En protokoll for flere geneutslag i musen Små intestinale organoider ved hjelp av en CRISPR-concatemer

Bioengineering
 

ERRATUM NOTICE

Summary

Denne protokollen beskriver trinnene for kloning av flere enkle guide-RNAer i en guide RNA-concatemer-vektor, som er spesielt nyttig for å skape multi-gen-knockouts ved hjelp av CRISPR / Cas9-teknologi. Genereringen av dobbelt knockouts i tarmorganoider er vist som en mulig anvendelse av denne metoden.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9-teknologien har kraftig forbedret muligheten og hastigheten til tap av funksjonstudier som er avgjørende for å forstå genfunksjonen. I høyere eukaryoter kan paralogøse gener maske en potensiell fenotype ved å kompensere tapet av et gen, og dermed begrense den informasjonen som kan oppnås fra genetiske studier som stole på enkeltgenutslag. Vi har utviklet en roman, rask kloning metode for guide RNA (gRNA) concatemers for å skape multi-gene knockouts etter en enkelt transfeksjon i mus-tarmorganoider. Vår strategi gjør det mulig for concatemerization av opptil fire individuelle gRNAer i en enkelt vektor ved å utføre en enkelt Golden Gate-shufflingreaksjon med annealed gRNA oligos og en pre-designet retroviral vektor. Dette tillater enten samtidig utkobling av opptil fire forskjellige gener eller økt utkoblingseffektivitet etter målretting av ett gen av flere gRNAer. I denne protokollen viser vi i detaljHvordan klone flere gRNAer effektivt i den retrovirale CRISPR-concatemer-vektoren og hvordan å oppnå høy effektiv elektroporasjon i tarmorganoider. Som et eksempel viser vi at samtidig utkobling av to par gener kodende negative regulatorer av Wnt signalveien (Axin1 / 2 og Rnf43 / Znrf3) gjør intestinale organoider resistente mot tilbaketrekking av viktige vekstfaktorer.

Introduction

Omvendt genetikk tilnærming er en mye brukt metode for å undersøke funksjonen av et gen. Spesielt undersøkelser av tap av funksjon, hvor forstyrrelse av et gen forårsaker fenotypiske forandringer, spiller en nøkkelrolle i å bygge vår forståelse av biologiske prosesser. CRISPR / Cas9-metoden representerer den nyeste fremskriden innen genomteknikkteknologi og har revolusjonert gjeldende praksis for genetikk i celler og organismer. Cas9 er en RNA-styrt endonuklease som binder til en spesifikk DNA-sekvens komplementær til gRNA og genererer en dobbeltstrengspaus (DSB). Denne DSB rekrutterer DNA-reparasjonsmaskineri som, i fravær av en DNA-mal for homolog rekombination, vil re-ligere den kuttede DNA-streng via feilkrenkelig, ikke-homolog sluttendring, noe som dermed kan resultere i innsetting eller deletjon av nukleotid (er) Forårsaker fremdriftsmutasjoner 1 .

Den store brukervennligheten og allsidigheten til CRISPR / Cas9 apprOach har gjort det til et svært attraktivt verktøy for genome-skala knockout skjermer rettet mot unraveling ukjente genfunksjoner 2 , 3 . Ikke desto mindre er enkle genknockout tilnærminger av begrenset bruk hvis flere paraloger med overflødige funksjoner eksisterer. Således kan ablatering av et enkelt gen ikke være nok til å bestemme funksjonen til det genet gitt mulig kompensasjon av paraloger som resulterer i liten eller ingen fenotypisk forandring 4 . Det er derfor viktig å slå ut paraloger parallelt ved å levere flere gRNA-vektorer rettet mot de forskjellige paraloggenene for å overvinne påvirkning av genetisk kompensasjon.

For å utvide bruken av CRISPR / Cas9 til paralogous gen-knockout, har vi nylig utviklet en rask, en-trinns kloningsmetode for å klone opp til fire pre-annealed gRNAs i en enkelt retroviral vektor 5 . Ryggrad, som heter CRISPR-concatemer, er basertPå et MSCV retroviralt plasmid som inneholder repeterende gRNA ekspresjonskassetter. Hver kassett inneholder to omvendte gjenkjennelsessteder av Type IIS-restriksjonsenzymet Bbs I, som kan erstattes irreversibelt med en glødet gRNA-oligo med tilhørende overheng ved bruk av en Golden Gate-shuffling-reaksjon i et enkeltrør 6 . Denne kloningsmetoden består av repeterende sykluser av fordøyelse og ligering som tillater samtidig montering av flere DNA-fragmenter ved å utnytte de forskjellige overhengssekvenser generert av Bbs I. Uniktheten til dette enzymet er for eksempel evnen til å utføre asymmetriske kutt utenfor sin anerkjennelse sekvens; Derfor kan hver kassett ha en annen sekvens med tilpasset overheng flankerende Bbs I kjerneområde og på denne måten kan hver gRNA klones i en spesifikk posisjon og orientering av concatemervektoren.

Som bevis på prinsippet demonstrerte vi bruken av denne strategien iMus intestinale organoider ved å forstyrre samtidig to par av paralog negative regulatorer av Wnt-banen med en runde av elektroporasjon 5 .

I løpet av de siste årene har mange andre grupper utviklet lignende strategier basert på flere gRNA ekspressionsvektorer konstruert ved hjelp av Golden Gate shuffling 7 for å oppnå multi-gen-knockout i forskjellige modell systemer, for eksempel humane cellelinjer 8 , 9 , sebrafisk 10 og Escherichia coli 11 . I deres protokoller klones først gRNAer i individuelle mellomproduktvektorer og samles deretter sammen i ett sluttprodukt. I motsetning til dette er den viktigste fordelen av vår CRISPR-concatemer-strategi enkelheten til et enkelt Bbs I-shuffling, kloningstrinn. I likhet med andre gRNA concatemers, gjør vår metode det mulig enten samtidig utslag på opptil fireForskjellige gener eller økt CRISPR knockout effektivitet etter målretting av ett eller to gener med flere gRNAer ( Figur 1 ).

I denne protokollen beskriver vi i detalj hvert trinn i genereringen av CRISPR-concatemervektorer, fra gRNA-design til Golden Gate-reaksjonen og til bekreftelse på vellykket kloning. Vi gir også en svært effektiv protokoll for transfeksjon av CRISPR-concatemers i mus-tynne organoider ved hjelp av elektroporasjon og påfølgende vekstfaktor tilbaketrekkingsforsøk.

Protocol

1. gRNA Design for CRISPR-concatemer Vector

Merk: Målet med denne delen er å forklare hvordan man velger den beste målstrategien og hvordan man utformer gRNAer som inneholder spesielle overheng for CRISPR-concatemervektoren.

  1. Design gRNAer mot genene av interesse ved hjelp av et CRISPR gRNA-designverktøy av valg. Se Materialetabellen til et eksempel.
    MERK: Når du målretter mot et par paralogøse gener, selv om det er mulig å designe ett gRNA per gen, er det tilrådelig å designe to gRNAer per gen for å øke sjansene for å oppnå en dobbel knockout ( figur 1 ).
  2. Pass på at gRNAene ikke inneholder Bbs I-anerkjennelsessiden ved å bruke et begrensnings kartleggingsverktøy (se Materialetabellen til et eksempel).
  3. Legg til spesifikke CRISPR-concatemer-vektoroverheng til hver oligo, som vist i tabell 1 .
"Fo: keep-together.within-page =" 1 "fo: keep-with-next.within-page =" always "> Kassett 1 Kassett 2 Kassett 3 Kassett 4 Sekvens (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT Sekvens (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] C AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

Tabell 1: Overheng for hver kassett av CRISPR-concatemer Vector.

2. Kloning av gRNAer i CRISPR-concatemer Vector

  1. Fosforylering og glødning av oligos
    MERK: Dette trinnet illustrerer hvordan tO anneal topp og bunn tråder for hver gRNA oligo og hvordan å fosforylere deres ender i en enkelt reaksjon.
    1. Forbered reaksjonsblandingen for fosforylerende oligos og annealing topp- og bunnstrenger på is, per instruksjonene nedenfor.
      MERK: Alle oligoer kan samles i en reaksjon; For eksempel, i tilfelle av en 4 gRNA-concatemer-vektor, samles 8 oligos sammen.
    2. For 3 konkatater bruker 3,0 μL gRNA toppstreng (1,0 μL fra hver gRNA, 10 μM, 1 μL / gRNA), 3,0 μL gRNA bunnstreng (1,0 μL fra hver gRNA; 10 μM, 1 μl / gRNA), 2,0 μl T4 DNA-ligasebuffer (10x), 1,0 ul T4-PNK, og tilsett H 2 O opp til totalt volum av 20,0 ul.
    3. Bland godt ved pipettering og kjør dette i en termocykler ved hjelp av følgende innstillinger: 37 ° C i 30 minutter, 95 ° C i 5 minutter, rampe ned til 25 ° C ved 0.3 ° C / min, hold ved 4 ° C.
  2. Bbs jeg shuffling reaksjon
    MERK: I denne delen inkorporeres de pre-annealed gRNA oligos i riktig posisjon av concatemer vektoren i ett trinn ved alternerende sykluser av fordøyelse og ligering.
    1. Fortynn reaksjonsblandingen 1: 100 i DNase / RNase-fri vann for å generere 3 og 4 gRNA-konkatemervektorer.
      MERK: Ved kloning av 2 gRNA-concatemers er dette trinnet ikke nødvendig.
    2. Monter Bbs I shuffling reaksjon på is, per instruksjonene nedenfor. Inkluder en negativ kontroll som bare inneholder vektoren.
    3. Bruk 100 ng CRISPR-konkatemervektor, 10,0 μl oligo-blanding, 1,0 μl BSA-holdig restriksjonsenzymbuffer (10x), 1,0 μl DTT (10 mM), 1,0 μl ATP (10 mM), 1,0 μl Bbs I, 1,0 μl T7-ligase og H2O opptil totalvolum på 20,0 ul.
    4. Bland godt ved pipettering og kjør dette i en termocykler ved hjelp av følgende innstillinger: Kjør 50 sykluser for kloning av 3 og 4 gRNA-concatemers og hold ved 37 ° C i 15 minutter og deretter 4 ° C for alltid.
  3. Exonukleasebehandling
    MERK: Dette trinnet anbefales sterkt da det øker effektiviteten av kloningen ved å fjerne spor av lineært DNA.
    1. Behandle Bbs I shuffling-reaksjonen med en DNA-exonuklease (se tabell over materialer ) som følger.
    2. Ta 11,0 μl ligasjonsblanding fra det forrige trinnet (2.2.3), tilsett 1,5 μL exonukleasebuffer (10x), 1,5 μL ATP (10 mM), 1,0 μL DNA exonuklease, og oppsamler totalt volum til 15,0 μL med vann. Inkuber ved 37 ° C i 30 minutter etterfulgt av 70 ° C i 30 minutter.
      MERK: Dette trinnet fjerner alt gjenværende lineært DNA i blandingen og øker dermed kloningseffektiviteten.
    3. Bruk 2 μl av reaksjonsblandingen for transformasjon til kjemisk kompeTelt E. coli- bakterier ved varmestokk 12 .
      MERK: Alternativt kan reaksjonen lagres i opptil en uke ved -20 ° C.
  4. Restriksjon fordøyelse
    MERK: Målet med dette trinnet er å vurdere ved begrensningsfordøyelse suksessen til kloningsprosedyren.
    1. For å bekrefte tilstedeværelsen av gRNA-innsatser i CRISPR-concatemer-vektoren, velg 4-8 bakteriekolonier med en inokuleringssløyfe, vokse hver klon i 4 ml LB-medium natten over ved 37 ° C i en orbital rystelse. Ekstra DNA med et plasmid miniprep-sett i henhold til produsentens instruksjoner (se Materialebordet ).
    2. Fordel ~ 200 ng DNA med 10 U EcoR I + 5 U Bgl II i en 10 μl reaksjon ved inkubering ved 37 ° C i 3 timer i en bakterieinkubator. Inkluder en egen reaksjonsblanding med den tilsvarende opprinnelige vektoren som en positiv kontroll for størrelsesjämförelse.
      MERK: ThiS vil bekrefte om alle concatemers er tilstede, da disse to restriksjonsenzymer vil aksessere hele konsatatører. Disse er forventede størrelser for hver concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1,2 kbp) og 4 gRNA-concatemer (1,6 kbp).
    3. Kjør fordøyelsesreaksjoner på en 1% agarosegel ved 90 V i ca. 20 min.
    4. Visualiser gelen ved hjelp av en UV-transilluminator. Identifiser klonene med riktig innsatsstørrelse ved å sikre at deres båndmønster samsvarer med den av den opprinnelige vektoren, og at hvert fragment har den forventede størrelsen ved å bruke en DNA-stige.
    5. Fordel de valgte klonene med 5 U Bbs I ved 37 ° C i 3 timer i en bakterieinkubator. Ta med en egen reaksjonsblanding med den tilsvarende originale vektoren som en kontroll.
      MERK: Dette ekstra fordøyelsestrinnet er å bekrefte at gRNAer har blitt klonet i riktig posisjon og følgelig har alle Bbs I-anerkjennelsessteder gått tapt.
    6. Kjør fordøyelsesreaksjoner påEn 1% agarosegel ved 90 V i ca. 20 min. Betrakt som korrekte bare vektorer som ikke kuttes av Bbs I, da de bare inneholder gRNAer.
  5. Vector sekvensering
    MERK: Målet med dette trinnet er å bekrefte tilstedeværelsen av gRNA-sekvenser i de vektorer som er identifisert som korrekte ved restriktionsfordøyelsesanalyse.
    1. Bekreft positive concatemervektorer ved Sanger-sekvensering 13 ved å bruke følgende primere:
      Fremover: TCAAGCCCTTTGTACACCCTAAG (for å sjekke den første gRNA-kassetten)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (for å sjekke den andre gRNA-kassetten)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (for å sjekke den andre gRNA-kassetten)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (for å sjekke den tredje gRNA-kassetten)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (for å sjekke den tredje gRNA-kassetten)
      Omvendt: AGGTGGCGCGAAGGGGCCACCAAAG (for å sjekke det siste gRNAkassett)
    2. Kontroller tilstedeværelsen av alle gRNA ved å søke i sekvensene i sekvenseringslesningen.

3. Transfeksjon av tarmorganoider ved elektroporasjon

MERK: Vær oppmerksom på at denne prosedyren er basert på protokollen utgitt av Fujii et al . I 2015, med tilpasning for mus-tarmorganiske kulturer 14 .

  1. Pre-electroporation
    MERK: Denne delen beskriver hvordan du klargjør muskelintestinale organoider før elektroporasjon ved å fjerne alle antibiotika og betingede medier fra sitt kulturmedium. Dette vil forhindre mulige toksiske effekter ved elektroporering.
    1. På dag 0 i transfeksjonsprosedyren, delte organoider i et 1: 2-forhold.
      MERK: Intestinale organoidkulturer kan oppnås ved å utføre kryptisolering i henhold til tidligere fastsatte protokoller 15 . Vennligst se
    2. Ved splitting av organoider for elektroporasjon, frø minst 6 brønner av en 48 brønn plate per transfeksjon.
    3. Seed de organoids i 20 ul-kjeller matrise dråper og dyrke dem i WENR- + Nic medium (Wnt + EGF + Noggin + R-spondin + nikotinamid) ved 37 ° C, 5% CO2 i en fuktig inkubator (som tidligere beskrevet 15) .
  2. På dag 2, bytt medium ved å erstatte WENR + Nic med 250 μL EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3 inhibitor) + Y-27632 (ROCK inhibitor) uten antibiotika (se tabell 2 ).
    MERK: I alle trinnene er mengden medium tilsatt til hver brønn på en 48-brønnplate 250 μL.
  3. På dag 3, bytt organoidmediet til EN + CHIR99021 + Y-27632 + 1,25% v / v Dimetylsulfoksid (DMSO), uten antibiotika.
  • Fremstilling av cellene
    MERK:Her beskriver vi hvordan man fragmenterer organoider i småcellede klynger ved mekanisk og kjemisk dissosiasjon. Disse trinnene er viktige for prosessens suksess.
    1. På dag 4, forstyrr kjellermatriksdomenene ved hjelp av en pipettespiss på 1 ml og overfør organoider til et 1,5 ml rør. Bassenginnhold av fire brønner på en 48-brønn plate i et rør.
    2. Mekanisk bryte organoider i små fragmenter ved pipettering opp og ned med en P200 pipette omtrent 200 ganger. Sentrifuger ved romtemperatur, 5 min ved 600 x g.
    3. Fjern mediet og resuspender pelleten i 1 ml av en rekombinant protease av cellekultur, se tabell over materialer. Inkuber ved 37 ° C i maksimalt 5 minutter og kontroller deretter en 50 μl dråpe prøve under et invertert lysmikroskop med 4x objektiv.
      MERK: Klynger på 10-15 celler er ønskelige, da dette øker celleoverlevelsen etter elektroporasjon.
    4. Overfør cellesuspensjonen til et lavbindende 15 ml rør og stansetDissosiasjon ved å tilsette 9 ml basalt medium uten antibiotika (se tabell 2 ). Sentrifuger ved romtemperatur, 5 minutter ved 600 xg, kast deretter supernatanten og resuspender pelleten i 1 ml redusert serummedium (se tabell over materialer ).
    5. Telle antall celler med et Bürker kammer og bruk minst 1 x 10 5 celler per elektroporasjonsreaksjon. Tilsett 9 ml redusert serummedium til 15 ml rør og sentrifuger ved romtemperatur, 3 min ved 400 x g.
  • electroporation
    MERK: I de følgende avsnittene finner du instruksjoner om hvordan du skal utføre elektroporasjon og å få organoider til å gjenopprette etterpå.
    1. Fjern all supernatanten og resuspender pelleten i en elektroporasjonsløsning (se tabell over materialer ). Tilsett en total mengde 10 μg DNA til cellesuspensjonen og tilsett elektroporasjonsløsning til et sluttvolum på 100 μl og hold celle-DNEn blanding på is. Bruk CRISPR-concatamervektorer i kombinasjon med et Cas9 ekspresjon plasmid ( f.eks. Addgen # 41815) i et 1: 1 forhold.
      MERK: Det totale volumet av det tilsatte DNA bør være mindre enn eller lik 10% av det totale reaksjonsvolumet.
    2. Inkluder en separat transfeksjonsmiks som inneholder et GFP-plasmid for å evaluere transfeksjonseffektivitet ( f.eks. PCMV-GFP, Addgen # 11153 eller et hvilket som helst generisk GFP-ekspressende plasmid).
    3. Legg celle-DNA-blandingen til elektroporasjonskuvetten og plasser den i elektroporatorkammeret. Mål impedansen ved å trykke på riktig knapp på elektroporatoren og sørg for at den er 0,030-0,055 Ω. Utfør elektroporering i henhold til innstillingene vist i tabell 3 .
      MERK: Hvis impedansverdien faller utenfor det tillatte området, må du justere løsningsvolumet i kyvetten.
    4. Tilsett 400 μL elektroporasjonsbuffer + Y-27632 til kuvetten og overfør deretter alt til en 1,5 ml rør. IncubaTe ved romtemperatur i 30 minutter for å tillate cellene å gjenvinne og deretter spinne dem ved romtemperatur i 3 minutter ved 400 x g.
    5. Fjern supernatanten og resuspender pelleten i 20 μl / brønn i kjellermatrisen. Sæd ca. 1 x 10 4 til 1 x 10 5 celler per brønn i en 48-brønn plate og legg til EN + CHIR99021 + Y-27632 + 1,25% v / v DMSO-medium. Inkuber ved 37 ° C.
    6. På dag 5, bytt mediet til EN + CHIR99021 + Y-27632, og kontroller transfeksjonseffektiviteten ved å observere GFP-uttrykk ( Figur 2 ). Hold organoider ved 37 ° C og oppfrisk EN + CHIR99021 + Y-27632 medium etter 2 dager.
    7. På dag 9, bytt mediet til WENR + Nic + Y-27632 og inkuber ved 37 ° C.
      MERK: Y-27632 kan fjernes etter 7-10 dager (på dag 16-19).
  • Poring puls Overfør puls
    Spenning 175V 20V
    Pulslengde 5 msek 50msec
    Pulseintervall 50msec 50msec
    Antall pulser 2 5
    Decay rate 10% 40%
    polaritet + +/-

    Tabell 3: Elektroporasjonsinnstillinger.

    4. Tilbaketrekking av vekstfaktor

    Merk: Her er det eksemplifisert hvordan man utfører et vekstfaktoruttrekkingsforsøk når man slår ut negative regulatorer av Wnt-banen i tarmorganoider.

    1. 10-14 dager avteR elektroporasjon, del organoidsene i et forhold på 1: 3 i en 48-brønn plate etter de ovennevnte trinnene (3.2.1 - 3.2.2).
    2. Resuspender organoidpelleten i 20 μl kjellermembranmatriks og la den størkne ved 37 ° C i 10 minutter. Deretter legger du over 250 μL vekstfaktorberøvet medium ( f.eks. EN) for å teste om knockout av målgenene er oppnådd 5 .
    3. Del organoidene under vekstfaktor-berøvede forhold for minst 2 - 3 passasjer for å se forskjell i overlevelse mellom wild type (WT) kontrollorganoider og mutantorganoider 5 , 15 .
      MERK: Wildtype-organoider bør ikke kunne overleve i vekstfaktorrelatert medium over to passasjer, mens mutantlinjer skal kunne vokse.

    Representative Results

    For å bekrefte tilstedeværelsen av det riktige antall gRNA-innlegg i concatemervektoren, utføres restriksjonsfordøyelse med enzymer ( EcoR I + Bgl II) som flankerer alle gRNA-uttrykkende kassetter (hver kassettstørrelse er ~ 400 bp, figur 1 ). Når man for eksempel genererer en 4 gRNA-concatemer-vektor, er den forventede størrelsen av det nedre båndet i agarosegelen ca. 1,6 Kbp; Et hvilket som helst bånd lavere enn dette indikerer at ikke alle 4 gRNA-kassetter settes inn i vektoren ( figur 2A ). I tillegg er det alltid anbefalt å kontrollere at alle Bbs I-anerkjennelsessteder går tapt og enzymet ikke kutter vektoren ( figur 2B ).

    Når konstruksjonene er bekreftet, kan de leveres til mus-tarmorganoider ved elektroporering for å oppnå optimaL-nivåer av transfeksjonseffektivitet (opptil 70%), som vist ved GFP-kontrollen ( Figur 3 ).

    Til slutt, for å funksjonelt teste effektiviteten av denne strategien ble intestinale organoider transfektert med Cas9 og concatemervektorer mot Axin1 / 2 og Rnf43 / Znrf3 dyrket i EN (R-spondin-tilbaketrekking) og EN + IWP2 (R-spondin og Wnt-tilbaketrekning, IWP2 : Porcupine inhibitor, 2,5 μM) media for minst 3 passasjer ( Figur 4 ). Mens utransfekterte WT-organoider døde under begge forhold, overlevde Axin1 / 2 knockout-organoider i begge på grunn av nedstrøms aktivering av Wnt-banen, I tillegg overlever Rnf43 / Znrf3 mutantorganoider i fravær av R-spondin, men kan ikke overleve i nærvær av IWP2, noe som fører til utmattelse av Wnt som aktiverer banen. Samlet sett demonstrerer disse observasjonene at knockout av disse paraloggenparene er mulig ved å generere tHan forventet organoid fenotype. Detaljer om disse resultatene er publisert i utviklingsbiologi 5 .

    Figur 1
    Figur 1: Skjematisk representasjon av CRISPR-concatemer med 4 kassetter. Skjema for 4 gRNA-concatemer-vektoren med hver 400 bp-kassett inneholdende en U6-promotor, to inverterte gjentatte Bbs I-steder (også angitt som BB) og gRNA-stillas i denne rekkefølge. Under den blandede reaksjonen blir Bbs I-steder erstattet av gRNA-fragmenter med tilhørende overheng og dermed tapte. Bindingssteder av sekvenseringsprimere for å sjekke korrekt innsetting av gRNA-oligos er vist ved de blå piler. Fwd = forward primer, Rev = revers primer, Link 1/2/3 = linker regioner 1/2/3. Vennligst cSlikk for å se en større versjon av denne figuren.

    Figur 2
    Figur 2: Representative fordøyelsesmønstre av Concatemer Vectors. ( A ) Dobbel fordøyelse av 3 og 4 gRNA-concatemervektorer med EcoR I og Bgl II. Det riktige fordøyelsesmønsteret er markert med en grønn tick, mens vektorer med bare 1 eller 2 gRNA-innskudd er merket med et rødt kryss. Bane 1 viser fordøyelsen av en 4 gRNA-concatemer foreldrevektor brukt som positiv kontroll (merket med "+"); På samme måte viser bane 5 fordøyelsen av en 3 gRNA-concatemer foreldringsvektor, merket med "+". ( B ) Fordøyelse med Bbs I, som viser den riktige størrelsen på ufordøpte concatemervektorer (indikert av de grønne flåttene). Digestion av en gRNA-holdig concatemervektor som har mistet Bbs I-steder, brukes som en positiv kontroll anD er merket med "+". Vennligst klikk her for å se en større versjon av denne figuren.

    Figur 3
    Figur 3: Representativt bilde av vellykket elektroporerte tarmorganoider. Transfeksjon av et GFP-plasmid er avgjørende for å evaluere transfeksjonseffektivitet. Omtrent 24 timer etter elektroporasjon er organoider som inneholder et lite antall celler, allerede synlige, og hvis elektroporasjonsprosedyren var vellykket, viser opptil 70% av dem grønn fluorescens. BF = lyse felt, GFP = grønt fluorescerende protein. Skalbjelke = 2000 μm. Vennligst klikk her for å se en større versjon av denne figuren.


    Figur 4: Representative bilder av mutant tarmorganoider. Knockout av de negative regulatorene til Wnt-banen Axin1 og Rnf43, sammen med deres paralogues, gjør tarmorganoiderne resistente mot vekstfaktorberegning. Spesielt kan Axin1 / 2 knockout-organoider (Axin1 / 2 KO) vokse i fravær av både R-spondin (EN: EGF + Noggin) og Wnt (EN + IWP2: EN + Porcupine-inhibitor), mens Rnf43 / Znrf3 mutantorganoider (R & Z KO) kan bare overleve i fravær av R-spondin (EN). I motsetning kan WT-organoider bare overleve i kontrollkulturtilstanden WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nikotinamid). Skalestenger = 1000 μm. Vennligst klikk her for å se en større versjon av denne figuren.

    Basal medium kommentarer
    Oppbevares ved 4 ° C i 4 uker
    Cellkulturmedium 500 ml Se tabell over materialer
    L-Glutamin 100x 5 ml
    Buffermiddel 1 M 5 ml Se tabell over materialer
    Penicillin Streptomycin 100x 5 ml
    WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nikotinamid)
    Oppbevares ved 4 ° C i 2 uker
    Basal medium Opptil 50 ml
    Neuronalcelle serumfritt supplement (50x) 1 ml Se tabell over materials
    Neuronalcelle serumfritt supplement (100x) 500 μl Se tabell over materialer
    N-acetylcystein (500 mM) 125 ul
    Mus EGF (100 μg / ml) 25 μl
    Mus Noggin (100 μg / ml) 50 μl
    R-Spondin betinget medium 5 ml
    Wnt3a betinget medium 25 ml
    Nikotinamid (1 M) 250 μl
    EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    Oppbevares ved 4 ° C i 2 uker
    Basal medium uten Penicillin Streptomycin Opptil 20 ml
    Neuronalcelle serumfritt supplement (50x) 400 μl Se tabell over materialer
    Neuronalcelle serumfritt supplement (100x) 200 μl Se tabell over materialer
    N-acetylcystein (500 mM) 50 μl
    Mus EGF (100 μg / ml) 10 μl
    Mus Noggin (100 μg / ml) 20 μl
    Y-27632 (10 uM) 20 μl
    CHIR99021 (8 μM) 10 μl
    EN (EGF + Noggin)
    Oppbevares ved 4 ° C i 4 uker
    Basal medium Opptil 50 ml
    Neuronalcelle serumfritt supplement (50x) Se tabell over materialer
    Neuronalcelle serumfritt supplement (100x) 500 μl Se tabell over materialer
    N-acetylcystein (500 mM) 125 ul
    Mus EGF (100 μg / ml) 25 μl
    Mus Noggin (100 μg / ml) 50 μl

    Tabell 2: Organoid Mediasammensetning.

    Discussion

    I denne protokollen detaljerer vi alle trinnene som er nødvendige for å generere CRISPR-concatemers og å anvende CRISPR-concatemers i muskeltarmorganoider for samtidig å slå ut flere gener. Som tidligere nevnt har denne strategien flere fordeler, for eksempel hastighet, høy effektivitet og kostnadseffektivitet.

    For å kunne utføre hele prosedyren, er det noen kritiske aspekter å vurdere. Først er det avgjørende at alle gRNA-oligos er riktig annealed og fosforylert, da de representerer utgangsmaterialet for Bbs I-kloningsreaksjonen som i seg selv er svært effektiv. For det andre, når de elektroporerende organoider, jo flere celler som brukes per tilstand, jo høyere er maksimal mulig transfeksjonseffektivitet. I tillegg er det også viktig at etter celledissociering dominerer småcelleklynger over enkeltceller.

    Likevel er det mulig å støte på teknisk probLemer når man prøver enten kloning eller transfeksjon for første gang; I tilfelle problemer under gRNA kloning, anbefales det å dobbeltsjekke gRNA oligosekvensen og, hvis det er riktig, velge ytterligere bakteriekolonier for restriksjonsfordøyelses screening. Hvis transfeksjonseffektivitet og cellelevedannelse er lav etter elektroporasjon, er det tilrådelig å gjenta protokollen ved å bruke flere celler per tilstand og redusere tiden for celledissociering til 3 minutter.

    Selv om genereringen av CRISPR-concatemers er relativt billig og enkel, er det ikke å utføre større skala genetiske skjermbilder i organoider, da skalaen er begrenset av kostnadene forbundet med organoid kultur og av arbeidsintensiv natur. Det er verdt å nevne at CRISPR-concatemer-metoden også er kompatibel med cellelinjer, for eksempel HEK293 og musembryoniske stamceller.

    Uavhengig av cellesystemet, en annen potensiell ulempe ved denne sTrategy kan oppstå når man sikter mot samtidig utkobling av tre eller fire forskjellige gener. For eksempel vil hver gRNA ha en annen målrettingseffektivitet, og endringene av å treffe alle generene på samme tid kan være relativt lave; Av denne grunn er det tilrådelig å benytte concatemer-systemet til å lede mer enn ett gRNA mot det samme genet.

    Alternative strategier basert på Golden Gate shuffling har blitt foreslått gjennom årene for å generere multiplex gRNA vektorer 7 , 8 . I vår metode er det imidlertid mulig å montere flere gRNAer direkte i en enkelt retroviral vektor i en enkelt kloning, noe som gjør den egnet til å generere gRNA-biblioteker for å målrette paraloger.

    Vår CRISPR-concatemer er bygd i den MSCV retrovirale vektorgraden. Således kan gRNA-concatemer-holdig retrovirus brukes til å generere stabile cellelinjer som overexplodererRess gRNAer. Når det kombineres med et Cas9-inducerbart system, kan man utføre inducerbare paralog-knockouts ved hjelp av vårt system.

    Sammendrag beskriver vi hvordan man klonrer opptil fire forskjellige gRNAer i samme vektor i ett trinn og hvordan man bruker denne strategien til organoidkultur med høy transfeksjonseffektivitet. Videre gir vi nyttige forslag for å maksimere sjansene for suksess gjennom hele prosedyren.

    Disclosures

    Forfatterne har ingenting å avsløre. Forfatterne har ingen interessekonflikt deklarert.

    Acknowledgments

    Vi takker Christopher Hindley for kritisk lesing av manuskriptet. AM støttes av Wntsapp (Marie Curie ITN), AA-R. Støttes av Medical Research Council (MRC), og BK.K. Og RM støttes av en Sir Henry Dale fellesskap fra Wellcome Trust og Royal Society [101241 / Z / 13 / Z] og mottar støtte gjennom et kjernebidrag fra Wellcome Trust og MRC til Wellcome Trust - MRC Cambridge Stem Cell Institute .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics