Formación de gránulos condrogénicos a partir de células madre pluripotentes inducidas derivadas de sangre del cordón umbilical

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Aquí, proponemos un protocolo para la diferenciación condrogénica de células madre pluripotentes inducidas por humanos derivadas de células mononucleares de sangre del cordón umbilical.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El cartílago articular humano carece de la capacidad de repararse. Por lo tanto, la degeneración del cartílago no se trata por tratamientos curativos sino por tratamientos conservadores. Actualmente, se están haciendo esfuerzos para regenerar el cartílago dañado con condrocitos expandidos ex vivo o células madre mesenquimales derivadas de médula ósea (BMSCs). Sin embargo, la viabilidad limitada y la inestabilidad de estas células limitan su aplicación en la reconstrucción del cartílago. Las células madre pluripotentes inducidas por el hombre (hiPSCs) han recibido atención científica como una nueva alternativa para aplicaciones regenerativas. Con ilimitada capacidad de auto-renovación y multipotencia, HiPSCs se han destacado como una nueva fuente de células de reemplazo para la reparación del cartílago. Sin embargo, la obtención de una gran cantidad de gránulos condrogénicos de alta calidad es un reto importante para su aplicación clínica. En este estudio, se utilizó el cuerpo embrioide (EB) derivado de las células de crecimiento para la diferenciación condrogénica. La condrogénesis exitosa fue confirmada por PCR yD con azul alciano, azul de toluidina y anticuerpos contra los tipos de colágeno I y II (COL1A1 y COL2A1, respectivamente). Proporcionamos un método detallado para la diferenciación de células madre mononucleares derivadas de células madre ipSCs (CBMC-hiPSCs) en chondrogenic pellets.

Introduction

El uso de hiPSCs representa una nueva estrategia para la detección de drogas y estudios mecánicos de diversas enfermedades. Desde una perspectiva regenerativa, hiPSCs son también una fuente potencial para la sustitución de los tejidos dañados que tienen capacidad de curación limitada, como el cartílago articular 1 , 2 .

La regeneración del cartílago articular nativo ha sido un reto durante varias décadas. El cartílago articular es un tejido suave y blanco que recubre el extremo de los huesos, protegiéndolos de la fricción. Sin embargo, tiene una capacidad regenerativa limitada cuando está dañada, lo que hace que la auto-reparación sea casi imposible. Por lo tanto, la investigación centrada en la regeneración del cartílago ha estado en curso durante varias décadas.

Anteriormente, la diferenciación in vitro en el linaje condrogénico se realizó generalmente con BMSCs o condrocitos nativos aislados de la articulación de la rodilla [ 3] . Debido tO su potencial condrogénico, las BMSC y los condrocitos nativos tienen numerosos méritos que apoyan su uso en la condrogénesis. Sin embargo, debido a su limitada expansión y fenotipo inestable, estas células enfrentan varias limitaciones en la reconstrucción de los defectos del cartílago articular. Bajo condiciones de cultivo in vitro , estas células tienden a perder sus propias características después de 3-4 pases, lo que finalmente afecta a sus capacidades de diferenciación [ 4] . Además, en el caso de condrocitos nativos, un daño adicional a la articulación de la rodilla es inevitable cuando se obtienen estas células.

A diferencia de BMSCs o condrocitos nativos, hiPSCs puede expandirse indefinidamente in vitro . Con las condiciones de cultivo adecuadas, los hiPSC tienen un gran potencial como fuente de reemplazo para la diferenciación condrogénica. Sin embargo, es un desafío para cambiar las características intrínsecas de hiPSCs [ 5] . Por otra parte, se necesitan varias complicaciones in vitroPs para dirigir el destino de hiPSCs a un tipo de célula específico. A pesar de estas complicaciones, el uso de los hiPSCs sigue siendo recomendable debido a su alta capacidad de auto-renovación y su capacidad para diferenciarse en las células objetivo, incluidos los condrocitos [ 6] .

La diferenciación condrogénica se realiza habitualmente con sistemas de cultivo tridimensionales, tales como el cultivo de pellets o el cultivo de micromasas, utilizando células progenitoras similares a MSC. Si se usan hiPSCs, el protocolo para generar células progenitoras tipo MSC difiere de los protocolos existentes. Algunos grupos utilizan cultura monocapa de hiPSCs para convertir directamente el fenotipo en MSC-como las células [ 7] . Sin embargo, la mayoría de los estudios utilizan EBs para generar células de crecimiento que se asemejan a MSCs 8 , 9 , 10 , 11 .

Se utilizan diversos tipos de factores de crecimiento para inducir el condrogeNesis Normalmente, las proteínas de la familia BMP y TGFβ se usan, solas o en combinación. La diferenciación también se ha inducido con otros factores, tales como GDF5, FGF2, y IGF1 12 , 13 , 14 , 15 . Se ha demostrado que TGFβ1 estimula la condrogénesis de una manera dependiente de la dosis en MSCs 16 . Comparado con el otro isotipo, TGFβ3, TGFβ1 induce condrogenesis mediante el aumento de la condensación de células mesenquimales pre-cartilage.TGFβ3 induce condrogenesis mediante el aumento significativo de la proliferación de células mesenquimales [ 17] . Sin embargo, TGFβ3 es utilizado con mayor frecuencia por los investigadores que TGFβ1 7 , 10 , 18 , 19 . BMP2 mejora la expresión de genes relacionados con los componentes de la matriz condrogénica en humanosCondrocitos articulares bajo condiciones in vitro 20 . BMP2 aumenta la expresión de genes críticos para la formación de cartílago en MSCs en combinación con TGF β proteínas [ 21] . También se ha demostrado que BMP2 sinérgicamente mejora el efecto de TGF β3 a través de las vías Smad y MAPK [ 22] .

En este estudio, CBMC-hiPSCs se agregaron en EBs utilizando medio EB en una placa de Petri de baja fijación. Las células de crecimiento se indujeron uniendo los EB a un plato recubierto de gelatina. La diferenciación condrogénica utilizando células de crecimiento se realizó por cultivo de pellets. El tratamiento con BMP2 y TGFβ3 condensó con éxito las células y indujo la acumulación de proteínas de la matriz extracelular (ECM) para la formación de gránulos condrogénicos. Este estudio sugiere un sencillo pero eficiente clondrogenic diferenciación protocolo utilizando CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Este protocolo fue aprobado por la junta de revisión institucional de la Universidad Católica de Corea (KC12TISI0861). CBMCs utilizados para la reprogramación se obtuvieron directamente del Banco de Sangre de Cordón del Hospital St. Mary de Seúl.

1. Diferenciación condrogénica de iPSCs

  1. Generación CBMC-iPSC
    1. Generar CBMC-hiPSCs utilizando el protocolo mostrado en nuestro trabajo anterior 23 .
    2. Recoja las células de la sangre en un tubo cónico de 15 ml y cuente con un hemocitómetro.
    3. Preparar 3 x 105 células y centrifugarlas durante 5 min a 515 xg y RT. Desechar el sobrenadante por succión y resuspender las células en 0,5 ml de medio de células sanguíneas.
    4. Transferir las células a un pocillo de una placa de 24 pocillos sin recubrimiento y añadir la mezcla de virus Sendai, siguiendo las recomendaciones del fabricante.
    5. Centrifugar la placa durante 30 minutos a 1.150 xg y 30 ° C.
    6. En popaEr de centrifugación, incubar las células durante la noche (O / N) a 37 ° C en 5% de CO 2 .
    7. Al día siguiente, transfiera las células transducidas a un pocillo revestido con matriz. Centrifugar la placa a 1.150 xg durante 30 minutos a 30 ° C.
    8. Después de la centrifugación, se retira el sobrenadante, se añade 1 ml de medio iPSC y se mantienen las células O / N a 37ºC en CO _ { 2 } al 5%.
    9. Mantener las células unidas a 37 ° C y 5% de CO 2 . Cambie el medio diariamente, reemplazándolo con el medio fresco iPSC.
      NOTA: Las colonias aparecerán en el día 14-21 después de la transducción.
  2. EB generación
    1. Mantener los hiPSCs a 37 ° C y 5% de CO 2 . Cambie el medio diariamente, reemplazándolo con el medio Essential 8 (E8) fresco.
    2. Preparar 2 x 10 6 hiPSCs en un plato revestido con vitronectina de 100 mm en medio E8.
    3. Se retira el medio E8 del plato de cultivo y se lava con solución salina tamponada con fosfato estéril (PBS).
    4. Añadir 1Ml de ácido etilendiaminotetraacético 1 mM (EDTA) e incubar a 37 ° C y 5% de CO 2 durante 2 min.
    5. Cosecha de las células con 3 ml de medio E8 y transferirlos a un nuevo tubo cónico de 15 ml. Centrifugar las células a 250 xg a temperatura ambiente (RT) durante 2 min.
    6. Aspirar el sobrenadante sin alterar el sedimento celular y resuspender las células en 5 ml de medio E8.
    7. Contar las células utilizando un hemocitómetro y preparar 2 x 10 6 células para cada 100 mm placa de Petri. Resuspender las células preparadas en una mezcla de 10 ml de medio E8 y EB (1: 1) con 10 μM de inhibidor de la quinasa rho-asociada (ROCK).
    8. Incubar las células O / N para la agregación a 37 ° C y 5% de CO 2 .
    9. Al día siguiente, cosechar los EBs agregados por pipeteo. Centrifugar las células a 250 xg durante 1 min. Se retira el sobrenadante y se resuspende el EB en 10 ml de medio E8 fresco.
    10. Ampliar los EBs generados durante 5 días, realizando cambios diarios con fresH E8 medio. Para maduración adicional, cambiar el medio de cultivo al medio E7. Mantener los EB a 37 ° C y 5% de CO2 durante otros 5 días, realizando cambios medios diarios con medio E7 fresco.
      NOTA: El medio E7 es medio E8 sin FGF2.
  3. Inducción de células extraídas de EBs
    1. Añadir 6 ml de gelatina al 1% a un plato de 100 mm e incubar a 37 ° C y 5% de CO 2 durante 30 min.
    2. Retire la gelatina y seque completamente el plato durante 2-3 horas antes de usarlo.
    3. Transfiera los EB a un tubo cónico de 50 ml. Deje que los EBs se asienten en el fondo del tubo cónico. Eliminar el sobrenadante sin alterar el EB.
    4. Resuspender los EBs en 10 ml de medio de Eagle modificado por Dulbecco (DMEM) con suero bovino fetal al 20% (FBS). Transfiera los EBs al plato recubierto de gelatina de 100 mm. Añadir 10 μ M ROCK inhibidor.
    5. Incubar y mantener las células a 37 ° C y 5% de CO 2 durante 7 días. Cambiar de temaDium cada dos días sin añadir inhibidor de ROCK.
  4. Formación de gránulos condrogénicos
    1. Aspirar el medio de cultivo del plato y lavar las células tres veces con PBS.
    2. Aplicar 1 mL de EDTA 1 mM e incubar a 37 ° C y 5% de CO 2 durante 2 min.
    3. Cosecha de las células utilizando 5 mL de DMEM con 20% FBS y transferirlos a un nuevo tubo cónico de 15 mL.
    4. Centrifugar las células durante 2 min a 250 xg y RT. Deseche el sobrenadante y resuspenda el sedimento en 10 ml de DMEM con FBS al 20%.
    5. Filtrar y descartar los grupos de células utilizando un tamiz de células de 40 μm y cosechar las células individuales. Contar las células individuales con un hemocitómetro.
    6. Centrifugar las células durante 2 min a 250 xg y RT. Eliminar el sobrenadante y sembrar 3 x 10 5 células por gránulo en un tubo cónico de 15 mL con 300 μl de medio de diferenciación condrogénica (CDM).
    7. Para la formación de gránulos, centrifugar las células durante 5 min a680 xg y RT.
      NOTA: Los gránulos se mantienen en tubos cónicos de 15 mL durante la diferenciación de los gránulos condrogénicos.
    8. Incubar las células durante la noche a 37 ° C y 5% de CO 2 .
    9. Cambie el MDL cada 2-3 días. Dentro de 3 días, los gránulos mostrarán morfologías esferoidales aplanadas. Mantener los gránulos durante 21 días a 37 ° C y 5% de CO 2 .

2. Caracterización de los gránulos condrogénicos por tinción

  1. Incorporación condrogénica
    1. Antes de empotrar, preparar y fundir la parafina a 58 ° C.
    2. Fijar los pellets en 1 mL de paraformaldehído al 4% durante 2 h a RT en un tubo de 1,5 mL.
      Precaución: Paraformaldehído es altamente tóxico. Evite el contacto con los ojos, la piel o las membranas mucosas. Minimizar la exposición y evitar la inhalación mientras se prepara.
    3. Coloque una capa de gasa sobre el cassette y transfiera los gránulos fijos usando una pipeta. Cubrir el pellet doblando thColoque la gasa y cierre la tapa del cassette.
    4. Inicie la deshidratación en 100 ml de etanol al 70% (EtOH) dos veces, 10 min cada uno. Deshidratar los gránulos a través de lavados secuenciales de 10 minutos en EtOH al 80% y al 95%.
    5. Transferir los gránulos a EtOH al 100% durante 10 min. Repetir tres veces con EtOH fresco.
    6. Para "limpiar", se cambia la solución por una mezcla 100: 1 de EtOH y xileno 1: 1, seguido de una mezcla 1: 2 de EtOH y xileno durante 10 min cada uno. Borrar el EtOH restante incubando los gránulos dos veces en 100% xileno, 10 min cada uno.
    7. Para la infiltración de parafina, incubar los pellets en xileno secuencial y mezclas de parafina. Realizar todo el proceso de infiltración de parafina a 58 ° C. Incubar los pellets en 100 ml de una mezcla 2: 1 de xileno y parafina durante 30 min.
    8. Se cambia la solución por 100 ml de una mezcla 1: 1 de xileno y parafina e incuba durante 30 min.
    9. Se cambia la solución por 100 ml de una mezcla 1: 2 de xileno y parafina y se incuba durante 30 min.
    10. Para la infiltración final, transferir los gránulos al primer baño de parafina al 100% e incubar durante 2 h.
    11. Transferir los gránulos al segundo baño de parafina al 100% e incubar O / N a 58 ° C.
    12. Al día siguiente, suavemente transferir los gránulos a un molde con una pinza. Agregue parafina al molde del dispensador de parafina. Solidificar la parafina durante 30 minutos a 4 ° C.
    13. Corte las secciones a 7 μm y transfiera las secciones sobre la diapositiva. Deje que los portaobjetos se sequen durante la noche y guarde los portaobjetos a RT hasta que estén listos para su uso.
  2. Preparación de la diapositiva
    1. Desparafinar los portaobjetos moviéndolos a través de 100 ml de EtOH al 100%, 90%, 80% y 70% secuencialmente durante 5 min cada uno.
    2. Coloque los portaobjetos en un frasco de vidrio y enjuague con agua del grifo durante 5 min.
  3. Tinción azul Alcian
    1. Incubar los portaobjetos en 50 ml de solución de azul alciano al 1% durante 30 min.
      NOE: El azul de Alcian se diluye en una solución de ácido acético al 3%. Ajustar el pH a 2,5 utilizando ácido acético.
    2. Coloque los portaobjetos en un frasco de vidrio y enjuague con agua del grifo durante 2 min.
    3. Enjuague los portaobjetos en agua desionizada (DW) y contraste con una solución nuclear de color rojo rápido durante 2 min.
    4. Coloque las diapositivas en un frasco de vidrio y enjuague con agua del grifo durante 1 minuto.
    5. 2.3.5) Proceda a deshidratar y montar los portaobjetos en el paso 2.6.
  4. Tinción con azul de toluidina
    1. Incubar los portaobjetos en 50 ml de solución de azul de toluidina durante 4 min.
    2. Coloque los portaobjetos en un frasco de vidrio y enjuague con agua del grifo durante 5 min.
    3. Proceda a deshidratar y montar los portaobjetos en el paso 2.6.
  5. Tinción inmunohistoquímica
    1. Incubar las diapositivas en H 2 O 2 al 3% durante 15 min para bloquear la peroxidasa endógena.
    2. Aplicar 200 μl de anticuerpo primario (anti-COL1A1 y -COL2A1) diluido 1: 100 en tris-bu(TBS) conteniendo 1% de albúmina de suero bovino (BSA) y 5% de suero normal de cabra (NGS) a los portaobjetos e incubar O / N a 4 ° C.
    3. Al día siguiente, coloque los portaobjetos en un frasco de vidrio y lávelos con 50 mL de TBS conteniendo 0,1% de polisorbato 20 (TBST) tres veces durante 5 min cada uno.
    4. Aplicar 200 μl de anticuerpo secundario (anticuerpo de cabra anti-IgG de conejo, diluido 1: 200 en TBS que contiene BSA al 1% y NGS al 5%) a las placas e incubar a RT durante 40 min.
    5. Colocar los portaobjetos en un frasco de vidrio y lavarlos tres veces con 50 mL, 5 min cada uno.
    6. Para la amplificación de la señal, aplique la solución de estreptavidina conjugada con HRP a los portaobjetos e incube durante 10 min.
    7. Colocar los portaobjetos en un frasco de vidrio y lavarlos tres veces con 50 mL, 5 min cada uno.
    8. Mezclar la solución de sustrato DAB-peroxidasa, aplicar 200 μL de solución a cada diapositiva e incubar durante 1 min.
    9. Coloque los portaobjetos en un frasco de vidrio y enjuague con agua del grifo durante 5 min.
    10. ContracolorCon hematoxilina de Mayer durante 1 min.
    11. Lave las diapositivas con DW.
    12. Proceda a deshidratar y montar los portaobjetos en el paso 2.6.
  6. Deshidratación y montaje
    1. Deshidrate los portaobjetos moviéndolos secuencialmente a través de 100 mL de EtOH al 70%, 80%, 90% y 100%, cada 30 segundos.
    2. Sumerja los portaobjetos en dos cambios de xileno durante 1 minuto cada uno.
    3. Agregue 50 μl de solución de montaje a los cubreobjetos y coloque los portaobjetos en la parte superior.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En este estudio, hemos generado gránulos condrogénicos de CBMC-hiPSCs por inducir las células de extracción de EBs. La diferenciación condrogénica se indujo utilizando CBMC-HiPSCs con confirmada alta pluripotencia [ 11] . Un esquema simple de nuestro protocolo se muestra en la Figura 1A . Antes de la diferenciación, las colonias de iPSC se expandieron ( Figura 1B ). Los iPSCs ampliado se ensamblaron como EBs para iniciar la diferenciación ( Figura 1C ]. Los EBs generados se unieron a placas revestidas con gelatina para inducir células de crecimiento ( Figura 1D ). A continuación, se recolectaron las células de crecimiento y se usaron para generar gránulos condrogénicos. Después de 21 días de diferenciación, se obtuvieron pequeños gránulos condrogénicos en forma de bolas y se utilizaron para una caracterización adicional ( Figura 1E ). La calidad del chon producido in vitroDrogénica se confirmó mediante diversos ensayos.

Se evaluó histológicamente la calidad de los gránulos condrogénicos en el día 21. Se usaron pastillas condrogénicas de BMSC como control positivo. La acumulación de proteínas ECM secretadas por los condrocitos diferenciados se confirmó mediante azul alciano y tinción con azul de toluidina en la Figura 2A . Las principales características del cartílago saludable, como la producción de lagunas y proteoglicanos, aumentaron a medida que el proceso de diferenciación continuó durante 21 días. Los gránulos condrogénicos generados a partir de CBMC-hiPSCs expresaron COL2A1, que es el componente ECM principal en el cartílago sano ( Figura 2B ). La expresión de COL2A1 CBMC-hiPSC derivados de pellets fue mayor que la de BMSC derivados pellets. La expresión de colágeno tipo I, un marcador para el cartílago fibrótico, fue menor en CBMC-hiPSC derivado de pellets en comparación con la expresión de COL2A1. La expresión génica de las proteínas ECM del cartílago en los gránulos condrogénicos del día 21 se confirmó mediante PCR en tiempo real. La expresión de agrecano (ACAN) de CBEL-hiPSC derivado de pellets fue similar a la de BMSC derivados pellets ( Figura 3A ]. La expresión de COL2A1 fue significativamente más alta en CBMC-hiPSC derivados pellets ( Figura 3B ]. También se evaluó la expresión de la región determinante del sexo Y-box 9 (Sox9), un marcador progenitor condrogénico. Los gránulos generados a partir de CBMC-hiPSCs expresaron altos niveles de Sox9 ( Figura 3C ). Se confirmó que estos genes fueron significativamente upregulated en CBMC-hiPSC gránulos condrogénicos en comparación con BMSC control pellets en el día 21. La expresión de un marcador hipertrófico, COL1A1, se evaluó ( Figura 3D ). La expresión de COL1A1 en CBMC-hiPSC derivados pellets se redujo en comparación con la de BMSC-deriPellets. La eficiencia de diferenciación se analizó mediante la relación de COL2A1 a COL1A1 ( Figura 3E ). El incremento de la relación en los gránulos CBMC-hiPSC derivados demostró la expresión relativamente alta de COL2A1 en comparación con COL1A1. En conclusión, hemos confirmado la capacidad de diferenciación condrogénica de CBMC-HiPSCs. La calidad de las pastillas condrogénicas derivadas de CBMC-hiPSC generadas tenía una calidad compatible con la de las BMSC.

Figura 1
Figura 1: Diferenciación condrogénica de hiPSCs. ( A ) Esquema de generación de gránulos condrogénicos a partir de hiPSCs. ( B ) Morfología de la CBMC-hiPSC generada. ( C ) Morfología de EBs generados. ( D ) células procedentes de EBs unidas a un plato de cultivo recubierto de gelatina. ( E ) Imagen de t La pastilla condrogénica después de 21 días de diferenciación. Las unidades de los intervalos se muestran en milímetros. Barras de escala = 200 μm. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Análisis histológico de la pastilla condrogénica. ( A ) Evaluación histológica de gránulos condrogénicos en el día 21 usando azul alciano y tinción con azul de toluidina. ( B ) Imagen inmunohistoquímica de gránulos condrogénicos teñidos con anticuerpos COL1A1 y COL2A1. Barras de escala = 100 μm. Haga clic aquí para ver una versión más grande de esta figura.

1 "> figura 3
Figura 3: Expresión génica de la pastilla condrogénica. ( A ) La expresión génica relativa de ACAN. ( B ) La expresión génica relativa de COL2A1. ( C ) La expresión génica relativa de SOX9. ( D ) La expresión génica relativa de COL1A1. ( E ) Expresión génica de COL1A1. ( F ) Expresión génica de COL10A1. ( G ) La proporción de COL2A1: expresión del gen COL1A1. Los gránulos se cosecharon y se analizaron después de 21 días de diferenciación. Los datos se obtuvieron mediante PCR en tiempo real y se mostraron como el error estándar medio de los experimentos triplicados por muestra (n = 3). La expresión génica se normalizó a GAPDH como un control interno. (* P <0,05, ** p <0,01, *** p <0,001).K "> Haga clic aquí para ver una versión más grande de esta figura.

Numero de celular Producción de células de crecimiento Rendimiento de pellets
Hippos 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabla 1: Comparación de rendimiento de MSC y hiPSCs.

Nombre del destino Dirección Secuencia del cebador tamaño
Adelante TTCCGCGACGTGGACAT 77 pb
Marcha atrás TCAAACTCGTTGACATCGAAGGT
UNA LATA Adelante AGCCTGCGCTCCAATGACT 107 pb
Marcha atrás TAATGGAACACGATGCCTTTCA
COL2A1 Adelante GGCAATAGCAGGTTCACGTACA 79 pb
Marcha atrás CGATAACAGTCTTGCCCCACTTA
COL1A1 Adelante CCCCTGGAAAGAATGGAGATG 148 pb
Marcha atrás TCCAAACCACTGAAACCTCTG

Tabla 2: Secuencias de cebadores frente a marcadores condrogénicos en PCR en tiempo real.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Este protocolo generó con éxito HiPSCs de CBMCs. Se reprogramaron CBMCs a hiPSCs utilizando un vector viral Sendai que contiene Yamanaka factores [ 24] . Tres casos se utilizaron en la diferenciación, y todos los experimentos generados con éxito chondrogenic pellets utilizando este protocolo. Numerosos estudios han informado de protocolos para la diferenciación de hiPSCs en condrocitos 25 , 26 , 27 , 28 . Sin embargo, la investigación adicional es necesaria para confirmar el uso de CBMC-HiPSCs un candidato para la regeneración y recuperación del cartílago.

La condrogénesis se confirmó utilizando hiPSCs generados a partir de diversos tipos de células somáticas 11 , 25 , 26 , 27 , 29 . Muchos informesQue el origen de la célula somática utilizada en la reprogramación puede afectar el resultado de diferenciación de los hiPSCs 30 , 31 , 32 , 33 . La sangre del cordón umbilical es una fuente enriquecida con HSCs y MSCs. No hay ningún informe sobre la diferencia entre las células derivadas de la sangre del cordón umbilical, como las células sanguíneas o las MSC. Sin embargo, estudios previos han demostrado que condrocitos articulares derivados de HiPSCs son más propensos a pasar por condrogénesis que hiPSCs generados a partir de sangre de cordón o fibroblastos de la piel [ 29] . Los resultados de la diferenciación endotelial utilizando hiPSCs generados a partir de fibroblastos, células progenitoras cardiacas y células endoteliales demostraron que el tejido de origen puede reflejar la memoria somática específica del tejido en la derivación diferencial terminalmente diferenciada del IPSC, especialmente en los primeros pasos, entre 10 y 20 34 . En los pasajes tempranos de los hiPSCs, el deri de células endotelialesHiPSCs se diferenciaron más eficientemente en el linaje endotelial. Sin embargo, la diferencia significativa entre estas líneas celulares desapareció en hiPSCs en 20 pasajes. Por lo tanto, es importante considerar cuidadosamente la memoria somática llevada por el hiPSCs en los pasajes tempranos cuando se utilizan en la investigación clínica.

Recientemente, se han desarrollado varios procedimientos para reparar el cartílago articular defectuoso. Microfractura se realiza mediante la perforación de múltiples agujeros en el hueso para inducir la afluencia de médula ósea para la reparación natural [ 35] . El reemplazo de rodilla, también conocido como artroplastia de rodilla, se utiliza para reemplazar el cartílago dañado. Sin embargo, la microfractura no es útil para el daño severo del cartílago articular, y el instrumento usado para los reemplazos de la rodilla se debe cambiar cada 10-15 años.

En estos días, las terapias basadas en células son un método alternativo prometedor para la reparación del cartílago. La implantación autóloga de condrocitos (ACI) es ampliaUtilizado para la recuperación del cartílago celular. ACI se realiza mediante la inyección directa de condrócitos autólogos en el defecto. Sin embargo, los condrocitos autólogos se convierten en células semejantes a fibroblastos en condiciones de cultivo in vitro . El daño adicional es también inevitable durante el proceso de cosecha de los condrocitos autólogos. MSCs han sido sugeridos como una fuente de células para la recuperación del cartílago. La sangre del cordón umbilical es una fuente útil y accesible de MSCs para el cartílago de ingeniería 36 . Sin embargo, la tasa de éxito para aislar MSC de sangre de cordón es controvertida 37 , 38 . Numerosos estudios informan del éxito del aislamiento de MSC de sangre de cordón umbilical. Varios estudios han demostrado que el volumen de sangre del cordón umbilical es un parámetro crítico que puede afectar a la tasa de rendimiento de aislamiento MSC 36 , 39 . Para adquirir MSC de alta calidad, el paso de las células también es crítico. Estudios previos indican queT MSCs tienen una vida útil restringida después de cierto número de división celular. Al entrar en la senescencia, las MSC se caracterizan por una proliferación disminuida, como con cualquier célula somática normal 40 . Por lo tanto, MSC derivado de la sangre del cordón umbilical debe utilizarse antes del sexto paso para evitar la senescencia celular y anomalías cromosómicas [ 41] .

Para evitar estas limitaciones, las iPSCs humanas abrieron una nueva posibilidad para una terapia celular personalizada con alta productividad 11 . Los hiPSC establecidos pueden, teóricamente, proliferar ilimitadamente. Además, con la misma identidad inmunitaria que el donante, pueden evitar el rechazo y los efectos secundarios más bajos cuando se implantan in vivo . La transición de los bancos de sangre del cordón umbilical en los bancos de hiPSC para el tratamiento médico alogénico tiene una tremenda posibilidad y potencial 42 . El cribado de CBMCs homocigóticos HLA-mecanografiados antes de la reprogramación puede utilizar ampliamente las líneas iPSC alogénicas foR tratamiento clínico. Las líneas iPSC homocigóticas pueden evitar reacciones inmunológicas tras el trasplante de un aloinjerto. Este concepto también se puede aplicar a la regeneración del cartílago mediante la generación de HLA-homocigotos cartílago [ 11] .

Por lo general, la diferenciación condrogénica se lleva a cabo a través de dos pasos críticos: la inducción de células derivadas de EB derivadas y la formación de pellets. La diferenciación inicial de hiPSCs en células derivadas EB-derivadas es fundamental para aumentar su potencial de diferenciación condrogénica. Outgrowth células diferenciadas de hiPSCs son funcionalmente y molecularmente similar a BMSC nativos [ 7 , 43] . Estudios anteriores utilizaron cultura de monocapa o cultivo EB como etapa de pre-diferenciación para inducir células mesenquimatosas 10 , 43 . Sin embargo, la diferenciación directa por el cultivo monocapa lleva mucho tiempo en comparación con el uso de EBs, y ch Los sedimentos ondrogénicos tienden a diferenciarse en fibrocartílago con características hipertróficas. Se informó de que la morfología celular y el potencial de diferenciación condrogénica de generados mesenquimal-progenitor células similares difieren mucho de acuerdo a la densidad celular de la monocapa celular [ 9] .

Utilizamos EBs para inducir células de crecimiento, que es un método relativamente rápido y simple comparado con el cultivo monocapa. Utilizando este protocolo, hemos sido capaces de generar muchos pellets utilizando un número relativamente pequeño de hiPSCs ( Tabla 1 ]. El tamaño y el número de EB fueron críticos para la producción exitosa de masa de gránulos condrogénicos. Por esta razón, ampliamos los EBs agregados en medio E8, hasta que más de la mitad de los EBs generados eran mayores de 100 μm. Después de la ampliación EB, mantuvimos los EBs en medio E8 sin FGF2. Previamente, los investigadores mantuvieron EBs generados sin FGF2 para la inducción del linaje mesodérmicoXref "> 9.

A pesar de que intentamos mantener las células extraídas generadas en una alta densidad para una mejor calidad, aún quedan varias limitaciones. Si bien hemos confirmado que las células generadas extracción comparten una morfología similar, las células pueden ser aún heterogéneas. Estudios previos han intentado clasificar para un tipo celular específico; Sin embargo, este procedimiento ha resultado en la recolección de un número bajo de células. Se requerirá un nuevo intento para aislar células de crecimiento homogéneo a mayor escala para generar una gran cantidad de gránulos condrogénicos con características mejoradas.

Varios grupos están induciendo células progenitoras de hiPSCs usando cultivo monocapa o EB. La inducción de células progenitoras con una alta similitud con MSCs puede ser la clave para obtener gránulos condrogénicos de mayor calidad. Estas células progenitoras derivadas de EBs tienen características similares a las de MSCs. Sin embargo, esto puede deberse a laIr naturaleza fibroblástica. Por lo tanto, se requiere un estudio detallado de validación de las células de crecimiento.

En este estudio, sugerimos un protocolo que puede generar una cantidad relativamente grande de pellets condrogénicos. Se confirmó que el cartílago regenerado utilizando CBMC-hiPSCs mostró un fenotipo saludable y se puede utilizar como material para la regeneración de tejidos. Sin embargo, se requiere un método mejorado con un cronograma de diferenciación más corto para su posterior aplicación. El desarrollo adicional de las normas de control de calidad para validar el cartílago con un nivel más alto de hialina también es necesario para futuras aplicaciones de CBMC-HiPSCs como material celular para la regeneración del cartílago. El protocolo es simple pero efectivo y no requiere ningún proceso de clasificación adicional antes de la formación de gránulos. En conclusión, utilizando este protocolo, se pueden generar pellets condrogénicos de alta calidad para estudios sobre el modelado de la enfermedad, el tamizaje de fármacos y la medicina regenerativa paraNaturaleza del cartílago.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

Este trabajo fue apoyado por una subvención del proyecto de I + D de Tecnología Sanitaria de Corea, Ministerio de Salud, Bienestar y Asuntos Familiares, República de Corea (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics