasmídeos é direto quando realizado com cuidado, em comparação com versões completas que são altamente instáveis ​​(dados não mostrados). Após a digestão e a ligação das duas peças distintas, o ARN tampado é produzido usando transcrição in vitro com polimerase T7 que é então eletroporada em células Vero ( Figura 1 ). A sequência de plasmídeos correta pode ser monitorada usando digestão de restrição como um proxy após miniprep ( Figura 2a ) e via seqüenciamento de Sanger após produção de DNA em grande escala com RCA ou maxiprep. Após a confirmação dos clones por seqüenciamento, a recuperação do vírus infeccioso requer apenas digestão, ligadura, transcrição in vitro e, finalmente, eletroporação. Essas etapas podem ser realizadas em um dia. Digestão corretaA ligação e a ligação podem ser monitorizadas por eletroforese em gel de agarose ( Figura 2b ), permitindo a resolução de problemas, se necessário.

    Conforme mostrado na Figura 3 , o vírus derivado de clones infecciosos se replica a níveis semelhantes como o isolado parental in vitro em várias linhas celulares, sugerindo que o vírus recuperado do cDNA se replica de forma semelhante ao isolado primário. Além disso, não foram observadas diferenças significativas entre o vírus derivado do clone infeccioso e o isolado parental nas taxas de sobrevivência em camundongos ou taxas de infecção, disseminação e transmissão em mosquitos Aedes aegypti ( Figura 4 ).

    figura 1
    Figura 1: Fluxo de trabalho do resgate ZIKV a partir de um clone de cDNA de dois plasmídeos.O genoma da estirpe ZIKV PRVABC59 foi clonado em duas peças separadas em um esqueleto de plasmídeo pACYC177. Os dois plasmídeos foram então digeridos e ligados com T4 DNA ligase. O RNA infeccioso-tampado foi então produzido através de transcrição in vitro seguida de eletroporação em células Vero. (Figura adaptada da referência 21 ). Clique aqui para ver uma versão maior desta figura.

    Figura 2
    Figura 2: eletroforese em gel para monitorar a digestão e a ligação do clone de cDNA. ( A ) Digestão de restrição inicial de plasmídeos derivados de miniprep para avaliar a estabilidade genética. ( B ) Exemplos de produtos de digestão e ligadura durante a recuperação de vírus infecciosos a partir do sistema de clones de dois plasmídeos. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Clique aqui para ver uma versão maior dessa figura.

    Figura 3
    Figura 3: Cinética de crescimento in vitro do vírus derivado de clones. A cinética de crescimento de PRVABC59 de tipo selvagem e o vírus derivado de clone infeccioso em linhas de células humanas (SH-SY5Y, Jar e NTERA2 cI.D1), mosquito (C6 / 36, Aag2) e primatas não-humanas (Vero) foram avaliados por ensaio de placa. N = 3 As barras de erro representam o desvio padrão da média. (Figura adaptada da referência 21 ). Clique aqui para ver uma versão maior desta figura.

    55857fig4.jpg "/>
    Figura 4: Caracterização in vivo do vírus derivado de clones em camundongos e mosquitos. ( A ) ratazanas de 4 semanas de idade, interferão alfa, beta e gama de receptores gama, AG129, ratos inoculados intraperitonealmente com 1.000 PFU de PRVABC59 ou vírus infeccioso derivado de clones e monitorizados ao longo do tempo para sobrevivência (n = 11). Os mosquitos Aedes aegypti receberam uma farinha infecciosa contendo ZIKV e dissecaram 14 dias depois. ( B ) Os ensaios de placas foram utilizados para avaliar os corpos de mosquitos (infecção), pernas (disseminação) ou secreções salivares (transmissão) para vírus infecciosos. As taxas são apresentadas como a porcentagem dos mosquitos totais testados (Figura adaptada da referência 21 ). Clique aqui para ver uma versão maior desta figura.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Os autores não têm nada a revelar.

    Acknowledgments

    Os autores agradecem a Kristen Bullard-Feibelman, Milena Veselinovic e Claudia Rückert por sua assistência na caracterização do vírus derivado de clones. Este trabalho foi apoiado em parte por doações do Instituto Nacional de Alergia e Doenças Infecciosas, NIH sob subsídios AI114675 (BJG) e AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics