Lipopolysaccharide enjeksiyon bağırsak bariyer ihlali sonra giriş ürünlerin mikrobiyal kaynaklı taklit etmek için fareler içine

Immunology and Infection
 

ERRATUM NOTICE

Summary

Burada bağırsak bariyer ihlali sonra girişinde bileşiklerin bakteriyel kaynaklı taklit için bir protokol sunulmuştur. Lipopolysaccharide sublethal düşük dozda sistemik 24 saat sonrası enjeksiyon için izlenen fareler içine enjekte ettiler. Pro-inflamatuar sitokinlerin ifade dalak, karaciğer ve iki nokta üst üste birkaç saat noktada tespit edilmiştir.

Cite this Article

Copy Citation | Download Citations

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bağırsak epitel bariyer normalde tolere veya göz ardı microbiota konaktan ayırır. Bu bariyer ihlali ana bilgisayar dolaşım ve iç organların iltihabi bağırsak hastalığı (IBD) olgularda gözlenen gibi kontrolsüz iltihap için önde gelen erişim ana bilgisayar içine bakteri veya bakteri kaynaklı ürün giriş sonuç bu tarafından artan bir bağırsak epitel geçirgenliği ile karakterizedir.

Ana girişinde bileşiklerin bakteriyel kaynaklı taklit etmek için bir endotoksemi modeli kabul hangi lipopolysaccharide (LPS), gram-negatif bakteri dış hücre duvarına bir bileşenidir, fareler enjekte edildi. Bu çalışmada, LPS sublethal bir doz intraperitoneally enjekte ettiler ve fareler daha sonra 8 h bir hastalık Puan kullanarak takip. Ayrıca, Il6, Il1b ve Tnfa inflamatuar sitokinlerin düzeyde dalak, karaciğer ve kolon qPCR farklı zaman noktalarda tarafından analiz edildi ifade LPS enjeksiyon sonrası. Bu model bağışıklık yanıtı araştırmaların ardından mikroorganizmalar veya vücut yüzeyleri bariyer ihlali tarafından neden olduğu bakteriyel kaynaklı ürünler işgali ile ilgili çalışmaları için yararlı olabilir.

Introduction

İnsan bağırsak bir karşılıklı yararlı ilişkilerini evrimi sırasında ana bilgisayar ile geliştirmiştir microbiota, oluşturan mikroorganizmaların büyük bir konsorsiyum ile kolonize. Vitaminler, besin sindirim ve patojenler koruma microbiota1bulunduğu ana bilgisayara microbiota sağlar, ancak bu ilişkide, ana bilgisayar güvenli bir niş microbiota için sağlar. Ev sahibi ve microbiota yararlı bu ilişkisi rahatsız zaman, iltihabi bağırsak hastalığı (IBD) gibi hastalıklar gelişebilir. IBD bir multifaktöriyel kronik inflamatuar iki önemli biçimde, Crohn hastalığı (CD) ve Ülseratif Kolit (UC) oluşan genetik ve çevresel faktörler nedeniyle bağırsak hastalığıdır. İki IBD form arasındaki benzerlikler olsa da, onlar konum ve inflamatuar değişiklikler doğası bazı farklılıklar karakterizedir. CD UC transmural sigara ve kolon sınırlı iken potansiyel olarak gastrointestinal sistem herhangi bir bölüme genişletebilirsiniz bir relaps transmural inflamatuvar hastalıktır. Ayrıca, mutasyonlar nükleotit bağlama Oligomerizasyonda etki alanını içeren protein 2 (NOD2), Muramil dipeptid (MDP), bir bileşeni en gram-pozitif - negatif bakteriler, hücre duvarı tanıdığı bir desen tanıma reseptör (PRR) olduğunu CD2ile ilişkili. Ayrıca, Escherichia coli (e.coli), Listeria ve streptokok ürünlerini tüm makrofajlar içinde bir bariyeri sonra3ana girdiğiniz CD hastalarda bulunmuştur. Bakteri veya ürünlerini ana CD geliştirilmesi sırasında girdiğinizde, anti-bakteriyel antikorlar4dolaşan üretimi için önde gelen bir yanıt bağışıklık sistemi geliştirir. Belki de, en inandırıcı kanıt microbiota IBD patogenezinde rol için fare modelleri kaynaklanıyor. Hayvanlar antibiyotiklerle tedavi edilir zaman, ya da fareler döl-özgür (GF) koşullarda tutulur, hastalığın şiddeti en kolit modellerinde gibi farelerde IL-10-/-kolit GF İmkanları5,6geliştirdiğiniz değil azalır. Ayrıca, kolit da dengesiz bir kompozisyon ile karakterizedir ve dysbiosis7denilen zenginlik azaltılmış microbiota bileşimi rahatsız ediyor. Mikroplar ve mikrobiyal kaynaklı ürünler girişine doğru ev sahibi açabilir artan bir bağırsak geçirgenliği IBD sonucu olabilir.

Hayvanlarda, uygulama Dextran sodyum sülfat (DSS) epitel bariyer8bir artan geçirgenliği için önde gelen bir bağırsak epitel gedik neden olmaktadır. DSS kolit9ile hayvanlarda Portal LPS konsantrasyonları yüksek. İlginçtir, C tipi lektin reseptör belirli hücre içi adezyon molekülü-3 eksik hayvanlar nonintegrin kapma homolog ile ilgili 1 (işareti-R1) DSS kolit ve LPS kaynaklı endotoksemi10korunur. Daha fazla ana bilgisayar yaymak için bakteri veya türetilmiş bakteri ürünleri vasküler bariyer11, küçük ve büyük bağırsak bulunur Periton boşluğuna, Mezenterik lenf düğümleri ve/veya karaciğer12geçmek zorunda. Bu sistem karmaşıklığını azaltmak için tanımlanmış bir bakteriyel kaynaklı bileşik kullanıldı. LPS, endotoksemi yol açan mayi (IP) veya Intravenous (IV) sonra enjeksiyon13 İnterlökin Il6 ifade ve Bab ve sitokin Tnfa LPS karşılık olarak çalışmaya fareler, içine enjekte.

LPS olduğunu lipid A oluşan bir hücre duvarı bileşeni Ayagin Gram-negatif bakteriler, olarak ifade edilen bir patojen ilişkili moleküler desen (PAMP) (LPS yapısı ana PAMP), çekirdek oligosakkarit ve bir O zinciri14yan. Toll benzeri reseptör dendritik hücreler, makrofajlar ve epitel hücreleri tarafından ifade edilen 4 (TLR4) Co reseptörleri için uygun bağlama gerektiren LPS15, tanır. Akut Faz LPS farklılaşma 14 kümeye LPS (CD14), bir glycosylphosphatidylinositol bağlantılı membran protein aktarır bir kompleks oluştururlar, protein LPS-bağlayıcı protein (LBP) bağlar. CD14 daha fazla LPS lenfosit antijeni 96 veya diğer adıyla MD-2, TLR4 ekstrasellüler etki alanı ile ilişkili olduğu taşırma su bendi kapakları. MD-2 LPS bağlama Miyeloid farklılaşma İlköğretim içeren aşağı akım sinyal yolu14, etkinleştirmek için hücre içi adaptör molekülleri askere konformasyon değişiklikleri ikna etmek için TLR4/MD-2 dimerization kolaylaştırır Yanıt gen 88 (MyD88) - bağımlı yolu ve tır etki alanını içeren adaptör-inducing interferon-β (TRIF) - bağımlı yolu16. LPS TLR4 tarafından tanınması sonra NF-κB yolu etkinleştirir ve proinflamatuar sitokinler, TNFα, Il-6 ve IL-1β17gibi ifadesi indükler.

LPS enjekte edilir zaman hayvanlar, hayvanlar için verilen LPS konsantrasyonu içine özellikle, hayvan ve diyet genetik arka plan kabul gerekir. LPS yüksek konsantrasyonda hipotansiyon ve birden fazla organ arızaları, ile karakterize bir septik şoka yol açar ve sonunda ölüm18. Fareler nerede LPS konsantrasyonları 2-4 ng/kg vücut ağırlığı (BW) arasında bir sitokin fırtına19ikna edebiliyoruz daha az göre uzatmaktı, LPS duyarlıdır. Fareler için öldürücü doz (LD50), hangi ölüm yarısı 10-25 mg/kg BW20 bağlı olarak kullanılan fare zorlanma fareler aralıklarının neden olmaktadır. C57Bl/6 ve BALB/c, yaygın olarak kullanılan fare suşları için 10 mg/kg BW (LD50) % öldürücü doz 50'dir. Buna ek olarak, suşları C3H/HeJ ve C57BL/10ScCr Tlr421mutasyonların kaynaklanmaktadır indüklenen LPS endotoksemi korunuyorsunuz demektir. Sonuç olarak, Tlr4-eksik fareler hiporesponsif LPS22ile enjeksiyonlar için değildir. Diğer genetik olarak değiştirilmiş fare, PARP1/fareler23 gibi LPS kaynaklı toksik şok dayanıklı vardır.

Açıklanan fare modeli burada sistemik bir bariyer ihlali sonra LPS yayılması vücudun yüzeyler sonuçlarını taklit etmek için yönetilen LPS sublethal bir doz kullanır. Seçilen LPS konsantrasyonu (2 mg/kg BW) mortalite C56Bl/6 farelerde ama pro-inflamatuar sitokinlerin indüklenen sürümü ikna etmek değil.

Protocol

Fareler yetiştirilen ve belirli patojen-Alerjik (SPF) şartlarda, biyomedikal bölümü, Basel Üniversitesi (Basel, İsviçre) hayvan tesisi devam etti. Tüm fare deneyleri İsviçre Federal ve Kanton düzenlemeler (hayvan iletişim kuralı numarası 2816 [Kanton Basel-Stadt]) uygun olarak yapıldı.

1. LPS çözüm hazırlanması

  1. Escherichia coli 0111:B4 steril koşullarda gelen saf LPS stokunun açın ve su 5 mg/mL konsantrasyonu için yeniden oluşturma.
  2. Steril fosfat tamponlu tuz çözeltisi (PBS) 0.2 µg/µL çalışma konsantrasyonu ile LPS stok sulandırmak.

2. LPS farelere mayi enjeksiyon

  1. Çözüm bir 0.5 mL şırınga 30 G iğne Laminer hava akışı ile çalışma LPS Aspire edin.
  2. Kadın C57Bl/6 fare (10 hafta-in yaş altı) tartmak ve eklenecek LPS, miktarı: 10 µL (2 µg) /g vücut ağırlığı.
    Not: bir fare 20 g ardından 20 g x 10 µL tartmak Eğer örneğin, 200 µL LPS enjekte edilir çözüm ihtiyaçlarını çalışma =.
  3. Nazikçe ama sıkıca fare işlemek ve bir elinde hayvan dizginlemek. Hayvan ama normal nefes değil kıvrıl ve dön sırasında kısıtlama mümkün olduğundan emin olun.
  4. Fare burun biraz karın enjeksiyon için ortaya çıkarmak için yere doğru eğin. Karın ve enjeksiyon yeri orta hat düşük karın sol veya sağ orta hat üzerinden bulun. I.p. PBS LPS yerine kontrol fareler enjekte.
  5. Serbest el ile uygun birimi (2.2 adımda hesaplanan birim) enjekte çözüm çalışma LPS. İğne Periton boşluğuna aksi, mis enjeksiyonları karın kas katmanına oluşabilir girdiğini emin olun. Hala, o bölgede bulunan iç organlara zarar önlemek için peritoneal kavite içine iğneyle çok derine gitme.
  6. Hayvan dikkatli belgili tanımlık kafes kafes başına en fazla 5 fare ile dönün.

3. monitör fareler

  1. Hayvanlar oluşumu ve endotoksemi şiddeti için 8 h için enjeksiyon sonra enjeksiyon ve her 2 h anda izlemek. Bu nedenle, daha önce yayımlanmış makale 24adapte edilmiş bir skor sayfası (Tablo 1) kullanmalıdır.
  2. LPS enjekte fareler tablo 1'de listelenen aşağıdaki parametreler için puan edinildi
    1. Normalde pürüzsüz olan kürk görünümü için kontrol edin. Kürk rahatsızlık ve/veya ağrı gösteren karıştırdı, dikenli veya kabarık kürk görüntülenirse, onları 1, 2 veya 3 puan edinildi.
    2. Fare etkinliği için kontrol edin.
      Not: Fareler normalde serbestçe yeme, içme, tırmanma bütün kafes hareket eder ama bastırılmış ya da kısıtlı aktivite acı belirtisi olabilir.
    3. Bilinç düzeyini kontrol edin.
      Not: Fareler çok meraklı, ve onlar normalde çevreleyen soruşturma kafes hareket eder. Eksikliği veya azaltılmış hareketi ağrı ve rahatsızlık önerebilirsiniz.
    4. Gözlere bakın.
      Not: Tam olarak açık gözleri sağlıklı farelerde bekleniyor, ancak muhtemelen salgılanması ile kısmen veya tamamen kapalı gözler acı belirtisi olabilir.
    5. İçin solunum hızını denetleyin.
      Not: Sağlıklı fareler genellikle normal ve hızlı solunum oranına sahip, düşük solunum oranı rahatsızlık belirtisi olabilir).
    6. Solunum kalitesi için kontrol edin.
      Not: Zahmetli nefes ya da nefes nefese olmadan acı bir işaretidir.

4. doku örnekleme ribonükleik asit (RNA) çıkarımı ve homojenizasyon için

  1. Toplama/homojenizasyon tüpleri hazırlayın: eklemek 1 mL tek adım RNA izolasyon reaktif 2 mL tüpler için 1.4 mm seramik küre ile doldurulmuş.
  2. Uygun zaman noktalarda ((0 h) önce ve 2 h, 4 h ve 8 h LPS enjeksiyon sonra) kan kaybı tarafından takip anestezik aşırı doz (isoflurane) fareyle ötenazi ve diseksiyon ile devam edin.
  3. Deri ve iç organları ile karın boşluğu makas çifti ile açığa kas katmanı kesti.
  4. Dikkatle dalak, karaciğer ve iki nokta üst üste incelemek, fat dosya sisteminden organlara temiz ve onları PBS buz üzerinde tutun.
  5. Makas veya skalpel kullanarak her organ dan küçük bir parça (yaklaşık 0.5 cm uzunluğunda) kesip.
    Not: Her zaman her fare (iki nokta üst üste karaciğer, proksimal veya distal kısmının aynı LOB) organ yaklaşık aynı bölümünden parça almak önemlidir.
  6. Kısa bir süre doku kağıt doku parçası üzerinde kuru ve toplama/homojenizasyon tüp tamamen RNA izolasyon reaktif içinde batırılır emin yerleştirebilirsiniz.
  7. Bir yüksek hızlı benchtop homogenizer dokusunda lunaparkçı. Dalak, karaciğer ve iki nokta üst üste 1 döngüsü homojenizasyon için 30 6,00 hızda kullanmak gibi yumuşak dokular için s.
  8. Örnekleri, oda sıcaklığında 5 min için kuluçkaya.
  9. Dikkatli bir şekilde yer ek bileşeni için sıvı azot tüp dondurma doku lysate. RNA izolasyon kadar-80 ° C'de lysate donmuş ek depolar.

5. RNA doku çıkarma

Not: RNA izolasyon reaktifler, kloroform ve alkoller tehlikeli madde kabul edilir. RNA ayıklama kimyasal bir başlık altında gerçekleştirin. Sertifikalı RNase free reaktifler ve ekipman RNase içermeyen bir ortam sağlamak için kullanın.

  1. Faz ayrımı
    1. Buzda donmuş doku lysate çözülme.
    2. Örnek 4 ° C'de kalmayabilir kalan doku parçacıkları cips için 5 min için 1000 x g santrifüj kapasitesi.
    3. Süpernatant yeni bir 1,5 mL nükleaz ücretsiz tüp aktarın.
    4. 1 mL RNA izolasyon reaktif başına 200 µL buz gibi kloroform ekleyin ve elle 10-15 s için şiddetle çalkalanır.
    5. Oda sıcaklığında 2-3 dakika için kuluçkaya.
    6. Santrifüj 12, 000 x g 4 ° C'de 15 dakika
      Not: Örnek şimdi 3 aşama içerir: alt kırmızı fenol kloroform faz, interfaz ve üst renksiz sulu faz. RNA üst sulu aşamasında bulunuyor.
    7. Üst sulu faz (toplam hacminin % 50) ve transfer yeni 1,5 mL nükleaz ücretsiz tüp içine toplamak.
  2. RNA Yağış
    1. 1 mL RNA izolasyon reaktif başına 0.5 mL buz gibi isopropanol ekleyin ve karışımı yavaşça 5 - 6 kez tüp ters çevirme tarafından.
    2. 10-15 dakika oda sıcaklığında kuluçkaya.
    3. 4 ° C'de 10 dakika için 12.000 x g, santrifüj
      Not: Bu aşamada RNA Pelet görünür olması gerekir.
  3. RNA Pelet yıkama
    1. Tamamen isopropanol Pelet bozmadan içeren süpernatant kaldırın.
    2. Pelet 1 mL buz gibi % 75 etanol ilk lizis için kullanılan 1 mL RNA izolasyon reaktif başı ile yıkayın.
    3. Girdap örnek kısa bir süre.
    4. Santrifüj örneği 7,500 (ya da 12.000) x g ' 4 ° C'de 5 min için
  4. RNA eriterek
    1. Tamamen etanol içinde süpernatant Pelet bozmadan kaldırın.
    2. 3-5 dakika oda sıcaklığında RNA Pelet kurumasını kimyasal başlık altında açılan tüp bırakın (Bu durumda RNA çözülmeye zor olacak gibi aşırı kuru değil).
    3. 20-50 µL nükleaz ücretsiz su RNA Pelet dikkatlice yukarı ve aşağı pipetting tarafından geçiyoruz.
    4. Örnek 10-15 dk daha fazla RNA'ın çözüm geliştirmek için 55 ° C'de kuluçkaya.
      Not: Bu aşamada, RNA-80 ° c daha fazla analiz kadar saklanabilir.

6. sindirim kalan DNA'ın

  1. RNA konsantrasyon Spektrofotometre ile Spektrofotometre bir aliquot (2 µl) pipetting tarafından ölçmek ve önerilen konsantrasyon için ayarlayın.
  2. Max ile DNA kirletici sindirim başlatın. 10 µg RNA nükleaz ücretsiz 50 µL suda.
  3. 10 ben tampon Dnaz ve ben her örnek ve karışımı yavaşça pipetting tarafından yukarı ve aşağı 1 µL rDNase x 0.1 birimi ekleyin.
  4. 20-30 dk 37 ° C'de kuluçkaya.
  5. Girdap Dnaz Inactivation reaktif ve 0.1 birim de pipet ile karıştırma örnek ekleyin.
  6. Zaman zaman el ile karıştırma oda sıcaklığında 5 min için kuluçkaya.
  7. 10.000 x g 1.5 dakika, santrifüj kapasitesi.
  8. Yeni nükleaz ücretsiz tüp içine DNA-Alerjik RNA içeren süpernatant aktarın.
  9. Ölçü RNA konsantrasyon ve kalitesi ile Spektrofotometre.

7. ters transkripsiyon

  1. Piyasada bulunan deoksiribonükleik asit cDNA ters transkripsiyon (RT) kiti ters transkripsiyon için kullanın.
    Not: Burada, RNA 2 µg kadar kopya etmek ters kaydedilebilir.
  2. 2 µg RNA içeren birimin hesaplayın. Yeni bir PCR tüp 2 µg RNA pipet.
  3. Son hacmi 10 µL PCR tüp örnekte nükleaz ücretsiz su ekleyin.
  4. 2 x Master Mix karıştırma aşağıdaki bileşenleri tarafından Tablo 2 ' de listelenen hazırlamak
  5. 10 µL 2 Master Mix x 1 x Master Mix 20 µL hacmi elde etmek için 10 µl RNA ekleyin.
  6. Polimeraz zincir reaksiyonu (PCR) tüp ve örnek aşağı spin kısaca kapatın.
  7. Örnekleri bir PCR Thermocycler yerleştirin ve Tablo 3' te listelenen ayarları ayarlayın.
  8. -20 ° c daha fazla çözümleme için oluşturulan cDNA saklayın.

8. kantitatif PCR (qPCR)

  1. Piyasada bulunan bir kit ile qPCR reaksiyonu gerçekleştirmek.
  2. Kendi tasarım ve intron kapsayan astar şablonu cDNA farklı konsantrasyonları ile kullanımdan önce sınayın. Standart bir eğri oluşturarak astar etkinliğini analiz ve yüksek etkinlik ve doğru erime eğrileri ile astar kullanabilirsiniz.
    Not: Bu deneyde kullanılan astar dizisi Tablo 2' de listelenmiştir.
  3. Tablo 4' te açıklanan tepki Kur ile kantitatif Polimeraz zincir reaksiyonu (qPCR) tepkimesi 384-şey plaka hazırlayın.
  4. Zaman reaksiyon karışımı hazırlanan tüm çözümler ve plaka plaka engellemek için alüminyum folyo kullanarak buz üzerinde ıslak tutmak.
  5. Bütün tepkiler triplicates içinde gerçekleştirin.
  6. Tablo 5' te listelenen ayarı kullanarak bir thermocycler PCR reaksiyon yerine getirir.
  7. Tüm triplicates tepkiler ortalama Ct değeri hesaplamak. Tüm hedef genlerin glycerinealdehyde-3-fosfat dehidrojenaz ifade seviyesine normalize (Gapdh) 2^(-ΔCt) hesaplayarak temizlik gen.
    Not: Tüm hedef genlerin ortalama Ct ile > 35 algılama sınırının altında olmak olarak kabul.

Representative Results

Sonuçları için ana bağırsak bariyer ihlali sonra oluşur giriş bakteri veya bakteriyel kaynaklı ürün sonra taklit etmek için LPS enjekte içine sublethal doz (2 µg/g vücut ağırlığı) farelerde C57Bl/6. Her tek fare takip ve fareler görünümünü, hayvanlar, gözler, durumu ve solunum hızı ve kalitesi (Tablo 1) faaliyet içerir skor tablosunda listelenen parametrelerle endotoksemi oluşumu için attı . Hayvanlar içinde 24 h (şekil 1) yeniden elde etmek ve 6-10 h LPS enjeksiyon sonra doruğa hastalığın klinik belirtileri gösterdi. Bireysel fareler kurban 2 h, 4 h ve 8 h LPS enjeksiyon sonra idi. Doku parçaları dalak, karaciğer ve iki nokta üst üste toplanmıştır. RNA transkripsiyonu cDNA için izole--dan bu organlar ve geriye doğru. CDNA qPCR için bir şablon olarak qPCR için kullanılan astar ile Il6 (şekil 2A) Il1b (şekil 2B), TNFa (şekil 2C) ve Il10 (şekil 2B) ifade düzeyini belirlemek için kullanılan Tablo 6' da listelenen. Il6 ifade 2 h sonra enjeksiyon karaciğer dalak ve kolon ve 4 h enjeksiyon sonra doruğa ulaşmıştır. Dalak, karaciğer ve iki nokta üst üste enjeksiyon sonra 4 h Il1b, TNFa ve Il10 ifadesi numaraya kadar yükseldi. Enjeksiyon sonra içinde 8 h, Il6, Il1b, TNFa ve Il10 ifade temel seviyelere döndü.

Figure 1
Şekil 1: LPS enjeksiyon (2 µg/g vücut ağırlığı) indüklenen endotoksemi C57Bl/6mice içinde klinik belirtileri. Sonra enjeksiyon LPS, 2 µg/g vücut ağırlığının bireysel fareler görünümünü ve hayvanlar, aktivite içeren tablo 1'sunulan hastalığı puanı ile takip gözleri ve solunum hızı ve kalitesi ile her 2 h 24 h aft ve 12 h için açma Er LPS enjeksiyon. Hastalık puanı (y ekseni) ilgili zaman (x ekseni) deyimiyle. Demek ± SD her zaman noktası başına 4-5 fareler için sunulmaktadır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: LPS enjeksiyon (2 µg/g vücut ağırlığı) C57Bl/6 farelerde pro-inflamatuar sitokinlerin ifadesi indükler. Fareler LPS 2 µg/g vücut ağırlığı ve Il6 (A), Il1b (B)ifade düzeyleri ile enjekte edildi, Tnfa (C) ve Il10 (D) qPCR dalak, karaciğer ve iki nokta üst üste tarafından belirtilen zamanda analiz edildi Puan enjeksiyon sonra. Sitokin ifade düzeyleri tüm Gapdhifade için normalleştirilmiş. Demek ± SD her zaman noktası başına 4-5 fareler için gösterilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Tablo 1: C57Bl/6 fareler LPS enjeksiyon sonra izlemek için hastalık skor levha. LPS enjeksiyon sonra izlenen parametreler. Hayvanlar her 2 h sonra enjeksiyon 12 h bir süre için takip ve puanları tabloda listelenen tek tek her parametre için verildi. Her hayvan için final skoru tüm bireysel puanlarının toplamı temsil eder. Bu başvuru24adapte olduğunu. Bu dosyayı indirmek için buraya tıklayınız.

Tutar Reaktif
2 µL/örnek RT arabellek x 10
0.8 µL/örnek 25 x deoxynucleotide (dNTP) Mix (100 mM)
1 µL/örnek RT rasgele astar
4.2 µL/örnek nükleaz ücretsiz su

Tablo 2: Reaktifler ana karışımı ters transkripsiyon için hazırlamak için kullanılır.

Sıcaklık Zaman
25 ° C 10 dk
37 ° C 120 dk
37 ° C 5 dk
4 ° C basılı tutun

Tablo 3: ters transkripsiyon için kullanılan Thermocycler ayarlar.

Tutar Reaktif
5 µL/iyi 2 x Master Mix
0,05 µL/iyi Referans boya
500 nM final/iyi ileri astar
500 nM final/iyi astar ters
10 ile 100 arasında ng/iyi, biz 40 ng/iyi kullandık bir şablon seyreltme arabellekte seyreltilmiş şablon cDNA (1/100 seyreltme bu arabelleği nükleaz ücretsiz suda yaptım.. şablon cDNA sulandırmak için kullanılır). Bu arabellek şablonunda sulandrarak şablon reaksiyon rengi olarak değişir maviden yeşile eklendiği wells görselleştirme sağlar
nükleaz ücretsiz su son 10 µL/iyi hacmiyle nükleaz ücretsiz su

Tablo 4: PCR reaksiyon açıklaması.

Sıcaklık Zaman
95 ° C 2 dk
95 ° C 5 s 40 döngüleri
60 ° C 20 s
95 ° C 15 s eğri analaysis erime
60 ° C 1 dk.
95 ° C 15 s

Tablo 5: PCR için kullanılan Thermocycler ayarlar.

Astar Sıra Erime sıcaklığı Ürün uzunluğu
Il6-F TCG GAG GCT TAA TTA CAC ATG TTC T 60.3 94 bp
Il6-R GCATCATCGTTGTTCATACAATCA 58.2
Il1b-F TGTGAAATGCCACCTTTTGA 56,1 94 bp
Il1b-R GTCAAAGGTTTGGAAGCAG 57.2
Il10-F ATCGATTTCTCCCCTGTGAA 56.2 108 bp
Il10-R TGTCAAATTCATTCATGGCCT 56,1
Tnfa-F CCACCACGCTCTTCTGTCTAC 60,4 103 bp
Tnfa-R AGGGTCTGGGCCATAGAACT 60
Gapdh-F CATCAAGAAGGTGGTGAAGC 56.7 199 bp
Gapdh-R CCTGTTGCTGTAGCCGTATT 58

Tablo 6: qPCR tepki olarak kullanılan astar. QPCR için fare sitokinler ve Oda temizliği gene algılamak için kullanılan astar dizisi Gapdh.

Discussion

Bu iletişim kuralı mikrobiyal kaynaklı ürünler tarafından işgalden sonra gerçekleşen immünolojik süreçleri taklit eder. Kritik protokol içinde fare çizgi, fareler hijyen durumunu, LPS, hayvanlar endotoksemi oluşumunu ve deney fesih süresi noktası için izleme doz seçimi adımlardır. En önemlisi, genetik arka plan fare baskı kabul gerekir. Farklı fare suşları LPS farklı duyarlılık var. Örneğin, indüklenen C3H/HeJ ve C57BL/10ScCr fareler için LPS dirençli endotoksemi21,25. Ayrıca, hayvanlar hijyen durumunu LPS endotoksemi seyri etkileyebilir. Özel patojen ücretsiz (SPF) hayvanlar en yaygın olarak kullanılır. Bu fareler patojenler tanımlanmış bir listeden ücretsizdir ancak bu hayvanlar tam microbiota bileşimi26,27bilinmemektedir. (Bu bir microbiota liman değil) steril mikrop içermeyen ya da axenic hayvan SPF fareler26farklıdır. Büyük olasılıkla, axenic hayvanlar bir mikroorganizma veya mikroorganizmalar (gnotobiotic hayvanlar) bir konsorsiyum ile kolonizasyon genler, IL-19 gibi ifadeden sonra SPF hayvanlar8' e göre LPS enjeksiyon etkileyebilir. Ayrıca, bir skor sayfası Bu skor sayfası olarak dışkı çözüm Periton boşluğuna24enjekte edilerek indüklenen sepsis modeli için kullanılan sürülmüştür. Bu sheetcan yerel hayvan refahı Komitesi ile ele ve yerel ihtiyaçlarına adapte. Özellikle, fesih için ölçüt ihtiyacı yerel hayvan refahı Komitesi ile ele alınacak. Bu deney bir skor > 12 elde ya da bir tek tek parametre için maksimum puanı ulaşıldığında durdurulması gerekiyordu. Bu deneyde, hiçbir hayvan sekiz hayvanların LPS (2 µg/g vücut ağırlığı) enjeksiyon sonra 12 hastalık puanı aştı. Bu çalışmada, karaciğerde, Il6, Il1b, TNFa ve Il10 sitokinler ifade gösterilen sonuçlar dalak ve kolon LPS enjeksiyon sonra sunulur. 2 h sonra LPS enjeksiyon dalak ve iki nokta üstüste ve LPS enjeksiyon karaciğerde sonra 4 h Il6 ifade doruğa ise, Il1b, TNFa ve Il10 ifadesi 4 h LPS enjeksiyon dalak, karaciğer ve iki nokta üst üste, sonra doruğa ulaşmıştır. İçinde 8 h ifade Il6, Il1b, TNFa ve Il10 temel düzeyleri dalak, karaciğer ve iki nokta üst üste döndü. Hastalık şiddeti doruğa 6 h ve 10 h arasında LPS enjeksiyon sonra Il6, Il1b, TNFa ve Il10 ifadesi döndüğümde zaten gösteren temel düzeyleri Il6, ifade arttı Il1b, TNFa ve Il10 oluştuğunu hızla LPS enjeksiyon sonra Kinetik diğer genlerin farklı bir desen LPS enjeksiyon sonra gösterebilir ama. Bu sitokinler ifade de hayvanların protein düzeyi qPCR ek olarak kabul edilebilir ELISA tarafından çözümlenmesi.

Değişiklikler ve teknik sorun giderme bir hastalık puanı > 12 ulaşıldığında durumlarda gereklidir. Bu nedenle, LPS doz azaltılmış ve daha iyi kullanılan fare çizgi ve deneme erken sonlandırma önlemek için yerel koşullar için ayarlanmış gerekir. Genler belirli bir genomik bölge silerek veya bir gen overexpressing manipülasyon fareler duyarlılık LPS için etkileyebilir. Ön deneyler gereksiz zarar ve bu denemenin hayvanlarda ölüm önlemek için uygun doza LPS doz titre. Not, LPS kirlenme diğer bakteriyel kaynaklı ürünler ve yanlış iğne kaçınılması gerekiyor. Ayrıca, genler ilgi ifade LPS enjeksiyon sonra Kinetik belirlenmesi gerekiyor.

Bu teknik bir bağırsak bariyer gedik sonra ev sahibi içine mikrobiyal ürünler yayılması sonuçları hakkında bilgiler sağlar ancak yol açan olaylar hakkında bilgi vermek değil bağırsak bariyer ihlali ve nedenleri sınırlamaları vardır IBD tetikler. Tabii ki, bu model kolit manken DSS kolit model olarak değil, ama kolit modelleri mikrobiyal ürünler giriş sonucu ana içine çalışmaya ek olarak yararlı olabilir. Ayrıca, LPS ı.p. enjeksiyon peritoneal kavite içinde küçük ve büyük bağırsak bulunur, bölebilir. Bu bağırsak kaynaklı Periton boşluğuna bakteriyel Urun translocation ev sahibi içine kolaylaştırabilir.

Bu model önemini tanımlanmış PAMP kullanır olmasıdır. I.p. enjeksiyon tüm bakteri, dışkı çözümleri24 ı.p. enjeksiyon veya peritonit cecal tüp ligasyonu ve ponksiyon28tarafından mikroplar geniş bir dizi indüklenen septik peritonit modelleri de dahil olmak üzere diğer modellerinde veya onların Ürünler hastalığı neden olmaktadır. Ayrıca, LPS enjeksiyon fareler içine basit bir yaklaşımdır ve septik peritonit cecal tüp ligasyonu ve ponksiyon tarafından indüklenen gibi ameliyat gerektirmez.

Bu modelin daha fazla uygulama endotoksemi veya indüklenen LPS septisemi bakteri kaynaklı ürünler translocation cilt bariyer ihlali gibi ana bilgisayar içine ile karakterize olan veya bir ihlal herhangi bir bağlamı içinde araştırmak amacıyla çalışmalar vardır ürogenital sistem. Sonuç olarak, bu her laboratuvar ayarlarında kullanılan basit bir model olduğunu. Yerel koşullara bağlı olarak, yerel ihtiyaçları gerekli uyarlamaları olabilir. Özellikle, skor levha deneme yapılmadan önce yerel yönetimlerle ele alınacak vardır. Bu yaklaşım bir bariyer ihlali oluştuktan sonra bakteri veya bakteriyel kaynaklı ürünler ana girdiğinizde sonuçları için ev sahipliği taklit etmek için kullanıldı. Bu özellikle ilgili bir bağırsak bariyer gedik oluşumunu patoloji hastalığın ortak bir olay nerede IBD temeli inceleyerek çalışmalar olabilir.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

JHN İsviçre Ulusal Vakfı (SNSF 310030_146290) tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1

DOWNLOAD MATERIALS LIST

References

  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).

Erratum

Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic

to:

Katarina Radulovic

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics