Magnético-ativado da pilha classificação estratégias para isolar e purificar sinovial fluidos derivados mesenquimais células-tronco de um modelo de coelho

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este artigo apresenta um protocolo simples e económico para o simples isolamento e purificação de células-tronco mesenquimais do líquido sinovial do coelho branco Nova Zelândia.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Células-tronco mesenquimais (MSCs) são a fonte principal da célula para a terapia baseada em células. MSCs de líquido sinovial cavidade articular potencialmente poderiam ser usados para engenharia de tecidos de cartilagem. MSCs de líquido sinovial (SF-MSCs) foram considerados candidatos promissores para a regeneração articular, e seu potencial benefício terapêutico fez-lhes um tópico de pesquisa importante de tarde. SF-MSCs da cavidade do joelho do coelho Nova Zelândia branco podem ser empregados como um modelo otimizado translacional para avaliar humana medicina regenerativa. Por meio de CD90 à base magnética registrados da célula classificação tecnologias (MACS), este protocolo com sucesso Obtém coelho SF-MSCs (rbSF-MSCs) deste modelo de coelho e mais totalmente demonstra o fenótipo MSC dessas células induzindo os para diferenciar a osteoblastos, adipócitos e condrócitos. Portanto, esta abordagem pode ser aplicada em pesquisa da biologia celular e engenharia de tecidos, utilizando procedimentos e equipamentos simples.

Introduction

MSCs têm sido sugeridos como uma fonte valiosa para a medicina regenerativa, especialmente, para lesões da cartilagem. MSCs, incluindo osteoblastos, condrócitos, adipócitos, miócitos esqueléticos e células estromais viscerais, amplamente expandem as áreas de transplante de células-tronco devido a sua alta expansão taxa e linhagem multi diferenciação potencial1. MSCs podem ser isolados do esqueleto muscular, membrana sinovial, medula óssea e tecido adiposo2,3,4. As conclusões têm também confirmed a presença de MSCs no líquido sinovial, e anterior pesquisa identificou MSCs derivado de líquido sinoviais (SF-MSCs) como candidatos promissores para regeneração articular5,6.

No entanto, pesquisa e experimentação pré-clínica em amostras humanas estão sujeitas a muitas questões éticas. Em vez disso, os coelhos têm sido e continuam a ser os mais usados espécies animais para demonstrar que o transplante de MSCs pode reparar danos na cartilagem. Nos últimos anos, um número crescente de pesquisadores estudaram células-tronco mesenquimais coelho (rbMSCs), ambos em vitro e em vivo, como estas células são MSCs semelhantes ao ser humano em sua fisiologia celular biologia e tecido. Da mesma forma, os rbMSCs são capazes de aderir a superfícies plásticas, morfologia do eixo-fibroblasto como humanos MSCs. Além disso, amostras de mesenquimais coelho são simples e fáceis de obter7. Além disso, os pontos cruciais são que o rbMSCs expressar marcadores de superfície, tais como CD44, CD90 e CD105, e que o potencial de diferenciação de linhagem multi é preservada, que está de acordo com os critérios para a identificação de populações de MSC como definida pela sociedade internacional de terapia celular8,9. Em particular, chondroprogenitors de líquido sinoviais são capazes de não-hipertrófica condrogênese quando induzido por TGF-β1, tornando-os fontes de celular adequada para a cartilagem articular fenotipicamente regeneração10,11, 12.

No entanto, o isolamento de SF-MSCs é muito diferente de outros tecidos, incluindo o cordão umbilical, tecido adiposo, sangue periférico e medula óssea. Atualmente, as abordagens mais comuns para a purificação e a classificação de SF-MSCs são citometria de fluxo e Fima baseado no grânulo classificação, embora o método de citometria de fluxo requer um ambiente específico e altamente caro instrumentos13.

Este artigo apresenta um procedimento simples e minimamente invasivo coleção de amostras de líquido sinovial da Nova Zelândia coelhos brancos. Durante o procedimento, os MSCs-rbSF são estàvel expandido em vitro e então isolaram com CD90 positivo magnética do grânulo procedimentos baseados. Finalmente, o protocolo mostra como obter o MSCs com um elevado grau de pureza e viabilidade das fontes de células colhidos.

Neste protocolo, os rbSF-MSCs isoladas são caracterizadas com base na sua morfologia, expressão de marcadores específicos e pluripotência para células-tronco. Immunophenotyping baseados em citometria de fluxo revela uma expressão significativa e positiva de CD44 e CD105, Considerando que a expressão de CD45 e CD34 é negativa. Finalmente, um ensaio em vitro para rbSF-MSCs demonstra a diferenciação osteogênica, adipogenic e chondrogenic dessas células.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os animais de experimentos foram conduzidos em conformidade com as diretrizes regionais do Comitê de ética, e todos os procedimentos de animais foram aprovados pelo cuidado institucional do Animal e do uso Comissão de Shenzhen segundo pessoas Hospital, Universidade de Shenzhen.

1. isole e cultura as rbSF-MSCs

  1. Preparativos para o procedimento de animais
    1. Preparar com esqueleto maduro feminina Nova Zelândia coelhos brancos para a coleção de rbSF-MSCs. realizar um exame clínico dos coelhos um dia antes do procedimento de anestesia e artrocentese.
      Nota: o exame físico deve incluir peso (2.0-2.5 kg), gênero (feminino) e temperatura corporal, frequência respiratória e cardíaca. Intervalos de parâmetro para coelhos clinicamente saudáveis são 30-50 min para a taxa de respiração, 220-280 min para a frequência cardíaca e 38-39 ° C para a temperatura do corpo.
    2. Rapidamente os animais para 6 h antes da anestesia.
  2. Preparações e procedimento para a anestesia de animais
    1. Conter o coelho com uma gaiola (ver Tabela de materiais) e em seguida, injetar 3% pentobarbital de sódio na veia marginal da orelha, na dose de 1 mL/kg para anestesia geral.
    2. Coloque o coelho em uma posição confortável e dorsal-reclinada.
    3. Monitore a frequência respiratória, frequência cardíaca e temperatura do corpo do coelho durante a anestesia.
    4. Use pomada oftalmológica em seus olhos, para evitar o ressecamento durante a anestesia.
    5. Avalie a profundidade da anestesia classificação14 de Guedela seguir.
  3. Preparação para MSCs isolamento e cultivo
    1. Para cultivar rbSF-MSCs, preparar 500 mL de meio de cultura comercial (ver Tabela de materiais) suplementado com 10% de comercial complementar (ver Tabela de materiais), 10% soro fetal bovino (FBS) e 1% penicilina-estreptomicina.
    2. Incube o meio de cultura a 37 ° C em banho-maria.
    3. Prepare 500 mL de soro fisiológico de tampão fosfato (PBS) para isolamento de célula e a lavagem da célula.
    4. Prepare 100 mL de solução salina isotônica para o procedimento de artrocentese cavidade do joelho.
  4. Coleção de uid disquete sinovial articular do joelho do coelho
    1. Selecione uma área de cerca de 5 x 5 cm de tamanho em torno do joelho e raspar o pelo de coelho dessa área usando um barbeador elétrico de segurança.
    2. Alternadamente, desinfectar o local de procedimento 3 x com povidona iodo solução e 75% de etanol. Em seguida, aplica sterile drapeja depois que a área tem secado completamente.
    3. Injectar 1-2 mL de solução salina isotônica, usando uma seringa hipodérmica estéril (2 mL), para a cavidade articular do joelho do espaço articular lateral, mova o joelho x 3-4 e depois sugar todo o líquido sinovial em temperatura ambiente.
    4. Filtre o fluid sinovial através de um filtro de célula de nylon µm 40 para remover quaisquer detritos dentro de 4 h.
  5. Cultura dos rbSF-MSCs
    1. Recolha o filtrado fluid em tubos de centrífuga de 50 mL e centrifugar a 1.500 rpm durante 10 minutos à temperatura ambiente.
    2. Descartar o sobrenadante após a centrifugação, lavar a pelota com PBS, resuspenda o pellet com meio de cultura completo e então o meio em pratos de 100 mm da placa.
    3. Incube os pratos a 37 ° C numa atmosfera umidificada contendo 5% de CO2.
    4. Após 48 h, reabastecer os pratos com meio fresco para remover todas as células não-aderentes. Substitua o médio duas vezes por semana durante 2 semanas como passagem 0 (P0).
      Nota: Deve haver cerca de 1 x 104 células aderentes. Células/ml viável em SF são cerca de 2 x 102/mL.
    5. Após 14 dias o chapeamento inicial, muitas colônias devem ter se formado nos pratos de cultura. Selecione as colônias maiores que 2 mm de diâmetro. Mark, onde localizam-se as colônias selecionadas traçando sua circunferência na parte inferior do prato.
    6. Descarte as colônias < 2 mm de largura, utilizando raspadores de célula. Digerir as colônias selecionadas com cerca de 5 µ l de tripsina 0,25%, usando um cilindro de clonagem e transferir as colônias para um novo prato como passagem 1 (P1).
  6. Cuidados pós-operatórios de animais
    1. Siga os procedimentos de funcionamento institucionais padrão para acompanhamento pós-operatório e recuperação da anestesia.
    2. Monitore os sinais vitais o cada 10 min coelho até que ele recuperou a consciência. Finalmente, transfira o animal consciente para a gaiola. Não retornam um coelho que se submeteu a cirurgia para a companhia de outros animais até que ele se recuperou totalmente.
    3. Pós-operação, desinfecte o local com 0,1% de iodopovidona, 2x ao dia por 3 dias.

2. CD90-positivo magnético ativado celular classificação (MACS) do rbSF-MSCs e cultura primária

  1. Preparação da amostra
    1. Quando as células chegam em torno de confluência de 80%, Aspire o meio e em seguida, adicione 1-2 mL de 0,25% Trypsin-EDTA para cada prato.
    2. Incube os pratos para 2-3 min permitir o desprendimento de células.
    3. Uma vez que as células são desanexadas, adicione uma quantidade igual de meio de cultura para inactivar a tripsina.
    4. Passar a suspensão de células através de um filtro de célula de 40 µm, recolher o filtrado em um tubo de 15 mL e em seguida girar para baixo as células a 600 × g por 10 min à temperatura ambiente.
    5. Resuspenda o pellet de células em MACS executando o tampão (PBS, pH 7.2, albumina de soro bovino 0,5% e 2 mM EDTA) e em seguida, contar o número de celular.
  2. Rotulagem magnética
    Nota: Classificar os MSCs-rbSF com uma kit contendo separadores (ver Tabela de materiais), um carrinho e colunas de classificação magnética-ativado da pilha.
    1. Determine o número de células usando um hemocytometer.
    2. Centrifugar a suspensão de eritrócitos a 300 × g por 10 min a 4 ° C. Completamente, Aspire o sobrenadante.
    3. Adicione 80 µ l de tampão de ressuspensão por 107 células total.
    4. Para 107 células total, adicione 20 µ l de microbeads conjugado com anticorpo monoclonal anticoelho CD90.
    5. Misture as esferas magnéticas e células uniformemente nos tubos e, em seguida, incube-os a 4 ° C por 15 min no escuro.
    6. Adicionar 1 mL de tampão por 107 células ao tubo e centrifugá-la a 300 × g por 10 min a 4 ° C, para lavar as células. Desprezar o sobrenadante após a centrifugação.
    7. Resuspenda o pellet em 500 µ l de buffer por 107 células.
  3. Separação magnética
    1. Coloque a coluna com as asas de coluna para a frente no campo magnético do separador magnético.
    2. Lave a coluna de separador magnético (MS) com 500 µ l de buffer por 107 células.
    3. Transferi a suspensão única célula na coluna. Deixe que as células negativas passar através do campo magnético para descartar essas células sem rótulo.
    4. Lavar a coluna 1-2x com 500 µ l de buffer por 107 células e descartar o escoamento.
    5. Transferi a coluna para um tubo de centrifugação (15 mL).
    6. Adicionar 1 mL de tampão de por 107 células para a coluna e então imediatamente empurrar o êmbolo para a coluna para retirar as pilhas etiquetadas magneticamente.
    7. Repita o procedimento acima com uma segunda Column MS para aumentar a pureza do CD90+ células, que podem enriquecer a fração eluted.
    8. Centrifugar a suspensão celular de 300 × g durante 10 minutos, aspirar o sobrenadante e ressuspendê-lo com meio de cultura.
  4. Cultura da CD90+ rbSF-MSCs
    1. Inocule as células em pratos de 100 mm, após a separação magnética celular ativado.
    2. Incube a 37 ° C numa incubadora de célula umidificado com 5% CO2pratos.
    3. Quando a confluência de 80-90% da cultura primária é alcançada, em aproximadamente 7-10 dias, digerir as células aderentes com 0,25% Trypsin-EDTA e passagem-los em uma diluição de 1:2 para fazer a passagem 2 (P2).
    4. Use o mesmo método para passar as células de passagem 3 (P3), que podem ser usadas para os ensaios em vitro .
      Nota: Após a sub-cultura e purificação, são obtidos aproximadamente 1 x 107 rbSF-MSCs.

3. identificação do rbSF-MSCs

  1. Confirmação de marcador de superfície das rbSF-MSCs por citometria de fluxo
    1. Quando os MSCs confluente de 80-90%, em P3, lavam-se as células com PBS e tratá-los com 1 mL de 0,25% Trypsin-EDTA. Em seguida, incube os MSCs a 37 ° C durante 2-3 minutos até que as células são desanexadas.
    2. Colher as células usando 10 mL de PBS, transferi-los para um tubo cónico (15 mL) e centrifugá-los a 300 × g por 5 min à temperatura ambiente.
    3. Descarte os sobrenadantes. Ressuspender as células em 500 µ l de PBS e transferir para um tubo de 1,5 mL.
    4. Incubar uma diluição de 1: 100 de anticorpos conjugado FITC e PE-conjugados (isotipo, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) por 1h no escuro a 4 ° C.
    5. Esta mistura a 300 × g por 5 min à temperatura de centrifugação e lavar as células duas vezes com PBS por centrifugação a 300 × g por 5 min cada tempo. Descarte os sobrenadantes.
    6. Ressuspender as células em 500 µ l de PBS, transferir a suspensão de células para um tubo de fundo redondo (5 mL) e analisá-lo usando um citômetro de fluxo.
      Nota: Aquisição de dados em um citômetro equipado com dois canais de fluorescência: 533/30 e 585/40. Para cada fluorescência isotype, usar o isotipo controle para ajustar a tensão apropriada do laser e definir a intensidade mínima necessária para obter um histograma de fluorescência que exibe as bordas esquerdas e direita do pico. Recolha um mínimo de 10.000 eventos para as análises estatísticas.
  2. Multidifferentiation dos rbSF-MSCs
    Nota: Uso P3 rbSF-MSCs para os ensaios multidifferentiation em vitro .
    1. Diferenciação osteogênica
      1. Prepare o suporte de indução osteogênica: DMEM basic (1x), contendo 50 milímetros de L-ascórbico ácido-2-fosfato 10 mM de α-glicerofosfato e 100 nM de dexametasona.
      2. As células a 103 células/cm2 em uma placa de cultura de tecidos de 6-poços de sementes e cultura-los no meio de indução osteogênica.
      3. Altere o meio de indução em 3 dias por 3 semanas.
      4. Consertar as células com formol 4% durante 30 min à temperatura ambiente, depois de concluída a diferenciação, as células de mancha com vermelho de alizarina 1% por 5 min e depois lavar os 3 x com PBS15.
    2. Diferenciação de Adipogenic
      1. Prepare o suporte de indução de adipogenic: DMEM basic (1x), consistindo de 100 mM de indometacina, 10 mg/mL de insulina humana recombinante, 1mm de dexametasona e 0,5 mM de 3-isobutil-1-methylxanthine.
      2. Trate os P3 rbSF-MSCs para 3 semanas no meio de indução de adipogenic.
      3. Após 3 semanas, mancha os vacúolos de lipídios neutros usando O vermelho de óleo para confirmar a diferenciação de adipogenic. Consertar as células em uma solução de formol 4% durante 30 min à temperatura ambiente e em seguida lavá-los 3x com PBS16.
    3. Chondrogenic diferenciação
      1. Prepare o suporte de indução de chondrogenic: DMEM basic (1x), consistindo de 10 ng/mL de TGFβ1, 1% de seu suplemento, 0,35 mM de L-prolina, 100 nM de dexametasona, 50mm de L-ascórbico ácido-2-fosfato e 1 mM de piruvato de sódio.
      2. Use o pellet de cultivo para a indução de chondrogenic. Centrifugue a 5 × 105 P3 rbSF-MSCs a 1500 rpm durante 10 minutos em um tubo de polipropileno (15 mL) para formar um pellet.
      3. Cultura as pelotas por 3 semanas com o meio de indução de chondrogenic.
      4. Altere o meio de cada 3 dias por 3 semanas.
      5. Após a indução de 3 semanas, incorporar o centrifugado com parafina, seção-lo em fatias de 4 mm e manchá-las usando 0.1% azul de toluidina por 30 min à temperatura ambiente de17.
  3. Extração de RNA total e análise por reação em cadeia da polimerase em tempo real quantitativa (qRT-PCR)
    1. Isolar o RNA total das células após a indução da diferenciação de 3 semanas usando a extração de RNA comercial kit (veja a Tabela de materiais).
      1. Remover o meio de cultura a placa de cultura e, em seguida, adicione 1 mL do reagente de isolamento.
      2. Lise as células pipetando repetidamente até que a solução é homogênea. -Incube à temperatura ambiente por 3 min.
      3. Transferi o lisado celular em um tubo de microcentrifugadora de 1,5 mL.
      4. Adicione 100 µ l de clorofórmio, agitá-lo pela mão de 15x e incubar a mistura à temperatura ambiente por 3 min.
      5. Centrifugar o tubo a 12.000 × g por 15 min a 4 ° C. Transferi os sobrenadantes para um novo tubo de microcentrifuga de 1,5 mL.
      6. Adicionar 500 µ l de isopropanol e precipitar o RNA durante 10 minutos à temperatura ambiente.
      7. Centrifugar a 12.000 × g por 10 minat 4 ° C. A pelota do RNA deve ser visível na parte inferior do tubo.
      8. Remover o sobrenadante e em seguida, adicione 500 µ l de etanol a 75%. Brevemente, gire o tubo durante vários segundos para lavar a pelota do RNA. -Centrifugar a 7.500 × g por 5 min a 4 ° C.
      9. Remova o etanol residual.
      10. Dissolva a pelota do RNA em 10 µ l de água DEPC e coloque os tubos no gelo.
    2. Reverso transcrever total do RNA em cDNA com uma síntese de DNA kit (veja a Tabela de materiais).
      Nota: Execute todos os procedimentos a seguir no gelo.
      1. Prepare a mistura de mestre de transcrição reversa.
      2. Adicione 25 µ l de RNA DNase-tratados a cada tubo com 1 µ g de RNA.
      3. Incubar a mistura a temperaturas a seguir usando um termociclador PCR: 26 ° C durante 10 minutos (para permitir os hexâmeros aleatórios recozer), 42 ° C por 45 min (transcrição reversa) e 75 ° C por 10 min (inactivar o transcriptase reversa).
      4. Imediatamente analisar o cDNA resultante por PCR quantitativo em tempo real, ou armazená-lo a-20 ° C.
    3. Realizar a análise de expressão do gene com um sistema PCR quantitativo em tempo real.
      1. Use o qRT-PCR Master Mix (consulte Tabela de materiais) para realizar o PCR. Os primers PCR para GAPDH, Runx2, Agg e PPARγ estão listados na tabela 1.
      2. Calcule a expressão gênica usando o métodoΔΔCT 2.
      3. Realizar uma análise estatística usando o software padrão estatístico. Use um teste t de amostras independentes para comparar os meios do grupo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolamento, purificação e cultura dos MSCs-rbSF:
Este protocolo usa MACS para isolar rbSF-MSCs, baseados na expressão do marcador de superfície MSC CD90. Um diagrama de fluxo de processo de rbSF-MSCs isolamento, purificação e caracterização e o protocolo de cultura em vitro é mostrado na Figura 1.

Morfologia celular após magnético celular ativado classificação (MACS) com CD90:
Em primeiro lugar, para MACS, immunolabel MSCs com grânulos magnéticos CD90. Após a centrifugação, resuspenda um máximo de 107 células em 80 µ l de um buffer de classificação pré-resfriado e em seguida, adicionar 20 µ l de grânulos magnéticos CD90, seguido de incubação a 4 ° C por 15 min e num Vortex. Depois disso, lavar as células com 1 mL de tampão de classificação e Resuspenda-los em 500 µ l de buffer de classificação. Antes de prosseguir com a ordenação magnética, repita a etapa de lavagem. Este procedimento crítico é mostrado na Figura 2.

Antes de classificação, as populações de células de líquido sinovial aderente coelho exibido morfologia heterogênea, contendo célula diversos tipos e tamanhos (Figura 3A-C). Na sequência de MACS, as populações de célula exibiram morfologia homogênea. O número de células foi aumentado com a sub-cultura (Figura 3D-F).

Características de MACS enriquecido rbSF-MSCs de superfície:
Classificação de célula fluorescência-ativado (FACS) foi realizada para analisar o enriquecimento de rbSF-MSCs por MACS com CD90. Antes do MACS, população celular consistia de aproximadamente 40% MSCs (Figura 4D; isotipo controles na Figura 4A,B). Na sequência de MACS, população enriquecida continha aproximadamente > 99% MSCs (Figura 4E,F). Os marcadores de células hematopoiéticas linhagem CD34 e CD45, em 0.318%, ambos raramente manifestaram-se depois de MACS, que é um declínio de sua expressão inicial em 25,9%. Antes da seleção, havia cerca de 28% CD90+ células (Figura 4); após a purificação, cerca de 98% CD90+ células foram obtidas (Figura 4 H).

Multilineage diferenciação potencial do MSCs-rbSF:
Para caracterizar a capacidade de rbSF-MSCs de se diferenciar em várias linhagens tais como osteogênica, adipogenic e células chondrogenic, os MSCs-rbSF enriquecidos por MACS foram simultaneamente cultivadas em um meio de diferenciação específica e em um meio de diferenciação sem citocina para servir como controles. Quando completou-se a indução, marcadores de linhagem-específicos foram analisados pela coloração e RT-PCR. Alizarina vermelha de coloração dos compostos de cálcio demonstrou que nódulos mineralizados tinham formaram os MSCs-rbSF após 3 semanas sob as condições de indução osteogênica (Figura 5A). Após 3 semanas de indução de adipogenic, acúmulo de vacúolos rica em lipídios pode ser detectado por intracelular óleo vermelho O mancha (Figura 5B). Durante 21 dias de indução de chondrogenic, o centrifugado histologicamente foi analisado com coloração azul de toluidina. Células positivas para coloração (para proteoglycan) foram consideradas como células condrócitos (Figura 5). Semelhante a este resultado, uma análise quantitativa da expressão do potencial de diferenciação gene também demonstrou a capacidade de diferenciação dessas células. Os níveis de expressão de Agg (um marcador de condrócitos) e PPARγ (um marcador de adipogenic) Runx2 (um marcador do osteoblasto) foram upregulated em condições induzidas. Estes dados provaram a capacidade de diferenciação multipotentes de rbSF-MSCs em trilineages (Figura 5).

Figure 1
Figura 1: esquema completa de isolamento, purificação e caracterização dos SF-MSCs de coelhos Nova Zelândia branco. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: protocolo para magnético celular ativado classificação (MACS) com CD90. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: morfologia da monocamada cultivadas rbSF-MSCs antes e depois de MACS como examinados sob comum invertido microscopia. A-C) Antes de classificação, as populações de células de líquido sinovial aderente coelho exibem heterogeneidade. Eles contêm célula diversos tipos e tamanhos, tais como oval, longo-eixo, eixo curto e morfologia estrelada. A morfologia principal de P2 e P6 é uma morfologia do eixo (A: P2, B: P3, C: P6). D-F) Na sequência de MACS com CD90, as populações de células apresentam uma morfologia homogênea. Com uma sub-cultura, aumenta o número de células (D: P2, E: P3, F: P6). Barra de escala = 100 µm. clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: identificação de marcadores de superfície rbSF-MSC. Usando análise de citometria de fluxo, os MSCs-rbSF são positivos para os marcadores MSC CD44 e CD105, enquanto negativo para o marcador de células endoteliais CD34 e o marcador de células hematopoiéticas CD45. Antes de MACS, estas células têm uma baixa taxa de positividade para CD44 e CD105. No entanto, depois de MACS, a taxa de positividade foi alta. A, B) Esses top duas imagens mostram os dados do isotipo controle. C, D) Estes resultados mostram que antes de MACS a população rbSF-MSC é composta por cerca de 40% de células MSC. E, F) Depois de MACS, a população enriquecida contém células MSC > 99%. G, H) Estas imagens mostram a análise de citometria de fluxo da CD90+ marcador, (G) antes e (H) após a classificação de MACS. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: análise de marcadores de linhagem específica pela coloração e RT-PCR. A) alizarina coloração vermelha demonstra que mineralizado nódulos formam sob a indução osteogênica por 3 semanas. B) após 3 semanas de indução de adipogenic, o acúmulo de vacúolos rica em lipídios é detectado pela mancha de óleo vermelho O intracelular. C) para 3 semanas de indução de chondrogenic, o centrifugado histologicamente foi analisado com coloração azul de toluidina. Células positivas para coloração (para proteoglycan) foram consideradas como células condrócitos. Barra de escala = 100 µm. D) após cultivo por 3 semanas, o mRNA relativo, expressão de marcadores de osteoblastos (Runx2), marcadores de adipogenic (PPARγ) e marcadores chondrogenic (Agg) é detectado. Para todas as análises, p valores < 0,01 foram considerados estatisticamente diferenças significativas através do teste de Kruskal-Wallis (mostrada como * *). Clique aqui para ver uma versão maior desta figura.

Genes Encaminhar a cartilha (5'-3') Reverter a primeira demão (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabela 1: Lista de genes e primers utilizados neste estudo por PCR quantitativo em tempo real.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

A existência de MSCs no líquido sinovial fornece uma alternativa para a terapia baseada em células. Estudos anteriores mostraram que a lesão sites contêm quantidades mais elevadas de células-tronco mesenquimais em seu líquido sinovial, que pode ser positivamente correlacionada com o período pós-lesão5. Os MSCs no líquido sinovial podem ser benéficos para o tecido, para reforçar a cura espontânea após uma lesão18,19. A aplicação clínica de SF-MSCs raramente foi regravada na literatura, principalmente porque os mecanismos dos SF-MSCs em articulações permanecem indefinidos20. Jones et al. 21 relataram que números hSF-MSC em articulações de joelho aumentam significativamente 7-fold durante os estágios iniciais de osteoartrite (OA). Eles pensaram que o SF-MSCs aumentadas podem contribuir para manter a homeostase fisiológica das articulações.

Um modelo animal ideal é uma ferramenta indispensável no desenvolvimento de terapêuticas utilizando a medicina regenerativa e de translação. Embora existem diferenças óbvias entre seres humanos e coelhos, o coelho é usado extensivamente como um modelo animal para o estudo do tecido regeneração7, assim, levando-na escolhê-lo como modelo para nosso estudo de SF-MSCs. Um dos obstáculos mais assustadores neste esforço é que o isolamento de SF-MSCs muitas vezes resulta em taxas de sucesso variado e frequências de colônia baixa, como relatado no anterior pesquisa5. Portanto, numerosos pesquisadores têm incidido sobre as taxas de sucesso e otimização da isolação do MSCs de SF.

Este studyeffectively utilizado um procedimento de MACS para classificação de alta pureza e viabilidade do CD90+ MACSs de22coelho de líquido sinovial. Este sistema de MACS utiliza microbeads magnéticos conjugados com anticorpos altamente específicos, acoplados a um antígeno de superfície de célula específica, CD90, neste caso e permite a seleção do tipo de células de destino específico, nomeadamente CD90 células expressando. Antes a purificação com microbeads CD90, nós geralmente cultura os principais rbSF-MSCs para 14 dias. Durante este período, muitas colônias são formadas nos pratos de cultura. Este protocolo sugere selecionando as colônias maiores que 2 mm de diâmetro. Ao usar o cilindro de clonagem para a seleção de colônia, cuidadosamente observamos sob o microscópio. A única colônia é mais propagada para a purificação.

Durante o processo de separação e purificação, as células expressando CD90 que foram rotuladas magneticamente são atraídas pelo campo magnético do separador na coluna, Considerando que as células sem rótulo de vazão. Após o processo de lavagem, a coluna é removida do campo magnético do separador, e as células de destino são eluídas da coluna. Esta abordagem específica de Microconta MACS permite o isolamento de rbSF-MSCs que expressa especificamente as células-tronco superfície marcadores CD44 e CD105, demonstrando que essas células isoladas são as células-tronco mesenquimais, ao invés de células hematopoiéticas23. Estes rbSF-MSCs purificados podem ser cultivadas em vitro durante um longo tempo sem qualquer alteração significativa das características morfológicas e expressão do marcador. Além disso, os MSCs-rbSF enriquecidos por MACS exibem uma habilidade multipotentes diferenciação em células de linhagem multi, incluindo em células osteogênicas, adipogenic e chondrogenic.

A operação de MACS é um protocolo de fácil-para-executar e pode ser feita em banco23. Além disso, a Food and Drug Administration (FDA) aprovou a tecnologia de MACS baseados em Microconta, e assim é fácil de executar para aplicações clínicas24. CD90 é um marcador de superfície de células-tronco mesenquimais, e pesquisadores têm mostrado que CD90 MSCs positivos tem uma melhor diferenciação de25,chondrogenic capacidade26. A pluripotência das MSCs tem sido caracterizada com base na morfologia e a expressão de marcadores específicos para as células-tronco27.

Este estudo tem várias limitações. A primeira lacuna deste protocolo está relacionada com os marcadores de superfície que examinamos. Com base em uma declaração pela sociedade internacional para terapia celular (ISCT), os critérios mínimos para definir multipotentes MSCs é positivo para CD90, CD105, CD44 e CD73 e negativo para CD11b, CD14, CD34 ou CD45 e CD79a ou HLA-DR28. Com o objetivo de atenuar o esforço e a despesa necessária para testar o painel inteiro, os investigadores neste estudo cuidadosamente selecionados dois dos marcadores negativos e dois dos marcadores positivos recomendados. Em segundo lugar, é preciso muito tempo para dar forma as colônias que serão selecionadas para um estudo mais aprofundado. Além disso, a hipertrofia é um grande problema durante a indução de chondrogenic de SF-MSCs em vitro. Em fase posterior, o colágeno tipo sempre expresso X de condrócitos hipertrófica (COLX), matriz metaloproteinase 13 (MMP13), fosfatase alcalina (FAL ou ALP) e relacionados ao anão transcrição fator 2 (Runx2)29. A pesquisa sugere que a cultura da pelota (3D) tridimensionais, sistemas de cultura dinâmica e o coculture com condrócitos são benefício para MSC estàvel chondrogenic diferenciação30,31. Neste estudo, um sistema de cultura de pelotas foi usado para indução de chondrogenic da MSC para evitar hipertrofia.

Em conclusão, temos estabelecido um método simples para o isolamento e purificação de MSCs do fluido de lavagem de cavidade articular e caracterizado os MSCs obtidos nele. Este protocolo forneceu uma plataforma de pesquisa e investigação da utilidade potencial dos articular sinovial líquido-derivado MSCs em estratégias de regeneração conjunta romance.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que eles têm não tem interesses financeiro concorrente.

Acknowledgments

Este estudo foi suportado financeiramente pelos seguintes subsídios: Fundação de ciências naturais da China (n. º 81572198; N. º 81772394); o fundo para a construção de alto nível de disciplina médica da Universidade de Shenzhen (n º 2016031638); a Fundação de pesquisas médicas da província de Guangdong, China (n. º A2016314); e ciência de Shenzhen e tecnologia de projetos (n. º JCYJ20170306092215436; Não. JCYJ20170412150609690; Não. JCYJ20170413161800287; Não. SGLH20161209105517753; Não. JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics