Salvataggio e caratterizzazione del virus ricombinante da un nuovo mondo Clone infettivo del virus Zika

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Questo protocollo descrive il recupero del virus infettivo da Zika da un clone infetto cDNA a due plasmide.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

I cloni infetti cDNA consentono la manipolazione genetica di un virus, facilitando così il lavoro sui vaccini, la patogenesi, la replicazione, la trasmissione e l'evoluzione virale. Qui descriviamo la costruzione di un clone infettivo per il virus Zika (ZIKV), che attualmente sta causando uno scoppio esplosivo nelle Americhe. Per evitare la tossicità per i batteri che è comunemente osservato con i plasmidi derivati ​​da flavivirus, abbiamo generato un sistema a due plasmidi che separa il genoma al gene NS1 ed è più stabile di quelli a piena lunghezza che non possono essere recuperati con successo senza mutazioni. Dopo la digestione e la legatura per unire i due frammenti, l'RNA virale a piena lunghezza può essere generato mediante trascrizione in vitro con T7 RNA polimerasi. Dopo l'elettroporazione di RNA trascritto nelle cellule, è stato recuperato il virus che ha mostrato simili cinetica di crescita in vitro e fenotipi di virulenza e infezione in vivo nei topi e nelle zanzare rispettivamente.

Introduction

Il virus Zika (ZIKV; Family Flaviviridae : Genus Flavivirus ) è un flavivirus dalle zanzare che è arrivato in Brasile nel 2013-14 ed è stato successivamente associato ad un massiccio focolaio di malattia febbrile che si è diffuso in tutte le Americhe 1 . Inoltre, ZIKV è stato collegato a gravi conseguenze della malattia, come la sindrome di Guillain-Barré negli adulti e la microcefalia nei feti e nei neonati 2 . Poco noto su ZIKV prima della sua diffusione rapida nell'emisfero occidentale. Ciò comprendeva la mancanza di strumenti molecolari, ostacolando così la ricerca meccanicistica. Gli strumenti molecolari per i virus, come i cloni infetti cDNA, facilitano il vaccino e lo sviluppo terapeutico antivirale e consentono la valutazione dei fattori genetici virali correlati alla patogenesi virale differenziale, alla risposta immunitaria e all'evoluzione virale.

I cloni infettivi di Flavivirus sono noti per essere altamente instabili nei batteri dovuti alla crI promotori prokaryotici yptici presenti nei loro genomi 3 . Sono stati utilizzati diversi approcci per migliorare questo problema; Incluso l'inserimento di ripetizioni tandem a monte delle sequenze virali 4 , la mutazione di sequenze 5 di promoter prokaryotiche presunte, suddividendo il genoma in plasmidi multipli 6 , vettori di numeri a bassa copia (compresi i cromosomi artificiali batterici) 7 , 8 e l'inserimento di introni nel genoma virale 9 . Un sistema a tutta lunghezza senza modifiche è stato descritto per ZIKV; Tuttavia, questo clone sembrava essere attenuato nella coltura cellulare e nei topi 10 . Altri gruppi hanno introdotto gli introni nel genoma ZIKV, consentendo la distruzione di sequenze instabili nei batteri che possono essere splicate in cellule di mammiferi in vitro per la produzione di virus infettivo 11, 12 . Inoltre, un sistema basato su PCR intitolato Infectious-Subgenomic-Amplicons è stato usato con successo per salvare il prototipo MR766 ceppo di ZIKV 13 . L'approccio qui descritto non richiede sequenze straniere, ma disturba il genoma nella regione di elevata instabilità usando plasmidi multipli, precedentemente impiegati con successo con la febbre gialla 6 , i dengue 14 , 15 e i virus del West Nile 16 . Inoltre, l'aggiunta della sequenza ribozima di epatite D alle terminazioni genomiche virali facilita la creazione di un'autentica 3 'estremità senza la necessità di aggiungere un sito di linearizzazione. Inoltre, entrambi i plasmidi sono costruiti in un vettore di numero di copie basse (pACYC177, ~ 15 copie per cellula) per mitigare ogni tossicità residua 17 . Il virus recuperato mostra un profilo di crescita comparabile aVirus parenterale in curve di crescita in vitro in 8 linee cellulari comprendenti una varietà di tipi di cellule derivanti da entrambi i mammiferi e dagli insetti e ha mostrato identici profili patogeni nei topi e nelle infezioni, diffusione e velocità di trasmissione nelle zanzare 18 .

Qui abbiamo un protocollo che descrive come coltivare i plasmidi infetti del clone, generare in vitro l' RNA virale a piena lunghezza (il genoma virale) e recuperare il virus infettivo nella coltura cellulare. In primo luogo, descriviamo la propagazione di plasmidi in batteri o amplificazione senza batteri usando l'amplificazione del cerchio di rotolamento (RCA). Successivamente, mostriamo come i due plasmidi vengono digeriti e successivamente legati insieme per generare virus a piena lunghezza. Infine, descriviamo la produzione di RNA trascritto e la sua successiva elettroporazione in cellule Vero, seguita da una titolazione del virus recuperato ( Figura 1 ). L'approccio descritto è rapido, permettendo perR recupero di scorte di virus infettive in 1-2 settimane.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Trasformazione e recupero dei plasmidi di cloni infettivi

  1. Trasformare entrambi i plasmidi (separatamente) utilizzando un protocollo di trasformazione commerciale ( ad esempio , NEB 5 Minute Transformation Protocol) con alcune modifiche. Entrambi i plasmidi contengono un gene che codifica per la resistenza all'ampicillina, quindi utilizzare ampicillina o carbenicillina per la selezione. La carbenicillina è preferita, in quanto è più stabile.
    1. Rimuovere le celle (vedere tabella dei materiali) da congelatore da -80 ° C e scongelare su ghiaccio per 5-10 min. Brodo Lysogeny (LB) (contenente 10 g / L NaCl e 25 μg / mL carbenicillina, chiamato LB-carb) e il brodo con repressione catabolita (SOC (senza antibiotici) - venuta con le cellule) a 37 ° C.
    2. Aggiungere fra 100 pg-10 ng in 1 μl di plasmide DNA in un tubo contenente 50 μL di cellule competenti; Mescolare delicatamente spostando il tubo.
    3. Incubare i tubi in ghiaccio per 5 min.
    4. Tubazioni a scossa termica a 42 ° C per 30 sIn un bagno d'acqua. Ritorna al ghiaccio per 2 minuti subito dopo lo shock termico.
    5. Pipettare 950 μL di temperatura ambiente SOC in ogni tubo e mescolare pipettando. Distribuire 100 μL di miscela batterica su un piatto di LB-carb e incubare per una notte a 37 ° C (circa 12-14 h).
  2. Rimuovere le piastre da incubatore a 37 ° C dopo 12-14 h di incubazione. Posizionare le piastre in un cassetto scuro a temperatura ambiente per permettere alle colonie di continuare a crescere (circa 8-9 h).
  3. Utilizzando 5 ml di brodo Terrific (TB, contenente 25 μg / mL di carbenicillina, chiamato TB-carb), coltivate 5-10 piccole colonie per ogni plasmide per una notte a 30 ° C in un agitatore batterico (circa 14-16 h).
    NOTA: Le piccole colonie sono un indicatore che il plasmide è intatto; Le colonie con plasmidi contenenti delezioni, riarrangiamenti o mutazioni (qui chiamati eventi di instabilità) crescono più velocemente e quindi saranno più grandi. Pertanto, si dovrebbe cercare di prendere le colonie più piccole sul piatto, in particolare noT selezionando le più grandi colonie presenti. Alcune colonie di medie dimensioni possono anche essere selezionate per completezza. La temperatura inferiore utilizzata riduce la probabilità che le cellule si svilupperanno (OD 600 superiore a 0,6-0,8). Poiché la maggior parte dei ricercatori esegue la crescita durante la notte, consente un maggiore controllo e riduzione delle probabilità di sovraesposizione.
  4. Controllare le colture liquide per la torbidità (circa OD 600 di 0,6-0,8). Posizionare eventuali tubi torbidi a 4 ° C e permettere a altri tubi di diventare torbidi crescendo per più tempo.
    NOTA: Non coltivare i batteri ai valori OD 600 maggiori di quelli raccomandati, in quanto possono verificarsi eventi di instabilità plasmidica.
  5. Estrarre il DNA plasmidico da batteri con un kit di miniprep plasmide commerciale (vedi tabella dei materiali). Eluire in 15 μl di pre-riscaldato (a 70 ° C in un blocco di riscaldamento) tampone di eluizione. Lasciare che il buffer di eluizione si incuba sulla colonna per 5 minuti prima della centrifugazione.
    NOTA: conservare almeno 1 ml di questa coltura di starter a 4 ° C perUlteriore utilizzo nella fase successiva.
  6. Digest 10 μL dei plasmidi recuperati per valutare se gli eventi di instabilità del plasmide si sono verificati durante la coltura.
    NOTA: Digest p1 con SalI / NheI e p2 con BamHI / HindIII a 37 ° C per 1 h. Confermare la presenza delle bande corrette dopo la digestione ( Figura 2a ) mediante elettroforesi a gel e procedere al punto 2. Se si prepara il DNA del plasmide mediante l'amplificazione a cerchio di rotolamento (RCA), riservare un po 'di eluato di miniprep per servire come template.

2. Preparazione di un sufficiente DNA plasmidico per la legatura

NOTA: La legatura e la successiva elettroporazione richiedono una quantità sufficiente di DNA plasmidale che deve essere generato tramite maxiprep o RCA. Mentre il maxiprep è l'approccio tradizionalmente utilizzato, RCA offre il vantaggio di non richiedere batteri, eliminando così il potenziale di tossicità indotta dal plasmide nei batteri che possono causare eventi di instabilità.

  1. Per ciascun plasmide che ha dimostrato il corretto schema di digestione dell'enzima di restrizione nella sezione precedente, aggiungere 500 μl di coltura d'avviamento a 1 L di brodo di TB-Carb (25 μg / mL carbenicillina) e agitare per una notte a 30 ° C (circa 14-16 h , Circa OD 600 di 0,6-0,8).
    NOTA: non consentire alla coltura di crescere oltre questo valore OD 600 . Ciò potenzialmente può determinare eventi di instabilità all'interno dei plasmidi.
  2. Raccogli i batteri e eseguite maxipreps per protocollo del produttore (vedi tabella dei materiali).
  • Utilizzando il miniprep salvato dal punto 1.6, eseguire quanto segue per la procedura RCA.
    1. Trasferire 1 μl di plasmide DNA in un tubo contenente 50 μl di campione di tampone.
    2. Diluire il campione a 95 ° C per 3 minuti e poi incubare a 4 ° C fino a quando non è pronto per l'uso.
    3. Preparare l'amplificazione commercialePremix (vedi tabella dei materiali ). Combinare 50 μl di tampone di reazione con 2 μl di miscela enzimatica in un tubo posto sul ghiaccio.
      NOTA: La premiscela di amplificazione deve essere mantenuta sul ghiaccio fino a quando non sarà pronta per l'uso. È conveniente preparare un mix master combinando reagenti sufficienti per il numero richiesto di reazioni di amplificazione. Ogni premiscela non utilizzata deve essere scartata.
    4. Trasferire 50 μl di preparata preparata di amplificazione al campione denaturato.
    5. Incubare i tubi di reazione a 30 ° C per 18 ore.
    6. Incubare i tubi a 65 ° C per 10 minuti per inattivare la polimerasi ø29 DNA.
    7. Conservare i tubi di reazione a 4 ° C oa -20 ° C fino all'uso pronto.
      NOTA: A questo punto, il plasmide DNA preparato con entrambi i metodi dovrebbe essere quantificato (utilizzando l'assorbanza a 260 nm) e il genoma ZIKV dovrebbe essere Sanger sequenziato interamente per confermare eventi di instabilità (delezioni e riarrangiamenti) durante la preparazione.
  • Nome primario Sequenza (5 '- 3')
    ZIKV PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV Conservato 632For. GCCCTATGCTGGATGAGG
    ZIKV Conservato 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV Conservato 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV Conservato 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV Conservato 1663For. GCAGACACCGGAACTCCACACT
    ZIKV Conservato 2008For. CAGATGGCGGTGGACATGC
    ZIKV conservato 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV Conservato 2605Per. TACAAGTACCATCCTGACTCCC
    ZIKV Conservato 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV Conservato 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV Conservato 4132For. CATTTGTCATGGCCCTGG
    ZIKV Conservato 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV Conservato 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV Conservato 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV Conservato 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV Conservato 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV Conservato 6119Per. GCCTCATAGCCTCGCTCTATCG
    ZIKV Conservato 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV Conservato 6769Per. CCAGCCAGAATTGCATGTGTCC
    ZIKV Conservato 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV Conservato 7343Per. GTTGTGGATGGAATAGTGGT
    ZIKV Conservato 8243Per. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV conservato 9133For. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV Conservato 9686For. GATGATAGGTTTGCACATGCC
    ZIKV Conservato 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV Conservato 10455Per. CAGGAGAAGCTGGGAAACC
    ZIKV Conservato 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tabella 1: Primer per il sequenziamento di cloni cDNA. I plasmidi possono essere sequenziati interamente con i primer elencati. Primeri contrassegnati come indici "conservati"Che sono probabilmente in grado di sequenziare / amplificare tutti i genotipi di ZIKV. I primer contrassegnati come "PRVABC59" sono specifici a questo ceppo ma possono anche funzionare per altri ceppi di genotipo asiatici e forse altri genotipi.

    3. Preparazione di RNA trascritto in vitro

    1. Impostare la reazione di digestione del DNA preparato con maxiprep o RCA.
      1. Per la digestione p1, mescolare 10 μL di tampone di reazione 10x, 3 μL di ApaLI, 3 μL di BamHI-HF, 3 μL di rSAP o CIP e 3,3 μg di DNA p1. Aggiungere ddH 2 O a 100 μL.
      2. Per la digestione p2, mescolare 10 μl di tampone di reazione 10x, 3 μL di ApaLI, 3 μL di EcoRI-HF e 13,3 μg di DNA p2. Aggiungere ddH 2 O a 100 μL.
      3. Incubare a 37 ° C per 1-2 ore.
      4. Purificare con un gel commerciale e un kit di pulizia PCR (vedi tabella dei materiali). Eluire in 30 μl di tampone di eluizione pre-riscaldato a 70 ° C in un blocco di riscaldamento (incubare ilColonna per 5 min prima della rotazione).
        NOTA: tenere 1 μL in esecuzione su un gel in seguito.
    2. Preparare la reazione di legame.
      1. Combinare 10 μl di tampone di reazione di DNA di 10x T4, 3 μL di ligasi del DNA di T4 (400 U / μL), 29 μl di p1 purificato e 29 μl di p2 purificato. Aggiungere ddH 2 O a 100 μL.
      2. Incubare a temperatura ambiente per 2 ore o 16 ° C per una notte.
      3. Purificare con un gel commerciale e un kit di pulizia PCR (vedi tabella dei materiali). Eluire in 10 μl di tampone di eluizione pre-riscaldato a 70 ° C in un blocco di riscaldamento (incubare colonna per 5 minuti prima della filatura).
        NOTA: tenere 1 μL in esecuzione su un gel in seguito.
    3. Eseguire i plasmidi non digeriti, i plasmidi digeriti e la legatura su un gel agarosico. Il prodotto di legatura dovrebbe avere una banda di peso molecolare superiore (circa 11 kb) rispetto a solo il plasmide digerito, indicando che la legatura ha avuto successo ( Figura 2b ).
    4. Impostare T7 in vitro reazione di trascrizione.
      1. Combinare 10 μL di 2x ARCA / NTP Mix, 2 μL di miscela polimerasi T7 RNA e 8 μL di reazione di legatura purificata per un volume finale di 20 μL.
        NOTA: L'ARCA incluso nel mix è un analogo di protezione che è incorporato esclusivamente nell'orientamento corretto. Gli analoghi di protezione standard possono determinare solo il ~ 50% delle trascrizioni con un tappo nell'orientamento corretto.
      2. Incubare per 4 ore a 37 ° C.
      3. Misurare la concentrazione di RNA tramite uno spettrofotometro UV. Facoltativamente, eseguire un gel agarosante denaturante per confermare la lunghezza del trascritto RNA.

    4. Salvataggio del virus infettivo mediante elettroporazione

    1. Giorni prima dell'elettropazione, preparare 1 pallone T182 di cellule Vero (tra T150 e T182 è accettabile, coltivato in DMEM + 10% siero fetale fetale (FBS)) per struttura da recuperare. Includi 1 T182 come un controllo di transforzione falsa. CeDeve essere utilizzato a confluenza del 70-80%.
    2. Quando le cellule sono pronte, posizionare 12 mL / reazione di DMEM + 15% FBS + 10 mM HEPES in un bagno d'acqua riscaldato a 37 ° C.
    3. Staccare le cellule mediante trypsinizzazione con un protocollo standard e recuperare le cellule nel supporto con il 10% di FBS per inattivare la tripsina; Centrifugare le cellule a 150 xg per 5 minuti a 4 ° C.
    4. Le cellule di lavaggio in soluzione salina fosfato-tampone 1x (PBS), celle di pelleto a 150 xg per 5 minuti a 4 ° C. Ripetere due volte questo passaggio per un totale di tre lavaggi.
    5. Resuspendere le cellule in 200 μL di RPMI 1640 + 10 mM HEPES (sterile) per # campioni. Trasferire 200 μL di sospensione cellulare in un tubo sterile. Le cellule devono essere di ~ 0,5 x 10 7 cellule / ml.
    6. Aggiungere 20 μL di acqua (controllare la negazione negativa) o 20 μL di RNA (preferibilmente 5-10 μg) prodotta nel passaggio 3.4 ad ogni set di cellule. Mescolare delicatamente facendo scorrere il tubo e trasferire il contenuto del tubo in una cuvetta di elettroporazione di divario di 2 mm.
    7. Impostare un elettrOporatore a 170 V LV, omega (resistenza) a 0 e 950 μF (circa 625 V / cm e 20 ms di tempo per altre macchine). Impostare la resistenza all'impostazione più bassa disponibile, 0 o ∞ se disponibile.
    8. Impulsi una volta e subito aggiungere 600 μL di DMEM +15% FBS +10 mM HEPES che è stato riscaldato nel passaggio 4.2. Sciacquare bene all'interno della cuvetta per rimuovere tutte le celle. Aggiungere le cellule a un pallone di coltura tissutale T75 contenente 10 ml di supporto pre-riscaldato. Rimuovere i supporti aggiuntivi dalla cuvetta utilizzando il contagocce incluso nella cuvetta. Fare attenzione a mantenere la sterilità.
    9. Tappo di turbolenza per mescolare i supporti e le cellule e collocare in incubatore a 37 ° C.
    10. Controllare il giorno successivo per la vitalità delle cellule e farlo ogni giorno fino a quando il 50-75% della morte cellulare viene osservata. La morte cellulare viene osservata confrontando il controllo di elettroporazione.
      NOTA: L'effetto citopatico ZIKV (CPE) è abbastanza pronunciato nelle cellule Vero, provocando cellule arrotondate che si staccano e galleggiano nel mezzo di coltura. abbiamoHa osservato una gamma di 8-10 giorni come ideale per la raccolta.
    11. Raccogliere il supernatante in un tubo conico e centrifugare per rimuovere i detriti cellulari a> 3.000 xg per 10 minuti a 4 ° C.
    12. Rimuovere il supernatante chiarificato in un nuovo tubo e completare con una concentrazione finale del 20% di FBS (da 100% di azione). Inoltre, aggiungere HEPES sterile ad una concentrazione finale di 10 mM come agente tampone per preservare l'infettività del virus mentre è congelato (da uno stelo sterile di 1 M).
    13. Mescolare il virus mediante vortexing e l'aliquota in flaconcini a vite. Conservare a -80 ° C per un utilizzo futuro.

    5. Titolazione del virus recuperato

    1. Seguire il numero appropriato di piastre da 6 o 12 pozzetti di cellule Vero il giorno prima della titolazione.
    2. Rimuovere il virus dal congelatore e fare serie di diluizioni 10 volte in DMEM + 2% FBS in tubi o piatti a 96 pozzetti.
      NOTA: Il titolo atteso da cloni recuperati è compreso tra 1 x 10 6 e 5 x 10 7 PFU / mL.
    3. Aggiungi 200 oR 400 μL di ciascuna diluizione in duplice copertura a un pozzetto di una piastra da 12 o 6 pozzetti, rispettivamente.
    4. Posizionare le piastre in incubatore a 37 ° C e scendere ogni 15 minuti per un periodo di adsorbimento di ~ 1-1,5 h.
    5. Rimuovere l'inoculo virale e aggiungere 1 ml di overlay di DMEM-Tragacanth a 12 pozzetti o 2 mL (6 pozzetti) ad ogni pozzetto.
      NOTA: è possibile utilizzare agarosio, agar, metilcellulosa o altri supporti di sovrapposizione qui.
    6. Incubare le cellule in incubatore a 37 ° C per 5 giorni. Il tempo per una corretta formazione delle placche varia a seconda della sovrapposizione utilizzata.
    7. Per fissare le celle, rimuovere le piastre dall'incubatore e coprire decantamente in disinfettante.
    8. Aggiungere un sufficiente 20% di etanolo / 0,1% di violetta di cristallo (CV) ad ogni pozzetto per coprire e turbare per mescolare.
      NOTA: Molti altri fissativi esistono e possono essere usati qui. Inoltre, se si utilizza una sovrapposizione di agarosio o di agar, è possibile utilizzare una seconda sovrapposizione in combinazione con il rosso neutro per visualizzare le placche senza fissaggio. L'etanolo del 20% ha dimostrato di essereEfficace nell'inattivazione dei virus avviluppati negli studi precedenti; Non utilizzare questa quantità per i virus non avvolti in quanto non saranno inattivati 19 .
    9. Incubare le piastre per 30-60 minuti a temperatura ambiente (in un armadio di sicurezza di classe II); Scartare CV (secondo le normative locali) e lavare le piastre con acqua di rubinetto.
    10. Lasciare le piastre per asciugare e contare manualmente le placche.
      NOTA: il riferimento 20 può essere utilizzato come riferimento aggiuntivo per eseguire test di placca.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Il protocollo qui descritto consente di recuperare il virus Zika derivato dal clone infettivo. La manipolazione del sistema clone infettiva a due plasmidi è semplice quando viene eseguita con cura, rispetto alle versioni a piena lunghezza che sono altamente instabili (dati non mostrati). Dopo la digestione e la legatura dei due pezzi distinti, il RNA ricoperto viene prodotto usando la trascrizione in vitro con la T7 polimerasi, che viene poi elettroporato in cellule Vero ( Figura 1 ). La corretta sequenza del plasmide può essere monitorata utilizzando la digestione di restrizione come proxy seguendo il miniprep ( Figura 2a ) e attraverso il sequenziamento di Sanger dopo una produzione su larga scala di DNA con RCA o maxiprep. Dopo la conferma dei cloni sequenziando, il recupero del virus infettivo richiede solo la digestione, la legatura, la trascrizione in vitro e, infine, l'elettroporazione. Questi passaggi possono essere eseguiti in un giorno. Corretto digeLa stione e la legatura possono essere monitorate mediante elettroforesi a base di agarosio ( figura 2b ), consentendo la risoluzione dei problemi, se necessario.

    Come mostrato nella Figura 3 , il virus derivato dal clone infetto si replica a livelli simili come l'isolamento parentale in vitro in più linee cellulari, suggerendo che il virus recuperato dal cDNA replica similmente all'isolato primario. Inoltre, non sono state osservate differenze significative tra il virus derivato dal clone e l'isolamento parentale nei tassi di sopravvivenza nei topi o nei tassi di infezione, diffusione e trasmissione nelle zanzare Aedes aegypti ( Figura 4 ).

    Figura 1
    Figura 1: Flusso di lavoro di salvataggio ZIKV da un clone cDNA a due plasmidi.Il genoma del ceppo ZIKV PRVABC59 è stato clonato in pezzi separati da due pezzi in un pacigeno plasmidico pACYC177. I due plasmidi sono stati poi digeriti e ligati con ligasi del DNA di T4. L'RNA infetto da cappello è stato quindi prodotto mediante transcrizione in vitro seguita da elettroporazione in cellule Vero. (Figura adattata dal riferimento 21 ). Clicca qui per visualizzare una versione più grande di questa figura.

    figura 2
    Figura 2: Elettroforesi per monitorare la digestione e la legatura del clone cDNA. ( A ) La digestione iniziale di restrizione dei plasmidi derivati ​​da miniprep per valutare la stabilità genetica. ( B ) Esempi di prodotti di digestione e di legatura durante il recupero del virus infettivo dal sistema di clone a due plasmide. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Clicca qui per visualizzare una versione più grande di questa figura.

    Figura 3
    Figura 3: Cinetica di crescita in vitro del virus derivato dal clone. La cinetica di crescita del tipo selvatico PRVABC59 e del virus derivato del clone infettivo sull'uomo (SH-SY5Y, Jar e NTERA2 cI.D1), la zanzara (C6 / 36, Aag2) e le linee cellulari primarie non umane (Vero) sono state valutate mediante un test di placca. N = 3 Le barre di errore rappresentano la deviazione standard dalla media. (Figura adattata dal riferimento 21 ). Clicca qui per visualizzare una versione più grande di questa figura.

    55857fig4.jpg "/>
    Figura 4: Caratterizzazione in vivo del virus derivato dal clone nei topi e nelle zanzare. ( A ) i topi maschi e femmine di 4 settimane di interferone alfa, beta e gamma, AG129, sono stati inoculati per via intraperitoneale con 1.000 PFU di PRVABC59 o il virus derivato dal clone e monitorati nel tempo per la sopravvivenza (n = 11). Le zanzare Aedes aegypti sono state somministrate una farfalla infettiva contenente ZIKV e sezionata 14 giorni dopo. ( B ) I test di placca sono stati utilizzati per valutare corpi di zanzara (infezione), gambe (disseminazione) o secrezioni salivari (trasmissione) per il virus infettivo. Le tariffe sono presentate come percentuale delle zanzare totali che sono state testate (Figura adattata dal riferimento 21 ). Clicca qui per visualizzare una versione più grande di questa figura.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Gli autori non hanno niente da rivelare.

    Acknowledgments

    Gli autori vorrebbero ringraziare Kristen Bullard-Feibelman, Milena Veselinovic e Claudia Rückert per la loro assistenza nella caratterizzazione del virus derivato dal clone. Questo lavoro è stato sostenuto in parte da sovvenzioni dell'Istituto Nazionale di Allergia e Malattie Infettive, NIH con sovvenzioni AI114675 (BJG) e AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics