Magnetico-Activated Cell Sorting strategie per isolare e purificare Synovial cellule staminali mesenchimali liquido derivato da un modello di coniglio

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Questo articolo presenta un protocollo semplice ed economico per il semplice isolamento e purificazione delle cellule staminali mesenchimali da liquido sinoviale di coniglio bianco di Nuova Zelanda.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Cellule staminali mesenchimali (MSCs) sono la fonte principale delle cellule per terapia cellulare. MSCs dal liquido sinoviale cavità articolare potrebbero essere utilizzati per l'ingegneria tissutale della cartilagine. MSCs dal liquido sinoviale (SF-MSCs) sono stati considerati promettenti candidati per rigenerazione articolare, e loro potenziale beneficio terapeutico li ha resi un tema di ricerca importante di ritardo. SF-MSCs dalla cavità del ginocchio del coniglio bianco di Nuova Zelanda può essere impiegato come un modello traslazionale ottimizzato per valutare umana medicina rigenerativa. Per mezzo di CD90-base magnetica attivato cella (MACS) tecnologie di differenziazione, questo protocollo ottiene correttamente coniglio SF-MSCs (rbSF-MSCs) da questo modello di coniglio e completamente dimostra ulteriormente il fenotipo MSC di queste cellule inducendo loro di differenziarsi per osteoblasti, adipociti e condrociti. Di conseguenza, questo approccio può essere applicato nella ricerca di biologia cellulare e tissutale utilizzando procedure e attrezzature semplici.

Introduction

MSCs sono stati suggeriti come una preziosa fonte per la medicina rigenerativa, soprattutto per le lesioni della cartilagine. MSCs, tra cui condrociti, osteoblasti, adipociti, miociti scheletrici e viscerali cellule stromali, largamente espandere le aree per il trapianto di cellule staminali a causa della loro alta espansione tasso e multi-lignaggio differenziazione potenziali1. MSCs può essere isolato dal scheletrico muscolare, synovium, midollo osseo e del tessuto adiposo2,3,4. Risultati hanno inoltre confermato la presenza di cellule staminali mesenchimali nel liquido sinoviale, e precedente ricerca ha identificato MSCs derivato liquido sinoviale (SF-MSCs) come candidati promettenti per rigenerazione articolare5,6.

Tuttavia, ricerca e sperimentazione preclinica su campioni umani sono soggetti a molte questioni etiche. Invece, i conigli sono stati e continuano ad essere il più comunemente usato specie animali per dimostrare che il trapianto di cellule staminali mesenchimali può riparare il danno della cartilagine. Negli ultimi anni, un numero crescente di ricercatori hanno studiato le cellule staminali mesenchimali coniglio (rbMSCs) entrambi in vitro e in vivo, come queste cellule sono simili all'essere umano MSCs nella loro fisiologia biologia e tessuto. Allo stesso modo, il rbMSCs sono in grado di aderire a superfici in plastica, visualizzazione morfologia dell'alberino-fibroblasto come MSCs umane. Inoltre, campioni mesenchymal coniglio sono semplici e facili da ottenere7. Inoltre, i punti più cruciali sono che rbMSCs esprimono marcatori di superficie, quali CD44, CD90 e CD105, e che sia preservata la differenziazione multi-lignaggio potenziale, che è d'accordo con i criteri per l'identificazione delle popolazioni di MSC come definito dalla società internazionale per la terapia cellulare8,9. In particolare, sono in grado di non-ipertrofica Condrogenesi quando indotto dal TGF-β1, rendendoli così fonti di cellule adatto per cartilagine articolare fenotipico rigenerazione10,11, chondroprogenitors fluido sinoviale 12.

Tuttavia, l'isolamento della SF-MSCs è notevolmente diverso da altri tessuti, compreso il cordone ombelicale, il tessuto adiposo, sangue periferico e midollo osseo. Attualmente, gli approcci più comuni per la purificazione e l'ordinamento di SF-MSCs sono citometria a flusso e immunomagnetica ordinamento basato su tallone, anche se il metodo di cytometry di flusso richiede un ambiente specifico e altamente costosi strumenti13.

Questo articolo presenta una procedura per la raccolta semplice e minimamente invasiva di campioni di liquido sinoviale dalla Nuova Zelanda conigli bianchi. Durante la procedura, il rbSF-MSCs sono stabilmente espanse in vitro e quindi isolato con CD90 positive procedure basate su tallone magnetiche. Infine, il protocollo viene illustrato come ottenere MSCs con elevata purezza e vitalità dalle fonti delle cellule raccolte.

In questo protocollo, l'isolato rbSF-MSCs sono caratterizzati base alla loro morfologia, espressione di marcatori specifici e pluripotenza delle cellule staminali. Flusso cytometry-basata immunophenotyping rivela una significativa espressione positiva di CD44 e CD105, mentre l'espressione di CD45 e CD34 è negativo. Infine, un test in vitro per rbSF-MSCs illustra la differenziazione osteogenica, adipogenico e condrogenica di queste cellule.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti gli esperimenti sugli animali sono stati condotti in conformità degli orientamenti regionali del comitato etico, e tutte le procedure di animali sono state approvate dal istituzionale Animal Care e di utilizzo Comitato di Shenzhen secondo persone Hospital, Università di Shenzhen.

1. isolare e cultura rbSF-MSCs

  1. Preparativi per la procedura di animale
    1. Preparare scheletricamente maturo femmina Nuova Zelanda conigli bianchi per la raccolta di rbSF-MSCs. eseguire un esame clinico dei conigli un giorno prima della procedura di anestesia e artrocentesi.
      Nota: gli esami fisici dovrebbe includere peso (2.0-2.5 kg), sesso (donna) e la temperatura corporea, frequenza respiratoria e frequenza cardiaca. Intervalli di parametro per conigli clinicamente sani sono 30-50 min per tasso di respirazione, 220-280 min per la frequenza cardiaca e 38-39 ° C per la temperatura corporea.
    2. Veloce gli animali per 6 ore prima dell'anestesia.
  2. Preparazioni e procedura per l'anestesia degli animali
    1. Trattenere il coniglio con una gabbia (Vedi Tabella materiali) e poi iniettare 3% di sodio pentobarbital nella vena marginale dell'orecchio ad una dose di 1 mL/kg per l'anestesia generale.
    2. Posto il coniglio in una confortevole posizione dorsale-recumbent.
    3. Monitorare la frequenza respiratoria, frequenza cardiaca e temperatura corporea del coniglio durante l'anestesia.
    4. Usare pomata oftalmologico sui suoi occhi per prevenire la secchezza durante l'anestesia.
    5. Valutare la profondità dell'anestesia seguito classificazione14 di Guedel.
  3. Preparazione per MSCs isolamento e coltivazione
    1. Per coltivare rbSF-MSCs, preparare 500 mL di terreno di coltura commerciale (Vedi Tabella materiali) completati con supplemento di 10% delle imprese (Vedi Tabella materiali), 10% siero bovino fetale (FBS) e 1% penicillina-streptomicina.
    2. Incubare il terreno di coltura a 37 ° C in un bagno d'acqua.
    3. Preparare 500 mL di soluzione salina tampone fosfato (PBS) per isolamento delle cellule e cellula lavaggio.
    4. Preparare 100 mL di soluzione salina isotonica per la procedura di artrocentesi cavità del ginocchio.
  4. Raccolta di liquido sinoviale articolare dal ginocchio del coniglio
    1. Selezionare un'area di circa 5 x 5 cm di dimensioni intorno al ginocchio e radere i peli di coniglio da questa zona utilizzando un rasoio elettrico di sicurezza.
    2. In alternativa, disinfettare il sito di procedura 3 x con povidone iodio soluzione e 75% di etanolo. Quindi, applicare teli sterili dopo l'area è completamente asciugato.
    3. Iniettare 1-2 mL di soluzione salina isotonica, utilizzando una siringa ipodermica sterile (2 mL), in cavità articolare del ginocchio dallo spazio articolare laterale, spostare il ginocchio x 3-4 e poi succhiare tutto il fluido sinoviale a temperatura ambiente.
    4. Filtrare il fluido sinoviale attraverso un colino di cella di nylon µm 40 per rimuovere eventuali detriti all'interno di 4 h.
  5. Cultura di rbSF-MSCs
    1. Raccogliere il filtrato del fluido in provette centrifuga da 50 mL e centrifugare a 1.500 giri/min per 10 min a temperatura ambiente.
    2. Eliminare il supernatante dopo la centrifugazione, lavare la pallina con PBS, risospendere il pellet con il terreno di coltura completo e poi piastra il mezzo in piastre da 100 mm.
    3. Incubare le piastre a 37 ° C in atmosfera umidificata contenente 5% CO2.
    4. Dopo 48 h, ricostituire i piatti con medium fresco per rimuovere eventuali cellule non aderenti. Sostituire il mezzo due volte a settimana per 2 settimane come passaggio 0 (P0).
      Nota: Ci dovrebbe essere circa 1 x 104 cellule aderenti. Cellule/ml praticabile in SF sono circa 2 x 102/ml.
    5. Dopo 14 giorni che seguono la placcatura iniziale, molte colonie dovrebbero avere formato in piastre di coltura. Selezionare le colonie più grandi di 2 mm di diametro. Mark, dove si trovano le colonie selezionate tracciando loro circonferenza sul fondo piatto.
    6. Scartare le colonie < 2 mm di larghezza, utilizzando raschietti di cella. Digerire le colonie selezionate con circa 5 µ l di 0,25% tripsina, utilizzando una bomboletta di clonazione e trasferire le colonie un nuovo piatto come passaggio 1 (P1).
  6. Post-operatorio cura degli animali
    1. Seguire le procedure operative istituzionali standard per il monitoraggio post-operatorio e recupero dall'anestesia.
    2. Monitorare i segni vitali del coniglio ogni 10 min fino a quando ha riacquistato coscienza. Infine, è possibile trasferire l'animale cosciente alla gabbia. Non restituiscono un coniglio che ha subito un intervento chirurgico per la compagnia di altri animali, finché non ha completamente recuperato.
    3. Post-operazione, disinfettare il sito con 0,1% povidone iodio, 2 volte al giorno per 3 giorni.

2. CD90-positivo magnetico attivato cella ordinamento (MACS) del rbSF-MSCs e coltura primaria

  1. Preparazione del campione
    1. Quando le cellule raggiungono intorno 80% confluency, aspirare il mezzo e quindi aggiungere 1-2 mL di 0,25% tripsina-EDTA ad ogni piatto.
    2. Incubare i piatti per 2-3 minuti consentire il distacco delle cellule.
    3. Una volta che le cellule sono staccate, aggiungere una pari quantità di terreno di coltura per inattivare la tripsina.
    4. Passare la sospensione cellulare attraverso un colino di cella di 40 µm, raccogliere il filtrato in una provetta da 15 mL e poi girare giù le cellule a 600 × g per 10 min a temperatura ambiente.
    5. Risospendere il pellet cellulare in Mac con il buffer (PBS, pH 7,2, 0,5% di albumina di siero bovino e 2 mM EDTA) e poi contare il numero di cellulare.
  2. Etichette magnetiche
    Nota: Ordinare il rbSF-MSCs con una cella magnetico attivato l'ordinamento kit contenente colonne, uno stand e separatori (Vedi Tabella materiali).
    1. Determinare il numero di cellulare utilizzando un emocitometro.
    2. Centrifugare la sospensione cellulare a 300 × g per 10 min a 4 ° C. Completamente aspirare il supernatante.
    3. Aggiungere 80 µ l di tampone di risospensione per 107 cellule totali.
    4. Per 107 cellule totali, aggiungere 20 µ l di microsfere coniugate con un anticorpo monoclonale di CD90 anti-coniglio.
    5. Mescolare le biglie magnetiche e le cellule in modo uniforme nei tubi, poi li Incubare a 4 ° C per 15 min al buio.
    6. Aggiungere 1 mL di tampone per 107 cellule al tubo e poi lo Centrifugare a 300 × g per 10 min a 4 ° C per lavare le cellule. Eliminare il supernatante dopo la centrifugazione.
    7. Risospendere il pellet in 500 µ l di tampone per 107 cellule.
  3. Separazione magnetica
    1. Sistemare la colonna con le ali di colonna alla parte anteriore nel campo magnetico del separatore magnetico.
    2. Lavare la colonna Separatore magnetico (MS) con 500 µ l di buffer per 107 cellule.
    3. Trasferire la sospensione singola cella nella colonna. Lasciare che le celle negative passano attraverso il campo magnetico per eliminare queste cellule senza etichetta.
    4. Lavare la colonna 1-2x con 500 µ l di buffer per 107 cellule e scartare il flusso continuo.
    5. Trasferire la colonna in una provetta da centrifuga (15 mL).
    6. Aggiungere 1 mL di tampone per 107 cellule alla colonna e poi immediatamente spingere lo stantuffo nella colonna per scovare le cellule magneticamente con etichetta.
    7. Ripetere la procedura di cui sopra con un secondo MS Column per aumentare la purezza del CD90+ cellule, che possono arricchire la frazione eluita.
    8. Centrifugare la sospensione cellulare a 300 × g per 10 min, aspirare il supernatante e risospendere le con terreno di coltura.
  4. Cultura del CD90+ rbSF-MSCs
    1. Inoculare le cellule in piastre da 100 mm dopo l'ordinamento magnetico delle cellule attivate.
    2. Incubare le piastre a 37 ° C in un'incubatrice umidificata cellulare con 5% CO2.
    3. Quando viene raggiunta la confluenza di 80-90% di colture primarie, a circa 7-10 giorni, digerire le celle aderenti con 0,25% tripsina-EDTA e passaggio a una diluizione di 1:2 a fare passaggio 2 (P2).
    4. Utilizzare lo stesso metodo per passare alle cellule di passaggio 3 (P3), che possono essere utilizzate per le analisi in vitro .
      Nota: Dopo la sub-cultura e la purificazione, si ottengono circa 1 x 107 rbSF-MSCs.

3. identificazione del rbSF-MSCs

  1. Conferma di superficie dell'indicatore di rbSF-cellule staminali mesenchimali da citometria a flusso
    1. Quando i MSCs sono 80-90% confluenti a P3, lavare le cellule con PBS e trattarli con 1 mL di 0,25% tripsina-EDTA. Quindi, incubare le MSCs a 37 ° C per 2-3 minuti fino a quando le cellule sono staccate.
    2. Raccogliere le celle utilizzando 10 mL di PBS, trasferirli in un tubo conico (15 mL) e li Centrifugare a 300 × g per 5 min a temperatura ambiente.
    3. Eliminare i sovranatante. Risospendere il pellet cellulare in 500 µ l di PBS e trasferirlo in una provetta da 1,5 mL.
    4. Incubare una diluizione di 1: 100 di anticorpi coniugati FITC e PE-coniugati (isotipo, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) per 1 h al buio a 4 ° C.
    5. Questa miscela a 300 × g per 5 min a temperatura ambiente di centrifugare e lavare le cellule due volte con PBS mediante centrifugazione a 300 × g per 5 minuti ogni volta. Eliminare i sovranatante.
    6. Risospendere le cellule in 500 µ l di PBS, trasferire la sospensione cellulare in una provetta di turno-fondo (5 mL) e analizzarlo utilizzando un citometro a flusso.
      Nota: Acquisizione di dati su un citometro dotato di due canali di fluorescenza: 533/30 e 585/40. Per ogni isotipo di fluorescenza, utilizzare il controllo di isotipo per regolare la tensione del laser appropriato e impostare l'intensità minima necessaria per ottenere un istogramma di fluorescenza che Visualizza i bordi destro e sinistro del picco. Raccogliere un minimo di 10.000 eventi per le analisi statistiche.
  2. Al multidifferenziamento delle rbSF-MSC
    Nota: Uso P3 rbSF-MSCs per le analisi di multidifferenziativo in vitro .
    1. Differenziazione osteogenica
      1. Preparare il supporto di induzione osteogenica: DMEM basic (1x) contenente 50 mM di L-ascorbico acido-2-fosfato, α-glicerofosfato di 10 mM e 100 nM di desametasone.
      2. Le cellule a 103 cellule/cm2 in una piastra di coltura del tessuto 6 pozzetti di semi e loro cultura nel mezzo di induzione osteogenica.
      3. Cambiare il mezzo di induzione ogni 3 giorni per 3 settimane.
      4. Fissare le cellule con formaldeide al 4% per 30 min a temperatura ambiente, una volta completata la differenziazione, macchia le celle con il colore rosso di alizarina 1% per 5 minuti e poi lavare loro 3 x con PBS15.
    2. Adipogenico differenziazione
      1. Preparare il supporto di induzione adipogenico: DMEM basic (1x) composto da 100 mM di indometacina, 10 mg/mL di insulina umana ricombinante, 1 mM di desametasone e 0,5 mM di 3-isobutyl-1-methylxanthine.
      2. Trattare il P3 rbSF-MSCs per 3 settimane nel medium adipogenico induzione.
      3. Dopo 3 settimane, macchia i vacuoli di lipidi neutri utilizzando Oil Red O per confermare la differenziazione adipogenico. Fissare le cellule in una soluzione di formaldeide 4% a temperatura ambiente per 30 minuti e poi lavare 3 volte con PBS16.
    3. Differenziazione chondrogenic
      1. Preparare il supporto di induzione condrogenica: DMEM basic (1x) che consiste di 10 ng/mL di TGFβ1, 1% suo supplemento, 0,35 mM di L-prolina, 100 nM di desametasone, 50 mM di L-ascorbico acido-2-fosfato e 1 mM di piruvato di sodio.
      2. Utilizzare pellet coltura per l'induzione di chondrogenic. Centrifugare 5 × 105 P3 rbSF-MSCs a 1500 rpm per 10 min in un tubo in polipropilene (15 mL) per formare una pallina.
      3. Per 3 settimane con il mezzo di induzione condrogenica della coltura del pellet.
      4. Modificare il mezzo ogni 3 giorni per 3 settimane.
      5. Dopo induzione di 3 settimane, incorporare il pellet cellulare con paraffina, sezione a fette di 4 mm e macchia utilizzando 0.1% blu di toluidina per 30 min a temperatura ambiente17.
  3. Estrazione di RNA totale e l'analisi di reazione a catena della polimerasi in tempo reale quantitativa (qRT-PCR)
    1. Isolare il RNA totale delle cellule dopo induzione di differenziazione di 3 settimane attraverso l'estrazione di RNA commerciale kit (Vedi Tabella materiali).
      1. Rimuovere il terreno di coltura nella piastra di coltura e quindi aggiungere 1 mL di reagente di isolamento.
      2. Lisare le cellule pipettando ripetuto finché la soluzione non è omogenea. Incubare a temperatura ambiente per 3 min.
      3. Trasferire il lysate delle cellule in una provetta da microcentrifuga da 1,5 mL.
      4. Aggiungere 100 µ l di cloroformio, scuoterlo da mano 15x e incubare la miscela a temperatura ambiente per 3 min.
      5. Centrifugare la provetta a 12.000 × g per 15 min a 4 ° C. Trasferire i surnatanti in un nuovo tubo per microcentrifuga da 1,5 mL.
      6. Aggiungere 500 µ l di isopropanolo e precipitare il RNA per 10 min a temperatura ambiente.
      7. Centrifugare a 12.000 × g per 10 minat 4 ° C. La pallina del RNA dovrebbe essere visibile nella parte inferiore del tubo.
      8. Rimuovere il supernatante e quindi aggiungere 500 µ l di etanolo al 75%. Girare brevemente il tubo per alcuni secondi per lavare la pallina del RNA. E centrifugare a 7.500 × g per 5 min a 4 ° C.
      9. Rimuovere il residuo dell'etanolo.
      10. Dissolva la pallina del RNA in 10 µ l di acqua DEPC e posizionare i tubi sul ghiaccio.
    2. Retromarcia trascrivere RNA totale in cDNA con una sintesi di DNA kit (Vedi Tabella materiali).
      Nota: Eseguire tutte le procedure seguenti sul ghiaccio.
      1. Preparare il mix master di trascrizione inversa.
      2. Aggiungere 25 µ l di RNA dnasi-trattati in ogni provetta con 1 µ g di RNA.
      3. Incubare la miscela alle seguenti temperature utilizzando un termociclatore PCR: 26 ° C per 10 min (per consentire il random esameri tempri), 42 ° C per 45 min (trascrizione inversa) e 75 ° C per 10 min (inattivare la trascrittasi inversa).
      4. Immediatamente analizzare il cDNA risultante dalla PCR quantitativa in tempo reale, o conservare a-20 ° C.
    3. Eseguire l'analisi di espressione genica con un sistema PCR quantitativo in tempo reale.
      1. Utilizzare qRT-PCR Master Mix (Vedi Tabella materiali) per eseguire la PCR. Gli iniettori PCR per GAPDH, Runx2, Agg e PPARγ sono elencati nella tabella 1.
      2. Calcolare l'espressione genica utilizzando il metodoΔΔCT 2.
      3. Condurre un'analisi statistica utilizzando software statistici standard. Utilizzare un test t per campioni indipendenti per confrontare i mezzi del gruppo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolamento, purificazione e la cultura delle rbSF-msc:
Questo protocollo utilizza Mac per isolare rbSF-MSCs, basato sull'espressione del marcatore di superficie MSC CD90. Un diagramma di flusso del processo di isolamento, purificazione, dei rbSF-MSCs e la caratterizzazione e il protocollo di coltura in vitro è illustrato nella Figura 1.

Morfologia delle cellule dopo magnetico attivato cella ordinamento (MACS) con CD90:
In primo luogo, per i Mac, marcatura MSCs con biglie magnetiche CD90. Dopo la centrifugazione, risospendere un massimo di 107 celle a 80 µ l di un buffer di ordinamento preraffreddato e quindi aggiungere 20 µ l di biglie magnetiche CD90, seguita da Vortex e incubazione a 4 ° C per 15 min. Dopo di che, lavare le cellule con 1 mL di buffer di ordinamento e li risospendere in 500 µ l di buffer di ordinamento. Prima di procedere con l'ordinamento magnetico, ripetere la fase di lavaggio. Questa procedura critica è illustrata nella Figura 2.

Prima dell'ordinamento, le popolazioni delle cellule del liquido synovial aderente coniglio visualizzato morfologia eterogenea, contenente tipi cellulari diversi e dimensioni (Figura 3A-C). Seguito di MACS, le popolazioni delle cellule ha esibito la morfologia omogenea. Il numero delle cellule è stato aumentato con sub-cultura (Figura 3D-F).

Superficie rbSF-MSCs arricchita di caratteristiche di Mac:
Fluorescenza-Activated Cell Sorting (FACS) è stato effettuato per analizzare l'arricchimento di rbSF-MSCs di MACS con CD90. Prima del Mac, la popolazione delle cellule ha consistito di circa il 40% di cellule staminali mesenchimali (Figura 4D; controlli di isotipo in Figura 4A,B). A seguito di MACS, la popolazione arricchita ha contenuto circa > 99% MSCs (Figura 4E,F). Gli indicatori delle cellule ematopoietiche lignaggio CD34 e CD45, 0,318%, entrambi raramente espresse dopo MACS, che è un declino da loro espressione iniziale al 25,9%. Prima selezione, c'erano circa 28% CD90+ cellule (Figura 4); Dopo la purificazione, circa il 98% CD90+ cellule sono state ottenute (Figura 4 H).

Multilineare potenziale differenziazione delle rbSF-msc:
Per caratterizzare la capacità di rbSF-MSCs a differenziarsi nei vari lignaggi come osteogenica, adipogenico e cellule chondrogenic, la rbSF-MSCs arricchita da Mac sono state contemporaneamente coltivate in un mezzo di differenziazione specifica e in un mezzo di differenziazione senza citochina per servire da comandi. Una volta ultimato l'induzione, lineage-specifici marcatori sono stati analizzati dalla macchiatura e RT-PCR. Alizarina rosso macchiatura di composti di calcio ha dimostrato che i noduli mineralizzati avevano formato in rbSF-MSCs dopo 3 settimane sotto le condizioni di induzione osteogenica (Figura 5A). Dopo 3 settimane di induzione adipogenico, un'accumulazione dei vacuoli ricca di lipidi potrebbe essere rilevata da intracellulare Oil Red O macchiatura (figura 5B). Per 21 giorni di induzione condrogenica, il pellet cellulare è stato analizzato istologicamente con la macchiatura blu di toluidina. Le cellule positive per la macchiatura (di proteoglycan) erano considerate di condrociti-come le cellule (Figura 5). Simile a questo risultato, un'analisi quantitativa dell'espressione genica di potenziale differenziativo anche dimostrato la capacità di differenziazione di queste cellule. I livelli di espressione di Agg (un marcatore di condrociti), PPARγ (un marcatore di adipogenico) e Runx2 (un marcatore di osteoblasti) sono stati aumentati in condizioni indotte. Questi dati ha dimostrato la capacità di differenziazione multipotente del rbSF-MSCs in trilineages (Figura 5).

Figure 1
Figura 1: schema elettrico completo di isolamento, purificazione e caratterizzazione di SF-MSCs di conigli bianchi della Nuova Zelanda. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: protocollo per magnetico cellulare attivato l'ordinamento (MACS) con CD90. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: morfologia di strato monomolecolare coltivate rbSF-MSCs prima e dopo i Mac come esaminato sotto ordinario invertito microscopia. A-C) Prima dell'ordinamento, le popolazioni delle cellule del liquido synovial aderente coniglio visualizzare eterogeneità. Essi contengono tipi cellulari diversi e dimensioni, ad esempio ovale, lunga-mandrino, mandrino corto e morfologia stellare. La morfologia principale della P2 e P6 è una morfologia del mandrino (A: P2, B: P3, C: P6). D-F) A seguito di MACS con CD90, le popolazioni delle cellule presentano una morfologia omogenea. Con una sub-cultura, aumenta il numero di cellule (D: P2, E: P3, F: P6). Barra della scala = 100 µm. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: identificazione di marcatori di superficie rbSF-MSC. Utilizzando l'analisi di citometria a flusso, rbSF-MSCs sono positivi per gli indicatori MSC CD44 e CD105, mentre negativo per il marcatore delle cellule endoteliali CD34 e il marcatore di cellule emopoietiche CD45. Prima del Mac, queste cellule hanno un basso tasso di positività per CD44 e CD105. Tuttavia, dopo MACS, il tasso di positività era alto. A, B) Queste due immagini superiore Visualizza i dati di controllo di isotipo. C, D) Questi risultati mostrano che prima Mac la popolazione rbSF-MSC è composto da circa 40% di cellule MSC. E, F) Dopo MACS, la popolazione arricchita contiene cellule MSC di > 99%. G, H) Queste immagini mostrano l'analisi di citometria a flusso del CD90+ marcatore, (G) prima e (H) dopo MACS ordinamento. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: analisi dei marcatori lineage-specifici di macchiatura e RT-PCR. A) alizarina colorazione rossa dimostra che i noduli mineralizzati formano sotto l'induzione osteogenica per 3 settimane. B) dopo 3 settimane di induzione adipogenico, viene rilevato l'accumulo dei vacuoli ricca di lipidi dalla macchiatura Oil Red O intracellulare. C) per 3 settimane di induzione condrogenica, il pellet cellulare è stato analizzato istologicamente con la macchiatura blu di toluidina. Le cellule positive per la macchiatura (di proteoglycan) erano considerate di condrociti-come le cellule. Barra della scala = 100 µm. D) dopo la coltura per 3 settimane, il relativo mRNA espressione di marcatori degli osteoblasti (Runx2), adipogenico marcatori (PPARγ) e marcatori condrogenica (Agg) è rilevato. Per tutte le analisi, i valori p < 0.01 sono stati considerati come statisticamente differenze significative utilizzando il test di Kruskal-Wallis (visualizzato come * *). Clicca qui per visualizzare una versione più grande di questa figura.

Geni Forward primer (5'-3') Reverse primer (5'-3')
RUNX2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARY2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabella 1: Elenco di geni e primer usati in questo studio per PCR quantitativa in tempo reale.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

L'esistenza di cellule staminali mesenchimali nel liquido sinoviale fornisce un'alternativa per la terapia cellulare. Gli studi precedenti hanno dimostrato che lesioni siti contengono una maggiore quantità di cellule staminali mesenchimali in loro liquido sinoviale, che può essere correlata positivamente con il periodo di alberino-ferita di5. MSCs nel liquido sinoviale può essere favorevole al tessuto per migliorare la guarigione spontanea dopo un infortunio18,19. L'applicazione clinica di SF-MSCs è stato coperto raramente nella letteratura, soprattutto perché i meccanismi di SF-MSCs nelle articolazioni rimangono indefiniti20. Jones et al. 21 ha riferito che i numeri di hSF-MSC nei giunti di ginocchio aumentano significativamente 7 volte durante le prime fasi dell'osteoartrite (OA). Pensavano che l'aumentata SF-MSCs potrebbero contribuire al mantenimento dell'omeostasi fisiologica delle articolazioni.

Un modello animale ideale è uno strumento indispensabile nello sviluppo di terapie che utilizzano la medicina rigenerativa e traslazionale. Anche se esistono differenze evidenti tra esseri umani e conigli, il coniglio è ampiamente utilizzato come modello animale per lo studio del tessuto rigenerazione7, così ci spinge a sceglierlo come il modello per il nostro studio di SF-MSCs. Uno degli ostacoli più arduo in questo sforzo è che l'isolamento di SF-MSCs spesso si traduce in tassi di successo varia e frequenze basse Colonia, come riportato nella precedente ricerca5. Di conseguenza, numerosi ricercatori hanno messo a fuoco sulle percentuali di successo e ottimizzazione dell'isolamento di cellule staminali mesenchimali da SF.

Questo studyeffectively ha utilizzato una procedura MACS per ordinamento ad alta purezza e vitalità di CD90+ MACSs dal coniglio fluido sinoviale22. Questo sistema Mac utilizza microperle magnetiche coniugate agli anticorpi altamente specifici, accoppiati ad un antigene di superficie cellulare particolare, CD90 in questo caso e consente la selezione del tipo di cella di destinazione particolare, vale a dire le cellule esprimenti CD90. Prima la purificazione con microsfere CD90, abbiamo solitamente coltura primario rbSF-MSCs per 14 giorni. Durante questo periodo, molte colonie sono formate in piastre di coltura. Questo protocollo suggerisce selezionando le colonie più grandi di 2 mm di diametro. Quando si utilizza il cilindro di clonazione per la selezione di Colonia, lo osserviamo con attenzione sotto il microscopio. La singola Colonia viene propagata ulteriormente per la purificazione.

Durante il processo di separazione e purificazione, le cellule esprimenti CD90 che sono state etichettate magneticamente sono attratti dal campo magnetico del separatore nella colonna, mentre le cellule senza etichetta flusso attraverso. Dopo il processo di lavaggio, la colonna viene rimossa dal campo magnetico del separatore, e le cellule bersaglio sono eluite dalla colonna. Questo approccio di Microperlina Mac specifico permette l'isolamento di rbSF-MSCs che espressa specificamente le cellule staminali gli indicatori di superficie CD44 e CD105, dimostrando che queste cellule isolate sono cellule staminali mesenchimali, piuttosto che le cellule emopoietiche23. Questi purificato rbSF-MSCs possono essere coltivate in vitro per un lungo tempo senza alcun cambiamento significativo delle caratteristiche morfologiche e dell'espressione dei marker. Inoltre, il rbSF-MSCs arricchito da Mac presentano una capacità di differenziazione multipotenti nelle celle multi-lignaggio, compresi in condrogenica, adipogenico e cellule osteogeniche.

L'operazione di Mac è un protocollo di facile--effettua e può essere fatto sulla panchina23. Inoltre, la US Food and Drug Administration (FDA) ha approvato la tecnologia della microperla-based Mac e quindi è facile da eseguire per applicazioni cliniche24. CD90 è un indicatore della superficie delle cellule staminali mesenchimali, e i ricercatori hanno dimostrato che CD90 positivo MSCs hanno un25,capacità di differenziazione condrogenica meglio26. La pluripotenza delle MSCs è stato caratterizzato basata sulla morfologia e l'espressione di marcatori specifici per le cellule staminali27.

Questo studio hanno diverse limitazioni. Il primo difetto di questo protocollo è imparentato con i marcatori di superficie che abbiamo esaminato. Basato su un'istruzione dalla società internazionale per la terapia cellulare (ISCT), i criteri minimi per la definizione di MSCs multipotenti è positivo per CD90, CD105, CD44 e CD73 e negativo per CD11b, CD14, CD34 o CD45, HLA-DR e CD79a28. Con l'obiettivo di attenuare lo sforzo e la spesa necessaria per l'intero pannello di prova, i ricercatori in questo studio accuratamente selezionati due degli indicatori negativi e due degli indicatori positivi consigliati. In secondo luogo, ci vuole molto tempo per formare le colonie che saranno selezionate per ulteriore studio. Inoltre, l'ipertrofia è un grave problema durante l'induzione condrogenica di SF-MSCs in vitro. Alla fase successiva, condrociti ipertrofici sempre espresso tipo X collagene (COLX), proteinasi metallica della tabella 13 (MMP13), della fosfatasi alcalina (ALP) e relativi runt trascrizione fattore 2 (Runx2)29. Ricerca suggerisce che la cultura di tridimensionale (3D) pellet, sistemi di cultura dinamica e il coculture con condrociti sono benefici per MSC stabile differenziazione condrogenica30,31. In questo studio, un sistema di coltura di pellet è stato utilizzato per l'induzione condrogenica di MSC per evitare l'ipertrofia.

In conclusione, abbiamo stabilito un metodo semplice per l'isolamento e la purificazione di MSCs dal fluido di lavaggio di cavità articolare e caratterizzato il MSCs ottenuto in esso. Questo protocollo ha fornito una piattaforma per l'esplorazione e la ricerca di programma di utilità potenziale degli articolare sinoviale liquido-derivato MSCs nelle strategie di rigenerazione comune romanzo.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

Acknowledgments

Questo studio è stato sostenuto finanziariamente dalle seguenti sovvenzioni: il Natural Science Foundation della Cina (n. 81572198; N. 81772394); il fondo per la costruzione di alto livello disciplina medica della Università di Shenzhen (No. 2016031638); il fondamento di ricerca medica della provincia del Guangdong, Cina (No. A2016314); Scienza di Shenzhen e progetti tecnologici (No. JCYJ20170306092215436; No. JCYJ20170412150609690; No. JCYJ20170413161800287; No. SGLH20161209105517753; No. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics