שיטת טרנספוזיציה יעיל במבחנה על-ידי מערכת יופי ישן Transcriptionally מוסדרים הארוזים לתוך וקטור Lentiviral פגומים אינטגרציה

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

פרוטוקול זה מתאר שיטה להשיג שילוב יציב הגן עניין הגנום האנושי על ידי המערכת היפהפייה הנרדמת transcriptionally מוסדרים. הכנת השילוב של וקטורים lentiviral פגומים, התמרה של במבחנה חושית של תאים אנושיים ואת וזמינותו המולקולרית בתאי transduced מדווחים.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Transposon היפהפייה הנרדמת (SB) היא מערכת שילוב נגיפי עם יעילות מוכחת עבור העברה גנטית, גנומיקה תפקודית. כדי למטב את מכונות transposon SB, הם מועסקים, transcriptionally מוסדרים היפראקטיביים transposase (SB100X) ו transposon מבוסס-T2. בדרך כלל, transposase ואת transposon הינם מסופקים transiently על ידי פלסמיד תרביות תאים, SB100X ביטוי מונעת על ידי יזם מכוננת. כאן, אנו מתארים שיטה יעילה כדי לספק את הרכיבים SB תאים אנושיים, כי הם עמידים בפני מספר שיטות פיזיקליות, כימיות תרביות תאים, SB100X הביטוי שליטה ולשלב stably הגן עניין (גוי) דרך SB "גזור והדבק" מנגנון. הביטוי של transposase היפראקטיבי מפוקחת באופן קפדני על-ידי מערכת ט-ON, בשימוש נרחב כדי לשלוט ביטוי גנים מאז 1992. הגן עניין משני צדדיה הפוך חזרה (IR) של transposon T2. שני הרכיבים SB ארוזים בשילוב פגומים וקטורים lentiviral transiently המיוצר בתאים HEK293T. תאים אנושיים, או שורות תאים או ראשי תאים מרקמות אנושיות, הם במבחנה transiently transduced עם וקטורים ויראלי. על תוספת של דוקסיציקלין (dox, טטרציקלין אנלוגי) לתוך המדיום תרבות, כוונון של ביטוי transposase נמדד, התוצאה היא שילוב לטווח ארוך של הגן עניין הגנום של תאים שטופלו. שיטה זו היא יעילים וישימים שורת התאים (למשל, הלה תאים) ותאים הראשית (למשל, אדם ראשי keratinocytes), ובכך מייצג כלי רב ערך עבור הנדסה גנטית, העברה גנטית טיפולית.

Introduction

Transposase SB100X היפראקטיבי מצמידים את transposon מבוסס-T2 שימש כבר ג'ין פרה טיפול יישומים1,2,3, הגנום שינויים4,5, ו pluripotent המושרה תא גזע (iPSC) התכנות6,7. בדרך כלל, הרכיבים SB transiently הינם מסופקים על ידי תרביות תאים פלסמיד וכונני מקדם מכוננת חזקה הביטוי של transposase. עם זאת, למרות השיטות חדש משופר של תרביות תאים, משלוח של מערכת שני עדיין אתגר עבור יישומים רבים. לפיכך, הפיתוח של פרוטוקול מסירה חדש יש עניין גובר. מלבד השיטות תרביות תאים פלסמיד8 ו- mRNA9, משלוח ויראלי בהתבסס על adenoviral10,11, adeno-הקשורים ויראלי (AAV)12, Baculovirus13, gammaretroviral14 , lentiviral וקטורים15 הוצע בעבר. ראוי לציין, המערכת של בחירה חייבת להבטיח את משלוח ארעית של רכיבי SB בלי אינטגרציה של וקטור ויראלי. למרות זאת, הביטוי המכונן של transposase מעלה חששות בטיחות בשל הסכנה של rehopping בלתי נשלט של transposon.

לכן, רגולציה תעתיק של SB100X על-ידי מערכת ט-אן מעודן הוא האתגר הראשון. מקדם ט מגיב שונה, שהושג על ידי החלפת ייצוג המקדם cytomegalovirus מינימלי מפותחת (CMV) המקורי עם האמרגן מינימלי (-81) של הגן Timidine קינאז (TK) 1 וירוס הרפס סימפלקס (HSV-1)16, שוכפל הזרם של CDNA SB100X (pTetOTKSB100X). מוטציה rtTA2 הפוכה-טטרציקלין-transactivators-M217 מבוטא תחת השליטה של האמרגן מכוננת חזקה (מקדם phosphoglycerate, PGK) שיכפל בתוך פלסמיד שונים (pCCL-PGKrtTA2S-M2). בעת הוספת המדיום תרבות, dox מאגד את rtTA2s-אפנן M2 ו tethers ט ייצוג המקדם מורכבים או, המתקבל ב מוסדר בחוזקה אינדוקציה של הביטוי SB100X18.

האתגר העיקרי השני נובע תרביות תאים לא יעיל של תאים אנושיים הראשי באמצעות מספר שיטות פיזיקליות, כימיות. להעביר ביעילות transposase בתאי אדם עמיד תרביות תאים, את SB100X של ה-rtTA2s-קסטות הביטוי M2 ארוזים אל תוך שילוב שני וקטורים פגומה lentiviral (IDLVs)19: IDLVTKSB ו- IDLVrtTA2s- M2. וקטורים ויראלי מיוצרים transiently כמו וקטורים הדור השלישי HEK293T תאים20 ו- pseudotyped עם גליקופרוטאין G של הנגיף Vescicular Stomatitis (VSV-G), אשר מקנה לקשת רחבה של זיהום. וקטור חלקיקים מרוכז על-ידי ultracentrifugation, טיטרציה על ידי HIV-1 להקיא p24 immunocapture. כדי מגלי שורות תאים ותאים הראשי, וקטור חלקיקים הם ומורכבת עם polybrene, מודגרת עם התאים היעד ב נוכחות או היעדרות של dox. התרופה תלוית ההפעלה של הביטוי SB100X בתאים transduced נמדד על ידי RT-PCR (לרביעיית-PCR) כמותית18.

ברגע מוסדר ט SB100X ביטוי הוכח, טרנספוזיציה של ממשלת ישראל (למשל, חלבון פלואורסצנטי ירוק, GFP) לתוך הגנום בתא היעד עוקב אחר האירועים המולקולריים schematized בבירור על ידי בק, Mikkelsen21. שליש IDLV וקטור נושא קלטת הביטוי עבור ממשלת ישראל משובטים בין ההכנסה T2-transposon (IDLVT2) חייב להיות נבנה ונארז כאמור לעיל. לבסוף, שלושת הווקטורים IDLV יכול לשמש ביעילות מגלי תאים אנושיים (למשל, ראשי keratinocytes) במבחנה ולשלב ממשלת ישראל בנוכחות דוקסיציקלין18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. פלסמידים המועסקים

הערה: פלסמיד pCCL-PGKrtTA2S-M2 היה בחביבות שסופקו על-ידי פרופסור Zappavigna (אוניברסיטת מודנה, רג'יו אמיליה, שוויץ). פלסמיד pCMVSB100X נושאת את רצף קידוד של transposase היפראקטיבי של פלסמיד transposon pT2/BH בחביבות שסופקו על-ידי פרופ ' / ח' ז' Ivics (פול ארליך המכון, Langen, גרמניה), פרופסור צ Izvak (Max Delbruck מרכז לרפואה מולקולרית, ברלין, גרמניה).

  1. עבור כל שכפול ב- Escherichia Coli (e. coli), בצע את האסטרטגיה שיבוט של הליך הבחירה ואת אנזים הגבלה או PCR הגברה של השבר להיות משובטים.
    הערה: טבלה 1 מסכמת כל פלסמידים המועסקים פרוטוקול זה. תיאור והפניות עבור כל פלסמיד הינם מסופקים.

2. ייצור וקטור ויראלי

הערה: כל הווקטורים ויראלי מיוצרים ברדס הביולוגי ברמה הבלימה אבטחה BSL2, על פי תקנות וכללים מוסדיים.

  1. התרבות תאים HEK293T חסיד של Dulbecco ששינה נשר בינוני בתוספת 10% HyClone סרום פניצילין U/mL 100-סטרפטומיצין, גלוטמין 2 מ מ.
  2. יום 0: להכין חמישה הכנת לוחות/ויראלי 15 ס מ זרע 5.5x106 תאים 30 מ של המדיום.
  3. יום 1: תקנים
    1. לפני שמתחילים תרביות תאים, הכן 100 מ ל תמיסת מלח 2 x HEPES מאגר (HBS):
      NaCl (5 מ') מ ל 5.6
      HEPES (1 מ') 10.0 מ ל
      נה2HPO4 (0.5 M) 0.3 mL
      סטרילי מים 84.1 mL
      להתאים את ה-pH 7.1 עם 37% HCl.
      הערה: 2 x HBS ניתן לאחסן ב 4 º C. PH המדויק חשוב מאוד עבור תקנים יעיל. הטווח pH אופטימלי הוא 7.10 עד 7.12.
    2. הסר בינוני ומוסיפים 22.5 מ ל/צלחת של טרי בינוני 4 שעות לפני תרביות תאים.
    3. Transfect תאים HEK293T עם פלסמיד העברה, את פלסמיד אריזה pMD.Lg/pRRE.D64VInt, פלסמיד קידוד המעטפה את pMD2.G את pRSV-Rev (טבלה 1) על פי הלוח/הכמות הבאים:
      העברת פלסמיד 25.00 µg
      µg pMD.Lg/pRRE.D64VInt 16.25
      pMD2.G 8.75 µg
      µg pRSV-Rev 6.25
      הערה: פלסמיד DNAs מוכנות לפי הפרוטוקול CsCl שתואר על ידי Maniatis22 או באמצעות ערכת טיהור ללא אנדוטוקסין פלסמיד.
      1. Resuspend µg 56.25 של DNA (שילוב של פלסמידים 4) ב- 1.125 מיליליטר מים סטריליים ולהוסיף µL 125 של 2.5 מטר CaCl2 (פתרון A).
      2. להוסיף 1.250 מ של 2 x HBS שפופרת צנטרפוגה חרוט סטרילי 15מל (פתרון B).
      3. להוסיף פתרון (1.250 mL) ל B (1.250 מ ל) dropwise תוך בעבוע באמצעות פיפטה מ"ל 1 או 2 (הפתרון תרביות תאים, הנפח הכולל 2.500 מ ל).
      4. תקופת דגירה של 20 דקות בטמפרטורת החדר (RT).
      5. באמצעות micropipette של P1000, להפיץ את כל הפתרון תרביות תאים (2.500 מ ל) טפט תא dropwise.
    4. דגירה בין לילה בחממה תרבות התא ב 37 מעלות צלזיוס, 5% CO2.
  4. יום 2: להסיר את המדיום ולהוסיף 15 מ"ל בינוני טריים (ראה שלב 2.1).
  5. יום 3: לאסוף ולרכז את תגובת שיקוע lentiviral המכילים חלקיקים.
    1. לאסוף כל תגובת שיקוע (~ 70 מ ל) (n = 5) transfected תא צלחות, לסנן דרך מיקרומטר 0.45 וסטיית לסנן ולמלא polyallomer 2 צינורות (1 אינץ ' x 3.5 ס מ) / ויראלי הכנה.
    2. לרכז את החלקיקים וקטור על ידי ultracentrifugation ב 106,000 g x עבור 2.5 h, 15 ° C עם בלם.
    3. מיד לאחר שעצרה את ultracentrifugation (כדי למנוע resuspension של בגדר בצינור), בעדינות שופכים את תגובת שיקוע לתוך מיכל המכיל 10% מלבין ו להשעות את כדורי בקושי נראה 2 ב 100 µL ל- PBS 1 x (+1% BSA). . זה נורמלי כמו בגדר ברורים וקצרים. השתמש הווקטור מרוכז טרייה, או aliquot ולאחסן את ההכנות ויראלי ב-80 מעלות צלזיוס.
      התראה: תגובת שיקוע מכיל חלקיקים lentiviral חייב להיות מולבן ביסודיות לפני השלכת של פסולת חומרים מסוכנים.
  6. כדי titrate ההכנה וקטור ויראלי, השתמש HIV-1 להקיא p24 immunocapture ערכה לפי הפרוטוקול של היצרן.
    הערה: כדי לתקנן את הייצור וקטור ויראלי, ריאגנטים מבוססי ליפוזומים יכול להיות מועסק. למרות זאת, כייל וקטור ויראלי תלויה מאוד תרביות תאים יעילות וטוהר פלסמיד ה-DNA.

3. התמרה חושית של שורות תאים אנושיים (למשל, הלה תאים)

הערה: הלה תאים מתורבתים במדיום הנשר של Dulbecco ששונה בתוספת 10% עגל עוברית סרום פניצילין U/mL 100-סטרפטומיצין, גלוטמין 2 מ מ. טבלה 1 מסכמת כל הווקטורים המועסקים פרוטוקול זה. תיאור עבור כל וקטור מסופק. התמרה חושית של תאים הלה מאפשר אימות של התקנון תעתיק של SB transposase בשילוב במינון הכי טוב שני וקטורים IDLV. וריאציה של מינונים IDLV עשויה להיות קשורה וקטור טיטור החלקיקים וסוג תא היעד.

  1. יום 0: זרע 2 x 105 תאים 3 מ"ל של מדיום עבור כל טוב של צלחת 6-. טוב. להכין 4 בארות.
  2. יום 1: התמרה חושית של הלה תאים.
    1. עבור כל תנאי, לדלל וקטורי lentiviral נפח סופי של 1 מ"ל בינוני (ראה הערה לעיל) בנוכחות 10 μL של polybrene (ריכוז סופי 8 μg/mL):
      דילול טוב # 1: ללעוג transduced תאים (בקרה שלילית).
      דילול עבור #2: וקטור IDLVTKSB (2,600 ng של p24).
      דילול-וולס #3, #4: וקטור IDLVTKSB (2,600 ng של p24) + IDLVrtTA2s-M2 וקטור (9,600 ng של p24).
    2. להסיר את המדיום מכל קידוח איפה הלה תאים מצופים ביום 0 ומוסיפים דילולים וקטור lentiviral המתאימה היטב.
    3. Spinoculate הצלחת. ובכן 6 ב g 754 x למשך 45 דקות ב 20-25 ° C, ואז העברת הצלחת 6-ובכן חממה התרבות התא-CO 37 ° C ו-5%2.
    4. לאחר 6-אייץ ', החלף את הווקטורים המכילות בינוני בינוני טריים בבארות כל ולהוסיף דוקסיציקלין μM 1 טוב # 4. מכניסים את הצלחת חממה התרבות התא ב 37 מעלות צלזיוס במשך 48 שעות.
  3. יום 3: הכנת תא צניפה לחילוץ RNA.
    1. לפני ניתוק התאים, הכן הפתרון עובד טריפסין (1 x):
      2.5% טריפסין (10 x) מ ל 5.0
      500 מ מ EDTA (ריכוז סופי = 5 מ מ) 0.5 mL
      1 x PBS 44.5 מ
    2. טריפסין חמים הפתרון עובד ב 37 מעלות צלזיוס לפני השימוש. לאחסן טריפסין הפתרון עובד ב 4 º C.
    3. הסר בינוני ולשטוף תאים עם 1 x PBS. להוסיף 0.5 מ של הפתרון עובד טריפסין מראש ומחוממת-37 מעלות צלזיוס מכל קידוח, דגירה ב 37 מעלות צלזיוס במשך 7 דקות (ב חממה התרבות תאים).
    4. לאחר הדגירה, להוסיף 0.5 מ של סרום המכיל בינוני עד בכל טוב כדי להשבית טריפסין ותאים לאסוף בשפופרת צנטרפוגה. לשטוף טוב פעם אחת עם 3 מ"ל של PBS 1 x, centrifuge התליה תא עבור 5 דקות ב 240 x g.
    5. לשטוף תאים עם 5 מ של 1 x PBS, צנטריפוגה למשך 5 דקות ב 240 x g ולמחוק את תגובת שיקוע. השתמש כדורי תא שנאספו טרי או לאחסן ב- 80 ° c חלץ RNA הכולל של כדורי לבצע RT-PCR כמותי למחצה (ראה שלב 6).

4. התמרה חושית של התאים הראשי של האדם (למשל, keratinocytes)

הערה: keratinocytes ראשי האדם הם נזרע על גבי לקרינה אולם 3T3-J2 תאים (שכבה מזין)23, מתנה נחמדה יאן Barrandon (EPFL, לוזאן, שווייץ).

  1. לגדול העכבר שוויצרי 3T3-J2 בתאים ששינה נשר בינוני של Dulbecco בתוספת 10% התורם סרום שור פניצילין U/mL 50-סטרפטומיצין, גלוטמין 4 מ מ (בינוני 3T3).
  2. לצמוח keratinocytes מצופה על גבי התאים לקרינה אולם 3T3-J2 cFAD בינוני, בינוני נשר שונה של Dulbecco F12 מדיה תערובת של חזיר (3:1) המכילים סרום שור עוברית (10%), פניצילין-סטרפטומיצין (1%), גלוטמין (2%) אינסולין (5 µg/mL), אדנין ( 0.18 מ מ), הידרוקורטיזון (0.4 µg/mL), טוקסין הכולרה (0.1 nM), ו תריודוטירונין (2 ננומטר).
  3. יום 0: זרע 3 x 105 אולם מוקרן 3T3-J2 תאים, בעבר מדולל 3T3 בינוניים עד ריכוז סופי של תאים5 עונה 1 פרק 10/mL, בבאר בכל צלחת 6-. טוב. להכין 9 בארות.
  4. יום 1: התמרה חושית של keratinocytes ראשי
    הערה: התמרה חושית של keratinocytes מאפשר כימות של התקנון תעתיק של SB transposase בשילוב במינון הכי טוב שני וקטורים IDLV (על-ידי לרביעיית-PCR) וכדי לאמת את השילוב של גוי (GFP) בתאי המטרה (על-ידי cytofluorimetric ניתוח).
    1. לפני ניתוק התאים, הכן את הפתרון עובד טריפסין:
      0.5% טריפסין-EDTA (10 x) מ ל 5.0
      500 מ מ EDTA (ריכוז סופי = 5 מ מ) 0.5 mL
      1 x PBS 44.5 מ
    2. טריפסין חמים הפתרון עובד ב 37 מעלות צלזיוס לפני השימוש. לאחסן טריפסין הפתרון עובד ב 4 º C.
    3. כדי לנתק keratinocytes subconfluent בתרבות, הסר בינוני, לשטוף תאים עם 1 x PBS ולהוסיף 1 מ"ל של הפתרון עובד טריפסין ומחוממת מראש מכל קידוח. דגירה ב 37 מעלות צלזיוס למשך 15 דקות החממה התרבות תאים.
    4. לאחר הדגירה, resuspend התאים של באר ביסודיות ולהעביר התליה תא שפופרת צנטרפוגה המכיל 2 מ של סרום המכיל בינוני (אם תאים רבים עדיין מחוברים, דגירה דקות נוספות ב 37 מעלות צלזיוס). לשטוף טוב פעם אחת עם 3 מ ל 1 x PBS או בינונית טרייה ולהוסיף את הפתרון שטיפה ברכבת התחתית צנטריפוגה עם התליה תא.
    5. צנטריפוגה למשך 5 דקות ב 580 x g וזורקים את תגובת שיקוע.
    6. לשטוף תאים עם 5 מ של 1 x PBS, צנטריפוגה למשך 5 דקות ב 580 x g וזורקים את תגובת שיקוע.
    7. צינור פוליפרופילן 15-mL, לדלל 1.6x10 keratinocytes5 ב 1 מ"ל של cFAD בינוני, דילול אחת עבור כל תנאי.
    8. לדלל lentiviral וקטורים ב 1 מ"ל של מדיום cFAD בנוכחות 20 μL של polybrene (ריכוז הסופי של µg/mL 8 בווליום הסופי של 2 מ ל):
      דילולים וולס #1, #2, #3: ללעוג transduced תאים (שליטה שלילי ללא וקטורים).
      דילולים וולס #4, #5: וקטור IDLVTKSB (13,000 ng של p24) + IDLVrtTA2s-M2 וקטור (48,000 ng של p24).
      דילולים וולס #6, #7, #8, #9: וקטור IDLVTKSB (13,000 ng של p24) + IDLVrtTA2s-M2 וקטור (48,000 ng של p24) + וקטור IDLVT2 (9,160 ng של p24).
    9. מגלי בתאים השעיה על-ידי הוספת כל דילול וקטור lentiviral (1 מ"ל) כדי המתלה תקין המתאים (1.6x10 keratinocytes5 ב 1 מ"ל).
    10. להסיר את המדיום מתאי לקרינה אולם 3T3-J2 נזרע יום 0 ו keratinocytes צלחת transduced (1.6x10 keratinocytes5 ב- 2 מ"ל) עלתה עליהם. לאחר transducing היטב המשך פעם הבאה.
    11. דגירה ב 25 מעלות צלזיוס למשך 30 דקות, ולאחר מכן להעביר את התאים עד 37 ° C בחממה התרבות התא במשך 6 שעות.
      הערה: תעשה לא keratinocytes, ראשי spinoculate הכדאיות והתפשטות חריפה יושפעו.
    12. לאחר 6 שעות, להוסיף 1 מ"ל של מדיום cFAD כל טוב. הוסף μM 1 דוקסיציקלין (ריכוז סופי) בבארות #5 #8, #9. לחזור תאים 37 מעלות צלזיוס.
  5. יום 2: להחליף cFAD בינוני 3 מ"ל של מדיום KC עם 10 ננוגרם למ"ל EGF.
  6. יום 3: Trypsinize ולשטוף תאים מבארות #1, #4 ו 5 # כמתואר קודם (ראה 4.4.1 כדי 4.4.6). הקפאת תאים כדורי ב- 80 ° C כדי לחלץ RNA הכולל לניתוח לרביעיית-PCR (ראה שלב 7).
  7. Trypsinize תאים מן #2, #6 ו- #8 כמתואר בצעדים 4.4.1 כדי 4.4.5 ולבצע ניתוח cytofluorimetric לביטוי GFP (ראה שלב 5).
  8. שמור את התרבות מבארות #3 #7, #9 עבור הטווח לפחות 3-4, מספיקות לדלל IDLVT2 האו ם משולב וקטור (5 ימים עבור האדם keratinocytes הראשית מצופה בשכבה מזין).
  9. יום 6: כ 5 ימים לכתוב התמרה חושית, trypsinize תאים (ראה שלבים 4.4.1 כדי 4.4.5) מבארות #3 #7, #9 לבצע ניתוח cytofluorimetric לביטוי GFP (ראה שלב 5).
    הערה: תזמון ניסוי ויעילות התמרה חושית מושפעות מאוד לפי סוג התא הראשי ולפי השתנות של הדוגמאות שנאספו.

5. Cytofluorimetric ניתוח על keratinocytes ראשי transduced

הערה: זרימה cytometer נקבעה עם לייזר כחול (488 ננומטר), לייזר אדום (633 ננומטר) מסננים עבור זיהוי של קרינה פלואורסצנטית GFP, APC הוא מועסק (ראה טבלת חומרים).

  1. להפלות keratinocytes משכבת מזין 3T3-J2, תווית transduced keratinocytes מנותקת-ביום 3 וביום 6 (ראה שלבים 4.7 ו- 4.9) עם העכבר monoclonal APC-נוגדן אנטי-מזין מצומדת.
    1. להכנת 4 מיליליטר מכתימה את המאגר עבור כל דגימה:
      5% FBS 200 ΜL
      500 מ מ EDTA (ריכוז סופי = 2.5 מ מ) 20 μL
      ΜL PBS 1 x 3780
    2. רחץ מנותקת תאים עם 1 מ"ל של צביעת מאגר. צנטריפוגה למשך 5 דקות ב 580 x g וזורקים את תגובת שיקוע.
    3. בשפופרת עבור רכישת cytometry זרימה, resuspend 5 x 10 תאים4 ב 100 μL מאגר מכתימים ולהוסיף 2 μL של נוגדן אנטי-מזין (1:50). מערבבים היטב, תקופת דגירה של 30 דקות על קרח בחושך.
    4. לאחר 30 דקות, לשטוף עם 2 מ של צביעת מאגר. צנטריפוגה למשך 5 דקות ב 580 x g וזורקים את תגובת שיקוע. Resuspend ב μL 200 של צביעת מאגר.
    5. רוכשים APC ו- GFP אותות על ידי ניתוח cytofluorimetric18. השבר תאים GFP+ של אוכלוסיית תאי APCמציין transduced keratinocytes.
      הערה: אם רצונך בכך, לתקן את הדגימה מוכתם לפני cytometry זרימה עם 2% paraformaldehyde ב- PBS 1 x וחנות ב 4 ° C בחושך עד ההפעלה.
  2. ניתוח נתונים cytometry זרימה ידי היחס בין אחוז GFP+תאים על הקצה (5 ימים) ואת אחוז GFP+תאים יומיים לפרסם התמרה חושית, מנורמל לרמה שיורית של IDLVT2-transduced תאים.

6. חצי כמותית RT-PCR

הערה: השתמש הצנטרפוגה תרמי של ה-PCR.

  1. לחלץ סך RNA מ transduced או לשלוט תאים באמצעות ערכת טיהור RNA, על-פי הפרוטוקול של היצרן.
    הערה: RNA הכולל שניתן לאחסן ב- 80 ° c
  2. לסנתז cDNA בתגובה 20 µL באמצעות 100 ננוגרם של RNA הכולל וערכת רוורס טרנסקריפטאז, על-פי הפרוטוקול של היצרן.
    הערה: cDNA שניתן לאחסן ב-20 ° C.
  3. עיצוב תחל ספציפיות עבור SB100X, rtTA2s-M2 ו- GAPDH (גן משק בית).
    עיצובים המוצע:
    SB קדימה פריימר: 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB הפוך פריימר: 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 להעביר פריימר: 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 הפוכה פריימר: 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH להעביר פריימר: 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH הפוכה פריימר: 5'CCACCACCCTGTTGCTGTAG3'
  4. ביצוע PCR נפח התגובה האחרונה של 50 µL. בפרט, להרכיב כל צינור PCR את התגובה הבאה:
    cDNA (1:5 דילול) (מתוך שלב 6.2) 1.00 µL
    קדימה פריימר (10 מיקרומטר מניות) 1.00 µL
    הפוך פריימר (10 מיקרומטר מניות) 1.00 µL
    dNTPs (10 מיקרומטר מניות) 1.00 µL
    מאגר (+ MgCl2) (10 x מניות) 5.00 µL
    . אנזימים (5 מניות U/µL) 0.25 µL
    µL במים סטריליים 40.75
  5. השתמש בתוכנית הבאה של הצנטרפוגה תרמי: 1 מחזור ב 95 מעלות צלזיוס במשך 5 דקות ואז להמשיך עם 95 ° C ל 30 s, 58 ° C ל 30 s, ו- 72 מעלות צלזיוס ל 30 s 34 מחזורים עבור SB100X, 32 מחזורים עבור rtTA2s-M2 , ומחזורי 25 עבור GAPDH.
  6. הכנת ג'ל agarose 1%. להמיס 1g של agarose ב- 100 מ של TBE 1 x (10 x מניות מדולל במים סטריליים), גביע או את הבקבוק. ממיסים במיקרוגל, מתערבל בכל דקה עד agarose זה התפרקה לחלוטין. מגניב של agarose נמס עד שהוא מגיע כ 50 ° C, ולאחר מכן להוסיף 5 µL של אתידיום ברומיד (10 mg/mL במלאי). יוצקים agarose נמס במגש ג'ל התאספו עם מסרק, לליהוק ג'ל.
  7. טען דוגמאות (10 µL כל אחד) על הג'ל agarose ולבצע אלקטרופורזה.
  8. במידת הצורך, לרכוש ג'ל התמונה ולבצע ניתוח densitometric על הלהקות PCR.

7. כמותיים RT-PCR (לרביעיית-PCR)

הערה: מערכת זיהוי רצף מסחרי הוא מועסק. תחל PCR ו- 6-carboxyfluorescein (FAM) רגש גליצראלדהיד 3-פוספט דהידרוגנאז (GAPDH) נרכשים באופן מסחרי.

  1. ראו רטרו-שעתוק, שלב 6.2.
  2. השתמש בתוכנה כדי לעצב תחל ולאחר בדיקה ספציפית עבור SB100X.
    עיצוב המוצע:
    SB.2 להעביר פריימר: 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 הפוכה פריימר: 5'-CCCCATGTGCAGTTGCAA-3'
    בדיקה SB FAM: 5'-CATAAGAAAGCCAGACTACGG-3'
  3. לבצע PCR בזמן אמת ב- 96-ובכן צלחות עם שילוב PCR מאסטר ומערבבים תחל + רגש, באמצעי אחסון התגובה האחרונה של 25 µL. בפרט, שקול את התגובה הבאה עבור כל טוב:
    cDNA (1:10 דילול במים סטריליים) 1.00 µL
    2 x מיקס מאסטר 12.50 µL
    צבעי יסוד + 20 x רגש לערבב 1.25 µL
    µL במים סטריליים 10.25
    הערה: לבצע תגובות כל דולר. כדי למנוע שגיאות pipetting, להכין תערובת לפחות n + 3 תגובות (ללא cDNA). Aliquot באמצעות פיפטה רב-ערוצי.
  4. הפעל PCR בזמן אמת באמצעות התוכנית הבאה: 1 מחזור ב 95 מעלות צלזיוס במשך 10 דקות, ואז 40 מחזורי 95 ° C עבור 15 s ו- 60 ° C 1 דקות, להחזיק על 4 מעלות צלזיוס.
  5. ניתוח נתונים לרביעיית-PCR על ידי נרמול הביטוי יחסי (ערך RQ) SB100X לרמה של GAPDH של המדגם cDNA אותו על ידי 2ΔΔCT כימות, באמצעות תוכנה לניתוח נתונים טיפוסי.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

שימוש בהליך המובאים כאן, שלושה וקטורים IDLV נושאת את הרכיבים SB מוסדר (SB100X, rtTA2S-transposon M2 ו- T2-GFP) היו באריזה, נהגה לספק ביעילות, בחוזקה לווסת את המערכת SB בתאים אנושיים. איור 1A מציג ערכה עבור במבחנה התמרה חושית של הלה תאים, אשר נערך כדי להעריך את התקנון תעתיק של SB transposase עם השילוב הטוב ביותר במינון של שני וקטורים IDLV (דיווח בטבלה מס ' 2). התקנון תעתיק של SB100X היה נמדדת לרביעיית-PCR (איור 1B), התווה ערך הכמות היחסית (RQ) ביחס המדינה הנחה (RQ לבד IDLVTKSB = 1). בתאים הלה transduced, הושג 8-fold הפעלה (+ dox) SB100X הביטוי ברקע (IDLVTKSB). ראוי לציין, cotransduced תאים הלה בהיעדר dox הראה transposase ביטוי דומה לארצות הברית כבוי, המציין שליטה חזקה מאוד של יזם TetTK מאת rtTA2s-אפנן M2.

Figure 1
איור 1: התמרה חושית של הלה תאים עבור הביטוי של SB מוסדר transcriptionally transposase נישא על ידי וקטורים IDLV. (א) ערכה עבור במבחנה התמרה חושית של הלה תאים עם IDLVs עבור הביטוי של transposase. (B) ניתוח לרביעיית-PCR של הלה תאים transduced עם IDLVTKSB (2,600 ng של p24) נוכחות (+) או היעדר IDLVrtTA2 (-)S-M2 (9,600 ng של p24) ו דוקסיציקלין 1 מיקרומטר (dox). הקו המקווקו מתחבר דגימות מציג ערכים שונים משמעותית (* * * P < 0.005). הניסוי בוצע דולר. זאת אומרת S.E.M הוא כמוצג קווי שגיאה. (דמות שונה Cocchiarella, פ. et al., 201618). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

לדוגמה, איור 2 מציג את המינון החל ניסוי להגדיר להגיע ברגולציה תעתיק אופטימלית של transposase. הלה התאים היו transduced עם הגדלת מינון (130, 260 ו- 2,600 ng של p24) של IDLVTKSB בשילוב עם IDLVrtTA2s-M2 (960 ו- 9,600 ng של p24), נוכחות או העדר dox. ניתוח ה-RT-PCR כמותי למחצה מראה בבירור כי מינונים גבוהים של שני IDLVs נדרשו לזירוז חריפה SB100X הביטוי. סוג התא יעד שונות ווריאציות ב טיטור וקטור ויראלי עלולה לגרום בביטוי SB סופ-אופטימלית, לכן אנו ממליצים על ביצוע ניסויים קביעת המינון.

Figure 2
איור 2: IDLV במינון הגדרת הניסוי בתאים הלה כדי להגדיר השילוב במינון אופטימלי שני IDLVs. ניתוח RT-PCR כמותי למחצה על תאים הלה transduced משותפת עם מינונים שונים של וקטור IDLVTKSB (130, 260 ו- 2,600 ng של p24) היעדרות או נוכחות של IDLVrtTA2s-M2 וקטור (ng 960 ו- 9,600 של p24) ו dox. GAPDH היה מוגבר כפקד סטנדרטי. SB100X transposase ו- rtTA2s-M2 ביטוי מדווחים בכל תנאי שנבדקו; NC = שליטה שלילי. (דמות שונה Cocchiarella, פ. et al., 201618). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

במערכת SB מוסדר תעתיק יכול לשמש גם בתאים הראשי, בפרט באותם תאים עמידים בפני מספר שיטות תרביות תאים, כגון keratinocytes העיקרי אנושי. איור 3 מראה ערכה עבור התמרה חושית של ראשי keratinocytes מעובדות על אולם מוקרן 3T3-J2 מזין שכבה, עם IDLV וקטורים סוחבת את הרכיבים SB מוסדר, נוכחות או היעדרות של dox לזירוז ביטוי SB100X.

Figure 3
איור 3: התמרה חושית ההשעיה של האנושי keratinocytes ראשי עם IDLV את המומנט עבור הביטוי של מוסדר transcriptionally SB transposase, transposon. ערכה עבור במבחנה התמרה חושית של האדם keratinocytes ראשי עם IDLVs להביע מוסדר transcriptionally SB transposase, transposon, נוכחות או היעדרות של 1 מיקרומטר dox. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

במסגרת הניתוח לרביעיית-PCR איור 4A מראה כי הטוב ביותר מנה שילוב של transposase, אפנן וקטורים, דיווח בטבלה מס ' 2, גרמו 15-fold ההפעלה של SB ביטוי על המדינה לך (-dox). הניסוי טרנספוזיציה בוצעה ב keratinocytes transduced עם שלושת הווקטורים IDLV (IDLVTKSB, IDLVrtTA2s-M2 ו- IDLVT2), נוכחות או היעדרות של dox. הביטוי של גוי (GFP) שהגעתי מאת T2-transposon, בתוך התא APC , נמדדה על ידי זרימת cytometer ניתוח 2 ימים שלאחר התמרה חושית (dpt), את endopoint של התרבות (5 ימים עבור keratinocytes העיקרי אנושי). נקודת הקצה הגיעו כאשר משולבות transposon T2-GFP ירד לרמה בקושי לזיהוי (ממוצע של 0.6%) עקב דילול תלויי-חלוקת התא. איור 4B מציג את היחס בין האחוז של GFP+ תאים בתוך התא APC קצה, 2 ימים פוסט התמרה חושית, מנורמל לרמת שיורית transposon לבד. מציין את אחוז תאי אירוח עותק אחד לפחות של ממשלת ישראל ביטוי משולב stably הגנום שלהם, מוערך ב- 12% עבור keratinocytes העיקרי אנושי.

Figure 4
איור 4: ניתוח של הביטוי של transposase ו- GFP ב transduced האנושי keratinocytes העיקרי. (א) assay לרביעיית-PCR על ראשי keratinocytes transduced עם IDLVTKSB ו IDLVrtTA2S-M2 על נוכחות או היעדרות של 1 מיקרומטר dox. (B) התמרה חושית משותפת של ראשי keratinocytes עם IDLVT2 transposon, IDLVs להבעה transposase נוכחות או היעדרות של dox. על ציר-y % GFP+ תאים 5dpt / % GFP+ תאים 2 dpt * 100 (אומר ± SEM של שני ניסויים). * * מציגים ערכים שונה באופן משמעותי (P < 0.05). (דמות שונה Cocchiarella, פ. et al., 201618). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

פלסמיד תיאור הפניות
pCCL-TetOTKSB העברת פלסמיד המשמש ליצירת IDLVTKSB וקטורית. פלסמיד הזה נגזר pTetOTKSB, לאחר שיבוט TetOTKSB של עמוד השדרה lentiviral pCCL. 18, 20
pCCL-PGKrtTA2S-M2 העברת פלסמיד המשמש ליצירת IDLVrtTA2s-M2 וקטור. המסופקים על ידי פרופסור (פ') Zappavigna
pCCL-T2GFP העברת פלסמיד המשמש ליצירת IDLVT2 וקטורית. פלסמיד הזה נגזר pT2GFP, לאחר שיבוט של GFP בין ההכנסה T2-transposon של עמוד השדרה lentiviral pCCL. 18, 20
pMD.Lg/pRRE.D64VInt אריזה פלסמיד ליצירת IDLV וקטורית. 19
pMD2.G פלסמיד קידוד עבור המעטפה VSV-G לייצר וקטור lentiviral. 20
pRSV-Rev פלסמיד Rev ליצירת וקטור lentiviral. 20
וקטור תיאור
IDLVTKSB שילוב וקטור lentiviral פגומים לביטוי SB100X תחת השליטה של יזם TK ט מגיב.
IDLVrtTA2s-M2 וקטור lentiviral פגומים אינטגרציה עבור הביטוי של rtTA2s-אפנן M2 תחת השליטה של יזם PGK.
IDLVT2 וקטור lentiviral פגומים אינטגרציה עבור הביטוי של ממשלת ישראל משובטים בין ההכנסה T2-transposon.

טבלה 1: פלסמידים ווקטורים הכלולה בפרוטוקול זה. תיאור והפניות הינם מסופקים.

וקטורים הלה (2 x 105 תאים) Keratinocytes (1.6x105 תאים)
IDLVTKSB 2,600 ng p24 13,000 ng p24
IDLVrtTA2s-M2 9,600 ng p24 48,000 ng p24
IDLVT2 9,160 ng p24

טבלה 2: מנות וקטור ממוטב עבור התמרה חושית של תאים הלה keratinocytes העיקרי אנושי.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כאן, אנו מתארים מתודולוגיה נגישים נרחב stably שילוב של גוי לתוך הגנום של התאים היעד על ידי היפהפייה הנרדמת-מתווכת טרנספוזיציה. למרות שהמערכת SB פותחה כדי לספק שיטה nonviral לעריכה הגנום, העברה יעילה של מכונות אינטגרציה (transposase ו- T2 transposon) הוא חובה. לכן, להשתמש במערכת SB בתאי ראשי בקושי transfectable, משלוח ויראלי של רכיבים SB היה נרדף בשנים האחרונות10,12,15. עם זאת, אף אחד הווקטורים ויראלי מועסק עד עכשיו התייחס לסוגיית ביטוי המכונן של transposase אשר עלולה לגרום הסיכון rehopping בלתי נשלט של transposon.

Transcriptionally לווסת את הביטוי transposase, אנחנו ניצלו ששונה ט-על מערכת16. האמרגן TK מינימלי התמזגו לרכיב TetO, על קשירה rtTA2s-אפנן M2 בנוכחות dox, שהוענקו כוונון של הפעלת transposase ברקע (הנחה-המדינה, בהיעדר dox). ההופעה התקינה תלויה IDLVs המתאים (IDLVTKSB ו- IDLVrtTA2s-M2) וקטור שילוב מינון על סוגי תאים (למשל, הלה תאים ואנושי keratinocytes הראשי). באופן עצמאי מתאי המטרה, המינון וקטור חייבות להבטיח את הרמה הגבוהה ביותר של התמרה חושית של תאי היעד מבלי להשפיע על יכולת הקיום תא, ולכן מנה-שילוב המחריף ניסוי הלה תאים (או שורות תאים אחרים) להגדרת במינונים אופטימליים, על-ידי RT-PCR כמותי למחצה, הוא הציע בתוקף.

טרנספוזיציה של ממשלת ישראל נאמד בתאים הראשי. האדם keratinocytes העיקרי נזרע בשכבה מזין לקרינה אולם 3T3-J2 היו transduced עם 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 ו- IDLVT2) במינון השפעול מוגדרים. הפעלה של ברור dox תלוית של transposase הודגם על ידי לרביעיית-PCR. יתר על כן, שילוב יציב של ממשלת ישראל הודגם על ידי ניתוח cytofluorimetric של הביטוי GFP בתאים transduced של נוכחות או היעדרות של dox, המציין את האפשרות להעסיק. את הפלטפורמה IDLV לרכב SB transcriptionally מוסדרים רכיבי התאים הראשי ולאחר האינטגרציה המוצלחת של גוי לתוך הגנום של תאי היעד.

השלבים הקריטיים בפרוטוקול IDLV וקטור הייצור הינם התמרה חושית של התאים היעד יעילות מיטבית, שילוב מינון וקטור. יעילות נמוכה תרביות תאים של תאי HEK293T עלול לגרום תשואה נמוכה וקטור. ההגדרה של מינונים של IDLVTKSB ו- IDLVrtTA2s-M2 יש צורך להימנע איזון של ט-על רכיבים שעלולים לגרום leakiness גבוהה בהעדר אפנן או קיפול נמוך אינדוקציה של האמרגן TetOTK על טיפול dox. השלבים הקריטיים יכול להתבצע על ידי שינויים מזעריים. למשל, פרוטוקול תרביות תאים יכול להיות מוגדר באמצעות תקנים מסחרי ריאגנטים. פרוטוקול התמרה חושית צריך להיות מותאם על פי סוג התא של עניין, במיוחד בהתחשב אם spinoculation מגדילה את היעילות התמרה חושית מבלי להשפיע על התאים הכדאיות. וקטורים ו polybrene יכול להיות נוספו המדיום התרבות של תאי היעד והוחלף בינוני טריים לאחר דגירה 6 שעות או לילה. זה גם ראוי לציין כי אחוז GFP+ תאים 5 ימים אחרי התמרה חושית יכולה להיות מושפעת ברקע קליטת IDLVs.

מגבלה מינור של שיטה זו הוא כי הווקטורים IDLV מיוצרים transiently על ידי תרביות תאים של תאי HEK293T. בהתאם וקטור מינונים לשמש, חזר על וקטור הפקות נדרשים. מגבלה נוספת קשורה האורך של ממשלת ישראל, כמו קיבולת מטען של וקטור IDLV הוא כ 8 kb.

לסיכום, שיטה זו כאן מאפשרת השילוב של גוי transcriptionally מוסדרים לרכיבים SB הארוזים לתוך IDLV וקטורים, אשר, בין השיטות הקיימות כדי לספק מערכת SB, להציג מגוון רחב של tropism ויעילות גבוהה התמרה חושית. יתר על כן, המערכת ט-אן ששונה היתרי תקנה תעתיק של הביטוי SB100X, נושא רלוונטי את הסיכון transposon מחדש מקפץ או בכל אירועי טרנספוזיציה טורי מרובים אם הן נדרשות. יישומים אפשריים של שיטה זו כוללים הנדסה הגנום של שורות תאים (למשל, תאים הלה, תאים HEK293) כדי ליצור אריזות יציב תאים עבור וקטורים ויראלי, וכן על שילוב של גנים טיפוליים לתאים ראשי הרלוונטית קלינית.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

אנו מודים פרופסור Zappavigna, אוניברסיטת מודנה, רג'יו אמיליה, שוויץ סיפק לנו pCCL-PGKrtTA2S-M2 פלסמיד. אנו גם להכיר פרופ Ivics צ (פול Ehlrich המכון, Langen, גרמניה), פרופסור צ Izvak (Max Delbruck מרכז לרפואה מולקולרית, ברלין, גרמניה) עבור pCMVSB100X ו pT2/BH פלסמידים. עבודה זו נתמכה על ידי דברה בינלאומי ומשרד איטלקית של אוניברסיטת ומחקר.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics