En effektiv In Vitro införlivande metod av en Transcriptionally reglerade Sleeping Beauty System paketeras i en Integration defekta Lentiviral Vector

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Det här protokollet beskriver en metod för att uppnå stabil integrering av en gen av intresse i det mänskliga genomet av systemet för transcriptionally reglerade Törnrosa . Beredning av integrationen av defekta lentiviral vektorer, den in vitro- transduktion av mänskliga celler och molekylära analysen på sensorik celler redovisas.

Cite this Article

Copy Citation | Download Citations

Benati, D., Cocchiarella, F., Recchia, A. An Efficient In Vitro Transposition Method by a Transcriptionally Regulated Sleeping Beauty System Packaged into an Integration Defective Lentiviral Vector. J. Vis. Exp. (131), e56742, doi:10.3791/56742 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den Törnrosa (SB) transposon är en icke-virala integrerande system med bevisad effekt för genöverföring och funktionsgenomik. För att optimera SB transposon maskiner, är en transcriptionally reglerade hyperaktiv transposase (SB100X) och T2-baserade transposon anställda. Vanligtvis transposase och transposon tillhandahålls normalnivå av Plasmiden transfection och SB100X uttryck är driven av en konstitutiva promotorn. Här beskriver vi en effektiv metod för att leverera SB komponenterna till mänskliga celler som är resistenta mot flera fysiska och kemiska transfection metoder, att styra SB100X uttryck och stabilt integrera en gen av intresse (GOI) genom en ”klippa och klistra” SB mekanismen. Uttrycket av hyperaktiva transposase styrs hårt av Tet-på systemet, ofta används för att styra genuttrycket sedan 1992. Gen av intresse flankeras av inverterad repetitioner (IR) av den T2 transposon. Båda SB komponenter förpackas i integration defekta lentiviral vektorer normalnivå produceras i HEK293T celler. Mänskliga celler, antingen cellinjer eller primära celler från mänsklig vävnad, är in vitro- normalnivå sensorik med virala vektorer. Vid tillägg av doxycyklin (dox, tetracyklin analoga) i odlingsmediet, en finjustering av transposase uttryck mäts och resulterar i en varaktig integration av genen sevärdheter i genomet hos de behandlade cellerna. Denna metod är effektiv och tillämplig på cellinje (t.ex. HeLa cells) och primära celler (t.ex. människans primära keratinocyter), och utgör därmed ett värdefullt verktyg för genteknik och terapeutiska genöverföring.

Introduction

Den hyperaktiva SB100X transposase kopplat till den T2-baserade transposon har redan använts i prekliniska gen terapi program1,2,3, genomet ändringar4,5, och inducerade pluripotenta stamceller (iPSC) omprogrammering6,7. Vanligtvis, SB komponenter tillhandahålls normalnivå av Plasmiden transfection och en stark konstitutiva promotorn driver ett uttryck för transposase. Men trots de förbättrade nya metoderna för transfection fortfarande leverans av de två-komponent systemet en utmaning för många tillämpningar. Således har utvecklingen av ett nytt protokoll som leverans ökat intresse. Förutom transfection metoder för plasmid8 och mRNA9, viral leverans baserat på adenovirala10,11, adeno-associerade viral (AAV)12, baculoviridae13, gammaretroviral14 och lentiviral vektorer15 har föreslagits tidigare. Noterbart är måste systemet med val garantera en övergående leverans av SB komponenter utan integration av den virala vektorn. Det konstitutiva uttrycket av transposase väcker ändå, säkerhetsproblem på grund av okontrollerbar rehopping av transposon.

Transkriptionsreglering av SB100X av ett raffinerat Tet-ON system är därför den första utmaningen. En modifierad Tet-lyhörd promotorn, erhålls genom att ersätta den ursprungliga utvecklade minimal cytomegalovirus (CMV) arrangören med minimal promotorn (-81) av Timidine Kinase (TK) genen av Herpes Simplex Virus-1 (HSV-1)16, klonas uppströms den SB100X cDNA (pTetOTKSB100X). Den muterade omvänd-tetracyklin-transactivator rtTA2s-M217 uttrycks under kontroll av stark konstitutiva promotorn (phosphoglycerate promotorn, PGK) klonade i en olika plasmid (pCCL-PGKrtTA2S-M2). När du lagt till odlingsmediet, dox binder den rtTA2s-M2 modulator och tethers Tet promotorn komplexa eller, resulterande i hårt reglerade induktion av SB100X uttryck18.

Den andra stora utmaningen uppstår från den ineffektiva transfection mänskliga primära celler med flera fysiska och kemiska metoder. Att effektivt leverera transposase i mänskliga celler tål transfection, SB100X och den rtTA2s-M2 uttryck kassetter är förpackade i två integration defekta lentiviral vektorer (IDLVs)19: IDLVTKSB och IDLVrtTA2s- M2. Virala vektorer produceras normalnivå som tredje generation vektorer i HEK293T celler20 och pseudotyped med glykoprotein G av vesikulär stomatit viruset (VSV-G), som ger ett brett spektrum av infektion. Vector partiklar koncentreras genom ultracentrifugering och titreras av HIV-1 Gag p24 immunocapture. För att transduce cellinjer och primära celler, vektor partiklar är komplex med polybrene och inkuberas med målceller i närvaro eller frånvaro av dox. Narkotikaberoende aktivering av SB100X uttryck i sensorik celler mäts genom kvantitativ RT-PCR (qRT-PCR)18.

När Tet-reglerade SB100X uttryck är visat, följer införlivandet av Indiens myndigheter (t.ex. grönt fluorescerande protein, GFP) i målet cellen genomet de molekylära händelser tydligt schematized av Bak och Mikkelsen21. En tredje IDLV vector bär ett uttryck kassett för Indiens klonade mellan T2-transposon IRs (IDLVT2) måste vara konstruerade och förpackade som nämnts ovan. Slutligen kan tre IDLV vektorer användas för att effektivt transduce mänskliga celler (t.ex. primära keratinocyter) in vitro- och integrera de indiska myndigheterna i närvaro av doxycyklin18.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. plasmider som anställd

Obs: Plasmiden pCCL-PGKrtTA2S-M2 var vänligt tillhandahålls av Prof. Zappavigna (universitetar av Modena och Reggio Emilia, Modena, Italien). Den pCMVSB100X plasmiden bär den kodande sekvensen av hyperaktiva transposase och pT2/BH transposon plasmid var vänligen tillhandahållen av Prof Z. Ivics (Paul Ehrlich Institute, Langen, Tyskland) och Prof. Z. Izvak (Max Delbrück Center för molekylärmedicin, Berlin, Tyskland).

  1. För alla kloning i Escherichia Coli (E. coli), följa strategin kloning av val och restriktionsenzym förfarande eller PCR-amplifiering av fragmentet att klonas.
    Obs: Tabell 1 sammanfattar alla av plasmidsna anställd i detta protokoll. En beskrivning och referenser för varje plasmid tillhandahålls.

2. viral vektor produktion

Obs: Alla de virala vektorerna produceras i en biohazard huva på BSL2 biosäkerhet inneslutningsnivå enligt institutionella regler och föreskrifter.

  1. Kultur vidhäftande HEK293T celler i Dulbeccos modifierade Eagle Medium kompletteras med 10% HyClone serum, 100 U/mL penicillin-streptomycin och 2 mM glutamin.
  2. Dag 0: Förbereda fem 15 cm tallrikar/viral förberedelse och utsäde 5.5x106 celler i 30 mL av medium.
  3. Dag 1: Transfection
    1. Innan du börjar transfection, bereda 100 mL 2 x HEPES buffert koksaltlösning (HBS):
      NaCl (5 M) 5,6 mL
      HEPES (1 M) 10,0 mL
      Na2HPO4 (0,5 M) 0,3 mL
      Sterilt vatten 84,1 mL
      Justera till pH 7.1 med 37% HCl.
      Obs: 2 x HBS kan lagras vid 4 ° C. En exakt pH är oerhört viktigt för effektiv transfection. Optimalt pH är 7.10 till 7.12.
    2. Ta bort medium och lägga till 22,5 mL/tallrik färska medium 4 h innan transfection.
    3. Transfect HEK293T celler med överföring plasmiden, pMD.Lg/pRRE.D64VInt förpackning plasmiden, pMD2.G kuvert-encoding plasmiden och pRSV-Rev (tabell 1) enligt följande belopp/plattan:
      överföra plasmid 25,00 µg
      pMD.Lg/pRRE.D64VInt 16,25 µg
      pMD2.G 8,75 µg
      pRSV-Rev 6,25 µg
      Obs: Kontrollplasmid-DNA är upprättad enligt protokollet CsCl beskrivs Maniatis22 eller genom att använda ett endotoxinfria plasmid rening kit.
      1. Omsuspendera 56.25 µg av DNA (mix av 4 plasmider) i 1,125 mL sterilt vatten och tillsätt 125 µL av 2,5 M CaCl2 (lösning A).
      2. Tillsätt 1.250 mL 2 x HBS till en steril 15 mL koniskt centrifugrör (lösning B).
      3. Lägga till lösning en (1.250 mL) till B (1.250 mL) droppvis medan bubblande med 1 eller 2 mL pipett (transfection lösning, totala volym 2.500 mL).
      4. Inkubera i 20 min i rumstemperatur (RT).
      5. Använder en P1000 mikropipett, distribuera all transfection lösning (2.500 mL) till den cell enskiktslager droppvis.
    4. Inkubera över natten i en cell kultur inkubator vid 37 ° C, 5% CO2.
  4. Dag 2: Ta bort mediet och tillsätt 15 mL färsk medium (se steg 2.1).
  5. Dag 3: Samla och koncentrera lentiviral partikel-innehållande supernatanten.
    1. Samla in supernatanten (~ 70 mL) från alla (n = 5) transfekterade cell plattor, filtrera genom ett 0,45 µm Arbetsförmedlingarna filtrera och fyller 2 polyallomer rör (1-tum x 3,5 tum) / viral förberedelse.
    2. Koncentrera sig vektor partiklarna av ultracentrifugering vid 106.000 x g för 2,5 h, vid 15 ° C med broms.
    3. Omedelbart efter avslutad den ultracentrifugering (för att undvika resuspension av pelleten i röret), försiktigt Häll supernatanten i en behållare som innehåller 10% blekmedel och suspendera 2 knappt synlig pellets i 100 µL av 1 x PBS (+ 1% BSA). Detta är normalt eftersom pelleten är tydlig och mycket små. Använd koncentrerad vektorn nylagad eller alikvotens och lagra viral preparat vid-80 ° C.
      Försiktighet: Supernatanten innehåller lentiviral partiklar som måste blekas grundligt innan kasta i det biologiskt avfallet.
  6. För att titrera virala vektorn beredning, Använd en HIV-1 Gag p24 immunocapture kit enligt tillverkarens protokollet.
    Obs: För att standardisera virala vektorn produktion, liposomer-baserade reagenser kunde anställas. Virala vektorn titern är dock starkt beroende av transfection effektivitet och renhet av Plasmiden DNA.

3. transduktion mänskliga cellinjer (t.ex. HeLa cells)

Obs: HeLa celler odlas i Dulbeccos modifierade örnens medium kompletteras med 10% fetalt kalvserum, 100 U/mL penicillin-streptomycin och 2 mM glutamin. Tabell 1 sammanfattar alla de vektorer som anställd i detta protokoll. En beskrivning för varje vektor finns. Transduktion av HeLa cells tillåter kontroll av transkriptionell reglering av SB transposase i den bästa kombinationen av de två IDLV vektorerna. Variationen i IDLV doser kan vara relaterade till vektor partikel titrering och cell måltypen.

  1. Dag 0: Frö 2 x 105 celler i 3 mL medium för varje brunn 6-bra platta. Förbered 4 brunnar.
  2. Dag 1: Transduktion av HeLa cells.
    1. För varje villkor, späd lentiviral vektorer till en slutlig volym av 1 mL medium (se not ovan) i närvaro av 10 μL av polybrene (slutlig koncentration 8 μg/mL):
      Utspädning för väl #1: håna sensorik celler (negativ kontroll).
      Utspädning för väl #2: IDLVTKSB vektor (2 600 ng av p24).
      Utspädning för brunnar #3, #4: IDLVTKSB vektor (2 600 ng av p24) + IDLVrtTA2s-M2 vektor (9 600 ng av p24).
    2. Ta bort mediet från varje brunn där HeLa cells var klädd på dag 0 och Lägg till lentiviral vector utspädningar motsvarande väl.
    3. Spinoculate 6-väl plattan vid 754 x g i 45 min på 20-25 ° C och överför sedan 6-väl plattan till en cell kultur inkubator vid 37 ° C och 5% CO2.
    4. Efter 6 h, ersätta de medium som innehåller vektorerna med färska medium i alla brunnar och Lägg till doxycyklin 1 μM i väl #4. Placera plattan i en cell kultur inkubator vid 37 ° C för 48 h.
  3. Dag 3: Beredning av cellpelleten för RNA-extraktion.
    1. Innan du lossar celler, Förbered en trypsin fungerande lösning (1 x):
      2,5% trypsin (10 x) 5,0 mL
      500 mM EDTA (slutlig koncentration = 5 mM) 0,5 mL
      1 x PBS 44,5 mL
    2. Varma trypsin fungerande lösning vid 37 ° C före användning. Lagra trypsin fungerande lösning vid 4 ° C.
    3. Ta bort medium och tvätta cellerna med 1 x PBS. Tillsätt 0,5 mL av pre värmde 37 ° C trypsin fungerande lösning till varje brunn och inkubera vid 37 ° C i 7 min (i en cell kultur inkubator).
    4. Efter inkubering, tillsätt 0,5 mL serum-innehållande medellång till varje brunn för att inaktivera trypsin och samla celler i ett centrifugrör. Skölj väl en gång med 3 mL 1 x PBS och centrifugera cellsuspensionen för 5 min vid 240 x g.
    5. Tvätta cellerna med 5 mL 1 x PBS, Centrifugera under 5 minuter vid 240 x g och Kassera supernatanten. Nyligen uppsamlat cell pellets eller förvara vid-80 ° C. Extrahera total-RNA från pellets till utföra semi kvantitativ RT-PCR (se steg 6).

4. transduktion mänskliga primära celler (t.ex. keratinocyter)

Obs: Människans primära keratinocyter är seedade på dödligt bestrålade 3T3-J2 celler (feeder layer)23, en slags gåva från Yan Barrandon (EPFL, Lausanne, Schweiz).

  1. Odla schweiziska mus 3T3-J2 cellerna i Dulbeccos modifierade Eagle Medium kompletteras med 10% givare bovint serum, 50 U/mL penicillin-streptomycin och 4 mM glutamin (3T3 medium).
  2. Växa keratinocyter pläterade på dödligt bestrålade 3T3-J2 celler i cFAD medium, en Dulbeccos modifierade Eagle Medium och Hams F12 media blandning (3:1) som innehåller fetalt bovint serum (10%), penicillin-streptomycin (1%), glutamin (2%) och insulin (5 µg/mL), () adenin 0,18 mM), hydrokortison (0,4 µg/mL), kolera toxin (0,1 nM), och trijodtyronin (2 nM).
  3. Dag 0: Seed 3 x 105 dödligt bestrålade 3T3-J2 celler, tidigare utspädd i 3T3 medium till en slutlig koncentration på 1 X 105 celler/mL, i varje brunn 6-väl plåt. Förbereda 9 brunnar.
  4. Dag 1: Transduktion av primära keratinocyter
    Obs: Transduktion av keratinocyter tillåter kvantifiering av transkriptionell reglering av SB transposase i den bästa kombinationen av de två IDLV vektorerna (av qRT-PCR) och kontrollera integrationen av Indiens myndigheter (GFP) i målcellerna (av cytofluorimetric analys).
    1. Innan du lossar celler, förbereda trypsin arbetslösning:
      0,5% trypsin-EDTA (10 x) 5,0 mL
      500mM EDTA (slutlig koncentration = 5 mM) 0,5 mL
      1 x PBS 44,5 mL
    2. Varma trypsin fungerande lösning vid 37 ° C före användning. Lagra trypsin fungerande lösning vid 4 ° C.
    3. För att lossa subconfluent keratinocyter i kultur, ta bort medium, tvätta cellerna med 1 x PBS och tillsätt 1 mL av pre värmde trypsin fungerande lösning till varje brunn. Inkubera vid 37 ° C i 15 min i cell kultur inkubatorn.
    4. Efter inkubering, Omsuspendera cellerna i en brunn grundligt och överföra cellsuspensionen till ett centrifugrör innehållande 2 mL serum-innehållande medium (om många celler är fortfarande kopplade, Inkubera under en ytterligare minuter vid 37 ° C). Skölj väl en gång med 3 mL 1 x PBS eller färskt medium och Lägg till skölj lösningen centrifugalröret med cellsuspensionen.
    5. Centrifugera under 5 min vid 580 x g och kasta bort supernatanten.
    6. Tvätta cellerna med 5 mL 1 x PBS, Centrifugera under 5 minuter vid 580 x g och Kassera supernatanten.
    7. I en 15 mL polypropylen rör, späd 1.6x105 keratinocyter i 1 mL cFAD medium, en spädning för varje villkor.
    8. Späd lentiviral vektorer i 1 mL cFAD medium i närvaro av 20 μL av polybrene (slutliga koncentration av 8 µg/mL vid en slutlig volym av 2 mL):
      Spädningar för brunnar #1, #2, #3: håna sensorik celler (negativ kontroll utan vektorer).
      Spädningar för brunnar #4, #5: IDLVTKSB vektor (13.000 ng av p24) + IDLVrtTA2s-M2 vektor (48.000 ng av p24).
      Spädningar för brunnar #6, #7, #8, #9: IDLVTKSB vektor (13.000 ng av p24) + IDLVrtTA2s-M2 vektor (48.000 ng av p24) + IDLVT2 vektor (9,160 ng av p24).
    9. Transduce celler i suspension genom att lägga till varje lentiviral vector utspädning (1 mL) till den motsvarande keratinocyter suspensionen (1.6x105 keratinocyter i 1 mL).
    10. Ta bort mediet från dödligt bestrålade 3T3-J2 celler seedade på dag 0 och plattan sensorik keratinocyter (1.6x105 keratinocyter i 2 mL) på dem. Efter transducing en väl fortsätta med nästa.
    11. Inkubera vid 25 ° C i 30 min och sedan överföra cellerna till 37 ° C i cell kultur inkubator för 6 h.
      Obs: Använd inte spinoculate primära keratinocyter, livskraft och spridning kommer att påverkas starkt.
    12. Efter 6 h, tillsätt 1 mL cFAD medium till varje brunn. Lägg till 1 μM doxycyklin (slutlig koncentration) i brunnar #5, #8 och #9. Återgå celler till 37 ° C.
  5. Dag 2: Ersätt cFAD medium med 3 mL KC medium med 10 ng/mL EGF.
  6. Dag 3: Trypsinize och tvätta cellerna från wells #1, #4 och #5 som beskrivs tidigare (se 4.4.1 till 4.4.6). Frysa cell pellets vid-80 ° C att extrahera total-RNA för qRT-PCR-analys (se steg 7).
  7. Trypsinize celler från väl #2, #6 och #8 som beskrivs i steg 4.4.1 till 4.4.5 och utföra cytofluorimetric analys för god Jordbrukarsed uttryck (se steg 5).
  8. Förvara odlingen från brunnar #3, #7 och #9 för minst 3-4 dubbleringar, tillräckligt för att späda ut un-integrerad IDLVT2 vektor (5 dagar för människans primära keratinocyter pläterade på mataren lager).
  9. Dag 6: Cirka 5 dagar post transduktion, trypsinize celler (se stegen 4.4.1 till 4.4.5) från wells #3, #7 och #9 att utföra cytofluorimetric analys för god Jordbrukarsed uttryck (se steg 5).
    Obs: Experiment timing och transduktion effektivitet är mycket influerad av primära celltyp och variabilityen av insamlade prover.

5. Cytofluorimetric analys på sensorik primära keratinocyter

Obs: En flödescytometer konfigurerats med en blå laser (488 nm), en röd laser (633 nm) och filter för detektion av god Jordbrukarsed och APC fluorescens är anställd (se Material tabell).

  1. För att diskriminera keratinocyter från 3T3-J2 feeder lager, etikett sensorik keratinocyter fristående på dag 3 och dag 6 (se stegen 4,7 och 4.9) med mus monoklonal APC-konjugerad anti Feeder antikropp.
    1. Förbered 4 mL färgning buffert för varje prov:
      5% FBS 200 ΜL
      500 mM EDTA (slutlig koncentration = 2,5 mM) 20 μL
      PBS 1 x 3780 μL
    2. Tvätta fristående celler med 1 mL färgning buffert. Centrifugera under 5 min vid 580 x g och kasta bort supernatanten.
    3. I ett rör för flöde flödescytometri förvärv, Omsuspendera 5 x 104 celler i 100 μL av färgning buffert och tillsätt 2 μl anti Feeder antikroppar (1:50). Blanda väl och inkubera i 30 min på is i mörkret.
    4. Efter 30 min, tvätta med 2 mL färgning buffert. Centrifugera under 5 min vid 580 x g och kasta bort supernatanten. Återsuspendera i 200 μL av färgning buffert.
    5. Förvärva APC och god Jordbrukarsed signaler genom cytofluorimetric analys18. GFP+ cell fraktionen av APCcell befolkningen anger sensorik keratinocyter.
      Obs: Om du vill fixa färgas provet innan flödescytometri med 2% PARAFORMALDEHYD i PBS 1 x och förvaras vid 4 ° C i mörker fram till körningen.
  2. Analysera flödesdata flödescytometri av plottning förhållandet mellan andelen GFP+celler vid slutpunkten (5 dagar) och procentandelen av GFP+celler 2 dagar efter transduktion, normaliserade till rester av den IDLVT2-sensorik celler.

6. semi-kvantitativ RT-PCR

Obs: Använd en PCR termocykel.

  1. Extrahera totalt RNA från sensorik eller styra celler som använder en RNA rening kit, enligt tillverkarens protokollet.
    Obs: Total-RNA kan lagras vid-80 ° C.
  2. Syntetisera cDNA i en 20 µL reaktion med 100 ng av total-RNA och ett omvänt transkriptas kit, enligt tillverkarens protokollet.
    Obs: cDNA kan förvaras vid-20 ° C.
  3. Design primers specifika för SB100X, rtTA2s-M2 och GAPDH (en städning genen).
    Föreslagna mönster:
    SB vidarebefordra primer: 5'-GCCACTCAGCAAGGAAGAAG-3'
    SB reverse primer: 5'-GTGTTGGAAGACCCATTTGC-3'
    rtTAM2 vidarebefordra primer: 5'- GACGACAAGGAAACTCGCTC-3'
    rtTAM2 reverse primer: 5'-TTACCCGGGAGCATGTCAA-3'
    GAPDH vidarebefordra primer: 5'-GACCACAGTCCATGCCATCAC-3'
    GAPDH reverse primer: 5'CCACCACCCTGTTGCTGTAG3'
  4. Utför PCR i en slutlig reaktionsvolym 50 µL. I synnerhet montera i varje PCR-rör följande reaktion:
    cDNA (spädningen 1:5) (från steg 6,2) 1.00 µL
    Vidarebefordra primer (10 µM lager) 1.00 µL
    Reverse primer (10 µM lager) 1.00 µL
    dNTP (10 µM lager) 1.00 µL
    Buffert (+ MgCl2) (10 x lager) 5.00 µL
    Taq-polymeras (5 U/µL lager) 0,25 µL
    Sterilt vatten 40,75 µL
  5. Använda programmet följande av termocykel: 1 cykel vid 95 ° C för 5 min sedan fortsätta med 95 ° C i 30 s, 58 ° C i 30 s och 72 ° C under 30 s för 34 cykler för SB100X, 32 cykler för rtTA2s-M2 , och 25 cykler för GAPDH.
  6. Bered 1% agarosgel. Lös upp 1 g av agaros i 100 mL TBE 1 x (10 x lager utspätt i sterilt vatten), i en bägare eller kolv. Smälta i en mikrovågsugn, virvlande varje minut tills Agarens är helt upplöst. Cool smält Agarens tills den når cirka 50 ° C och sedan Tillsätt 5 µL etidiumbromid (10 mg/mL lager). Häll smält agaros i ett fack som monterade gel med en kam, för gel gjutning.
  7. Ladda prover (10 µL varje) på agarosgel och utför elektrofores.
  8. Om du vill förvärva gel bild och utföra Densitometrisk analys på PCR-banden.

7. kvantitativ RT-PCR (qRT-PCR)

Obs: En kommersiell Sequence Detection System är anställd. PCR primers och 6-carboxyfluorescein (FAM) sond glyceraldehyd 3-fosfat dehydrogenas (GAPDH) köps kommersiellt.

  1. Om retro-transkription, se steg 6,2.
  2. Använda programvara för att designa primers och sond specifik för SB100X.
    Föreslagna design:
    SB.2 vidarebefordra primer: 5'-GAAGAAGCCACTGCTCCAAAA-3',
    SB.2 reverse primer: 5'-CCCCATGTGCAGTTGCAA-3'
    sond SB FAM: 5'-CATAAGAAAGCCAGACTACGG-3'
  3. Utföra Real-Time PCR i 96 brunnar med en PCR-Master Mix och primers + sond blanda, i en sista reaktionsvolym 25 µL. I synnerhet beakta följande reaktion för varje brunn:
    cDNA (1:10 utspädning i sterilt vatten) 1.00 µL
    2 x Master Mix 12,50 µL
    Primer + 20 x probe blanda 1,25 µL
    Sterilt vatten 10,25 µL
    Obs: Utför alla reaktioner i tre exemplar. För att förhindra pipettering fel, förbereda en blandning för minst n + 3 reaktioner (utan cDNA). Alikvot med hjälp av en flerkanalspipett.
  4. Kör realtids-PCR använder följande program: 1 cykel vid 95 ° C i 10 min, sedan 40 cykler av 95 ° C för 15 s och 60 ° C i 1 min och håll vid 4 ° C.
  5. Analysera qRT-PCR data genom att normalisera det relativa uttrycket (RQ värde) för SB100X till nivån för GAPDH av samma cDNA prov av 2ΔΔCT kvantifiering, med typiska data analys programvara.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Proceduren presenteras här, tre IDLV vektorer bära de reglera SB-komponenterna (SB100X, rtTA2S-M2 och T2-GFP transposon) var förpackade och används för att effektivt leverera och tätt reglera systemets SB i mänskliga celler. Figur 1A visar ett system för in vitro- transduktion av HeLa celler, som utfördes för att utvärdera transkriptionell reglering av SB transposase med den bästa kombinationen av de två IDLV vektorer (redovisas i tabell 2). Transkriptionell reglering av SB100X var mätt med qRT-PCR (figur 1B) och ritas som en relativ kvantitet (RQ) värde med avseende på off-staten (IDLVTKSB ensam RQ = 1). I sensorik HeLa cells erhölls en 8-faldigt aktivering (+ dox) av SB100X uttryck över bakgrunden (IDLVTKSB). Särskilt, cotransduced HeLa cells i avsaknad av dox visade transposase uttryck jämförbara till off staterna, som anger en sträng kontroll av TetTK arrangören av rtTA2s-M2 modulator.

Figure 1
Figur 1: Transduktion av HeLa celler av uttryck för transcriptionally-reglerade SB transposase av IDLV vektorinsekter. (A) ett system för in vitro- transduktion av HeLa celler med IDLVs av uttryck för transposase. (B) qRT-PCR-analys av HeLa cells sensorik med IDLVTKSB (2 600 ng av p24) i närvaro (+) eller saknas (-) IDLVrtTA2S-M2 (9 600 ng av p24) och 1 µM doxycyklin (dox). Den streckade linjen ansluter prover visar betydligt olika värden (*** P < 0,005). Experimentet utfördes i tre exemplar. Menar S.E.M visas som felstaplar. (Figur modifierad från Cocchiarella, F. et al., 201618). Klicka här för att se en större version av denna siffra.

Som ett exempel, figur 2 visar den dos som allt experiment inrätta för att nå optimal transkriptionell reglering av transposase. HeLa celler var sensorik med ökande doser (130, 260 och 2 600 ng av p24) av IDLVTKSB i kombination med IDLVrtTA2s-M2 (960 och 9.600 ng av p24), i av närvaro eller frånvaro av dox. Semi kvantitativ RT-PCR-analys visar tydligt att höga doser av båda IDLVs var skyldiga att starkt inducerar SB100X uttryck. Olika mål celltyp och variationer i virala vektorn titrering kan resultera i sup-optimal SB uttryck, och vi rekommenderar därför utföra dosering inställningen experiment.

Figure 2
Figur 2: IDLV dos inställningen experiment i HeLa celler att definiera den optimala kombinationen av de två IDLVs. Semikvantitativ RT-PCR-analys på HeLa cells Co sensorik med olika doser av IDLVTKSB vektor (130, 260 och 2 600 ng av p24) i frånvaron eller närvaron av IDLVrtTA2s-M2 vektor (960 och 9.600 ng av p24) och dox. GAPDH förstärktes som standard kontroll. SB100X transposase och rtTA2s-M2 uttryck redovisas i alla testade förhållanden. NC = negativ kontroll. (Figur modifierad från Cocchiarella, F. et al., 201618). Klicka här för att se en större version av denna siffra.

Transkriptionell reglerade SB systemet kan också användas i primära celler, särskilt i de cellerna som är resistenta mot flera transfection metoder, såsom människans primära keratinocyter. Figur 3 visar en ordning för transduktion av primära keratinocyter odlas på dödligt bestrålas 3T3-J2 feeder lager, med IDLV vektorer bära reglerade SB komponenter, i av närvaro eller frånvaro av dox att inducera SB100X uttryck.

Figure 3
Figur 3: transduktion i suspension av människans primära keratinocyter med IDLV vektorer av uttryck för transcriptionally-reglerade SB transposase och transposon. Ett system för in vitro- transduktion av människans primära keratinocyter med IDLVs att uttrycka transcriptionally-reglerade SB transposase och transposon, i av närvaro eller frånvaro av 1 µM dox. Klicka här för att se en större version av denna siffra.

QRT-PCR analysen i figur 4A visar att bäst dos kombination av transposase och modulator vektorer, redovisas i tabell 2, resulterade i 15-fold aktivering av SB uttryck över off-staten (-dox). Införlivande experimentet utfördes i keratinocyter sensorik med tre IDLV vektorer (IDLVTKSB, IDLVrtTA2s-M2 och IDLVT2) i närvaro eller frånvaro av dox. Uttryck av den GOI (GFP) beared av T2-transposon, i APC facket, mättes av flöde cytometer analys 2 dagar efter transduction (dpt) och på endopoint av kulturen (5 dagar för människans primära keratinocyter). Slutpunkten nåddes när ointegrerade T2-GFP transposon sjunkit till en knappt detekterbar nivå (genomsnitt 0,6%) på grund av celldelning-beroende utspädning. Figur 4B visar förhållandet mellan andelen GFP+ celler i APC facket vid slutpunkten och 2 dagar post transduktion, normaliserade till rester av transposon ensam. Detta anger procentandelen celler värd minst 1 kopia av den uttryckta GOI stabilt integrerat i sin arvsmassa, bedömas på 12% för människans primära keratinocyter.

Figure 4
Figur 4: analys av uttryck för transposase och god Jordbrukarsed i sensorik människans primära keratinocyter. (A) qRT-PCR test på primära keratinocyter sensorik med IDLVTKSB och IDLVrtTA2S-M2 i närvaro eller frånvaro av 1 µM dox. (B) samtidig transduktion av primära keratinocyter med IDLVT2 transposon och IDLVs för transposase uttryck i närvaro eller frånvaro av dox. På y-axeln, % GFP+ celler 5dpt / % GFP+ celler 2 dpt * 100 (medelvärde ± SEM av två experiment). ** Visa betydligt olika värden (P < 0,05). (Figur modifierad från Cocchiarella, F. et al., 201618). Klicka här för att se en större version av denna siffra.

Plasmid Beskrivning Referenser
pCCL-TetOTKSB Överföra plasmiden används för att generera IDLVTKSB vektor. Denna plasmid härrör från pTetOTKSB, efter kloning TetOTKSB i pCCL lentiviral ryggraden. 18, 20
pCCL-PGKrtTA2S-M2 Överföra plasmiden används för att generera IDLVrtTA2s-M2 vektor. som tillhandahålls av Prof. V. Zappavigna
pCCL-T2GFP Överföra plasmiden används för att generera IDLVT2 vektor. Denna plasmid härrör från pT2GFP, efter kloning av GFP mellan T2-transposon IRs i pCCL lentiviral ryggraden. 18, 20
pMD.Lg/pRRE.D64VInt Förpackning plasmiden att generera IDLV vektor. 19
pMD2.G Plasmid kodning för VSV-G kuvert att generera lentiviral vektor. 20
pRSV-Rev Rev plasmiden att generera lentiviral vektor. 20
Vektor Beskrivning
IDLVTKSB Integration defekta lentiviral vektor av uttryck för SB100X under kontroll av Tet-lyhörd TK arrangören.
IDLVrtTA2s-M2 Integration defekta lentiviral vektor av uttryck för den rtTA2s-M2 modulator under kontroll av PGK arrangören.
IDLVT2 Integration defekta lentiviral vektor av uttryck för Indiens klonade mellan T2-transposon IRs.

Tabell 1: plasmider och vektorer anställd i detta protokoll. Beskrivningar och referenser finns.

Vektorer HeLa (2 x 105 celler) Keratinocyter (1.6x105 celler)
IDLVTKSB 2 600 ng p24 13.000 ng p24
IDLVrtTA2s-M2 9.600 ng p24 48.000 ng p24
IDLVT2 9,160 ng p24

Tabell 2: Optimerade vektor doser för transduktion HeLa cells och människans primära keratinocyter.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här, vi beskriver en lättillgänglig metod för att stabilt integrera en GOI i genomet hos målceller av Törnrosa-medierad införlivande. Även om SB systemet utvecklades för att tillhandahålla en nonviral metod för editering, är effektiv leverans av integration maskiner (transposase och T2 transposon) obligatoriska. Därför, om du vill använda systemets SB på knappast transfectable primära celler, en viral leverans av SB komponenter uppvaktades i senaste åren10,12,15. Dock behandlat ingen av de virala vektorer sysselsatt upp till nu frågan om konstituerande uttryck för transposase som kan resultera i risk för okontrollerbara rehopping av transposon.

För att transcriptionally reglera transposase uttryck, drog vi fördel av en modifierad Tet-ON system16. Minimal TK arrangören smält till elementet TetO, vid bindning till rtTA2s-M2 modulator i närvaro av dox, som tilldelats en finjustering av transposase aktivering över bakgrunden (off-stat, i avsaknad av dox). Reglerande prestanda beror på de lämpliga IDLVs (IDLVTKSB och IDLVrtTA2s-M2) vektor doskombinationen och på celltyper (t.ex. HeLa cells och människans primära keratinocyter). Oberoende av målceller, vektor dosen måste säkerställa högsta nivå av transduktion av målceller påverkar cellernas viabilitet, således en eskalerande dos-kombination experimentera i HeLa cells (eller andra cellinjer) för att definiera de optimala doserna, av semikvantitativ RT-PCR, rekommenderas starkt.

Införlivandet av Indiens myndigheter bedömdes i primära celler. Människans primära keratinocyter seedade på dödligt bestrålade 3T3-J2 feeder lager var sensorik med 3 IDLVs (IDLVTKSB, IDLVrtTA2s-M2 och IDLVT2) vid experimentellt definierade doser. En tydlig dox-beroende aktivering av transposase visades av qRT-PCR. Dessutom visades stabil integrering av Indiens myndigheter av cytofluorimetric analys av GFP uttryck i celler sensorik i närvaro eller frånvaro av dox, indikerar möjligheten att anställa IDLV plattformen fordonet transcriptionally reglerade SB komponenter till de primära cellerna och framgångsrika integreringen av en GOI i genomet hos målceller.

De kritiska steg i protokollet är IDLV vector produktion och transduktion av målceller vid optimal effektivitet och vektor doskombinationen. Låg transfection effektivitet av HEK293T celler kan resultera i låg vektor avkastning. Definitionen av doser av IDLVTKSB och IDLVrtTA2s-M2 är nödvändigt att undvika en obalans av Tet-ON komponenter som kan resultera i höga leakiness i avsaknad av modulatorn eller låg vik induktion av TetOTK arrangören vid dox behandling. Dessa kritiska steg skulle kunna tas upp av mindre modifieringar. Exempelvis kan protokollet transfection standardiseras med kommersiella transfection reagens. Transduktion protokollet bör anpassas efter celltyp av intresse, särskilt med tanke på huruvida spinoculation ökar transduktion effektivitet utan att påverka cellernas viabilitet. Vektorer och polybrene kunde läggas till odlingsmediet av målceller och ersättas med färska medium efter 6 timmar eller över natten inkubation. Det är också värt att notera att andelen GFP+ celler inom 5 dagar efter transduktion kan påverkas av bakgrunden integrationen av IDLVs.

En mindre begränsning med denna metod är att de IDLV vektorerna produceras normalnivå av transfection av HEK293T celler. Beroende på vektorn upprepade doser som ska användas, vektor produktioner krävs. En andra begränsning är relaterad till längden av Indiens myndigheter, som Last kapaciteten av vektorn som IDLV är cirka 8 kb.

Avslutningsvis tillåter denna metod här integration av en GOI genom transcriptionally reglerade SB komponenter förpackade i IDLV vektorer, som bland de befintliga metoderna att leverera SB system, visar ett brett utbud av tropism och hög transduktion effektivitet. Dessutom tillåter ändrade Tet-ON systemet en Transkriptionsreglering av SB100X uttryck, en relevant fråga i risken för transposon åter hoppande eller flera seriella införlivande händelser om det behövs. Möjliga tillämpningar av denna metod inkluderar genomet engineering av cellinjer (t.ex. HeLa cells, HEK293 celler) att upprätta stabila förpackning celler för virala vektorer och integrering av terapeutiska gener i kliniska relevanta primära celler.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi tackar Prof. Zappavigna, universitetar av Modena och Reggio Emilia, Modena, Italien för att förse oss med pCCL-PGKrtTA2S-M2 plasmid. Vi erkänner också Prof Z. Ivics (Paul Ehlrich Institutet, Langen, Tyskland) och Prof. Z. Izvak (Max Delbrück Center för molekylärmedicin, Berlin, Tyskland) för pCMVSB100X och pT2/BH plasmider. Detta arbete stöds av DEBRA internationella och italienska ministeriet för universitet och forskning.

Materials

Name Company Catalog Number Comments
Dulbecco’s modified Eagle’s medium with 4.5g/L glucose w/o L-Glutamine Lonza BE12-614F Cell culture medium.
HyClone Fetal Bovine Serum (U.S.), Characterized GE Healthcare Life Sciences SH30071.03 Serum used HEK293T cell culture for lentiviral particle production.
Penicillin 10.000 UI/ml Streptomycin 10.000 UI/ml Lonza DE17-602E Reagents for cell culture medium.
L-Glutamine 200mM Lonza BE17-605E Reagent for cell culture medium.
Sodium Chloride (NaCl) Sigma-Aldrich S7653 Reagent for HBS 2X preparation.
HEPES Buffer, 1M Stock in normal saline Lonza BE17-737E Reagent for HBS 2X preparation.
Disodium hydrogen phosphate dihydrate (Na2HPO4·2H2O), 99.5% Merck 106580 Reagent for HBS 2X preparation.
Hydrochloric acid - ACS reagent 37% (HCl) Sigma-Aldrich 320331 Reagent for HBS 2X preparation.
Sterile water for injection Fresenius Kabi - Reagent for HBS 2X preparation.
0.45 µm PESS filter Whatman 10462100 Filters used to remove cell debris from viral supernatant.
Polyallomer Beckman tubes Beckman Coulter 326823 Tubes for concentrating IDLV vectors by ultracentrifugation.
PBS-1X w/o Ca, Mg Lonza BE17-516F Buffer for cell wash and lentiviral particle resuspension.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 (Optional) Buffer for lentiviral particle resuspension.
HIV-1 Gag p24 immunocapture kit Perkin Elmer NEK50001KT Kit for IDLV particle titration.
Polybrene Sigma-Aldrich 107689 Reagent to enhance transduction efficiency.
Trypsin (10X) 2.5% in HBSS w/o Ca, Mg GIBCO BE17-160E Reagent to detach HeLa cells (stock solution, to be diluted).
Ethylenediaminetetraacetic acid disodium salt (EDTA) 100938B AnalaR BDH Reagent for trypsin working solution preparation.
0.5% Trypsin-EDTA, no phenol red (10X) GIBCO 15400-054 Reagent to detach keratinocytes (stock solution, to be diluted).
Donor Bovine Serum, New Zealand Origin GIBCO 16030-074 Serum for Swiss mouse 3T3-J2 cell culture (feeder layer).
Ham’s F12 media GIBCO 21765 Medium for keratinocytes.
Fetal bovine serum Lonza DE14-801F Serum for HeLa cell culture medium.
Fetal Bovine Serum, qualified, Australia Origin GIBCO 10099-141 Serum for human primary keratinocyte culture medium.
Insulin from bovine pancreas Sigma-Aldrich I5500 Reagents for keratinocyte growth.
Adenine VWR 1152-25 Reagents for keratinocyte growth.
Hydrocortisone VWR 3867-1 Reagents for keratinocyte growth.
Cholera Toxin from Vibrio cholerae Sigma-Aldrich C8052 Reagents for keratinocyte growth.
Triiodothyronine Sigma-Aldrich T5516 Reagents for keratinocyte growth.
Human EGF Austral Biological GF-010-9 Reagents for keratinocyte growth.
Mouse monoclonal APC-conjugated Anti-Feeder antibody Miltenyi Biotech 130-096-099 To label feeder layer.
RNeasy Plus Mini Kit Qiagen 74134 RNA purification kit.
SuperScript III Reverse Transcriptase Life Technologies 18080051 Reverse transcriptase kit.
Deoxynucleotide Mix, 10 mM (dNTP) Sigma-Aldrich D7295 Reagent for semi-quantitative PCR.
UltraPure DNase/RNase-Free Distilled Water (any) - Reagent for semi-quantitative PCR and for qRT-PCR.
GoTaq G2 Hot Start Polymerase Promega M740B Taq polymerase.
Agarose, for molecular biology Sigma-Aldrich A9539 Reagent for agarose gel electrophoresis.
UltraPure TBE Buffer, 10X Invitrogen 15581028 Reagent for agarose gel electrophoresis, to be dilute (1X) in ddH2O.
Ethidium bromide Sigma-Aldrich E1510 Reagent for agarose gel electrophoresis.
Doxycycline Sigma-Aldrich D-9891 drug to induce transposase expression in HeLa cells and in keratinocytes
TaqMan Universal PCR Master Mix Applied Biosystem 4304437 TaqMan Universal PCR Master Mix including primers and probe.
15mL High Clarity polypropylene Centrifuge Tube, Conical Bottom, with Dome Seal Screw Cap, Sterile Falcon Corning 352096 Tubes for cell collection and vector dilution preparation.
150 mm TC-Treated Cell Culture Dish with 20 mm Grid, Sterile Falcon Corning 353025 Cell culture dish for viral production.
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid, Individually Wrapped, Sterile Falcon Corning 353046 Cell culture plate for HeLa and human primary keratinocyte transduction.
Safe-Lock microcentrifuge tubes, volume 1.5 mL Eppendorf 0030 120.086 Tubes for dilution preparation.
Safe-Lock microcentrifuge tubes, volume 2 mL Eppendorf 0030 120.094 Tubes for dilution preparation.
0.2ml PCR Tubes with flat caps, RNase, DNase, DNA and PCR Inhibitor free (any) - Tubes for semi-quantitative PCR.
MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL Applied Biosystem 4346906 96-well for qRT-PCR.
5mL Round Bottom Polystyrene Tube, without Cap BD Falcon 352052 Tubes for flow cytometry acquisition.
Disposable Serological Pipets, Polystyrene, Individually Wrapped, Sterile (different volumes) (any) - Pipettes for sterile tissue culture applications.
Filter Tips, Sterile, and RNase, DNase, DNA and Pyrogen free (different volumes) (any) - Filter tips for sterile tissue colture and molecular biology applications.
pH meter (any) - Equipment for measurement of HBS 2X pH.
PCR Thermal cycler (any) - Equipment for semi-quantitative PCR.
Agarose gel electrophoresis equipment (any) - Equipment for agarose gel electrophoresis of semi-quantitative PCR.
BD FACS Canto II 2LSR 4/2 BD - Flow cytometer.
7900HT Fast Real-Time PCR system Applied Biosystem 7900HT Equipment for qRT-PCR.
Benchtop centrifuges for efficient sample processing in cell culture applications, refrigerated, with microplate buckets. (any) - Centrifuge for cell culture processing and spinoculation.
Optima L-90K Ultracentrifuge equipped with SW32TI rotor Beckman Coulter - Ultracentrifuge for lentiviral particle production.
Equipment for cell culture and molecular biology laboratory (e.g., Class II laminar flow hood designed for work involving BSL2 materials, cell culture incubator,refrigerators and freezers (+4 °C, -20 °C, -80 °C), micropipettes and pipet-aid).
Protective laboratory coats, gloves, face protection in accordance with Institute rules and regulations, in particular for lentiviral particle production and transduction.

DOWNLOAD MATERIALS LIST

References

  1. Mates, L., et al. Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet. 41, (6), 753-761 (2009).
  2. Maiti, S. N., et al. Sleeping beauty system to redirect T-cell specificity for human applications. J Immunother. 36, (2), 112-123 (2013).
  3. Johnen, S., et al. Sleeping Beauty transposon-mediated transfection of retinal and iris pigment epithelial cells. Invest Ophthalmol Vis Sci. 53, (8), 4787-4796 (2012).
  4. Koso, H., et al. Transposon mutagenesis identifies genes that transform neural stem cells into glioma-initiating cells. Proc Natl Acad Sci U S A. 109, (44), E2998-E3007 (2012).
  5. Belay, E., et al. Novel hyperactive transposons for genetic modification of induced pluripotent and adult stem cells: a nonviral paradigm for coaxed differentiation. Stem Cells. 28, (10), 1760-1771 (2010).
  6. Grabundzija, I., et al. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells. Nucleic Acids Res. 41, (3), 1829-1847 (2013).
  7. Kues, W. A., et al. Derivation and characterization of sleeping beauty transposon-mediated porcine induced pluripotent stem cells. Stem Cells Dev. 22, (1), 124-135 (2013).
  8. Turchiano, G., et al. Genomic analysis of Sleeping Beauty transposon integration in human somatic cells. PLoS One. 9, (11), e112712 (2014).
  9. Jin, Z., et al. The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene Ther. 18, (9), 849-856 (2011).
  10. Latella, M. C., et al. Correction of Recessive Dystrophic Epidermolysis Bullosa by Transposon-Mediated Integration of COL7A1 in Transplantable Patient-Derived Primary Keratinocytes. J Invest Dermatol. 137, (4), 836-844 (2017).
  11. Zhang, W., et al. Integration profile and safety of an adenovirus hybrid-vector utilizing hyperactive sleeping beauty transposase for somatic integration. PLoS One. 8, (10), e75344 (2013).
  12. Zhang, W., et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One. 8, (10), e76771 (2013).
  13. Turunen, T. A., Laakkonen, J. P., Alasaarela, L., Airenne, K. J., Yla-Herttuala, S. Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye. J Gene Med. 16, (1-2), 40-53 (2014).
  14. Galla, M., et al. Avoiding cytotoxicity of transposases by dose-controlled mRNA delivery. Nucleic Acids Res. 39, (16), 7147-7160 (2011).
  15. Moldt, B., et al. Comparative genomic integration profiling of Sleeping Beauty transposons mobilized with high efficacy from integrase-defective lentiviral vectors in primary human cells. Mol Ther. 19, (8), 1499-1510 (2011).
  16. Recchia, A., Perani, L., Sartori, D., Olgiati, C., Mavilio, F. Site-specific integration of functional transgenes into the human genome by adeno/AAV hybrid vectors. Mol. Ther. 10, 660-670 (2004).
  17. Urlinger, S., et al. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 97, (14), 7963-7968 (2000).
  18. Cocchiarella, F., et al. Transcriptionally regulated and nontoxic delivery of the hyperactive Sleeping Beauty Transposase. Mol Ther Methods Clin Dev. 3, 16038 (2016).
  19. Yanez-Munoz, R. J., et al. Effective gene therapy with nonintegrating lentiviral vectors. Nat Med. 12, (3), 348-353 (2006).
  20. Dull, T., et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 72, (11), 8463-8471 (1998).
  21. Bak, R. O., Mikkelsen, J. G. Mobilization of DNA transposable elements from lentiviral vectors. Mob Genet Elements. 1, (2), 139-144 (2011).
  22. Green, M. R., Sambrook, J. Molecular Cloning: A laboratory Manual. 4th edition, (2012).
  23. Dellambra, E., et al. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa. Hum Gene Ther. 9, 1359-1370 (1998).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics