न्यूरोजेनेसिस पी 19 भ्रूण कार्सिनोमा कोशिकाओं का उपयोग

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

P19 माउस भ्रूण कार्सिनोमा सेल लाइन (P19 सेल लाइन) व्यापक रूप से vivo विश्लेषण की तुलना में महान सरलीकरण के साथ neurogenesis के आणविक तंत्र का अध्ययन करने के लिए प्रयोग किया जाता है. यहाँ, हम P19 सेल लाइन में रेटिनोइक एसिड प्रेरित neurogenesis के लिए एक प्रोटोकॉल प्रस्तुत करते हैं.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

एक माउस भ्रूण व्युत्पन्न teratocarcinoma से व्युत्पन्न P19 सेल लाइन तीन रोगाणु परतों में अंतर करने की क्षमता है. रेटिनोइक एसिड (आरए) की उपस्थिति में, निलंबन सुसंस्कृत P19 सेल लाइन न्यूरॉन्स में अंतर करने के लिए प्रेरित किया जाता है। इस घटना को बड़े पैमाने पर इन विट्रो में एक neurogenesis मॉडल के रूप में जांच की है. इसलिए, P19 सेल लाइन आणविक और सेलुलर neurogenesis के साथ जुड़े अध्ययन के लिए बहुत उपयोगी है. तथापि, साहित्य में वर्णित P19 कोशिका रेखा के न्यूरोनल विभेदन के लिए प्रोटोकॉल बहुत जटिल हैं। इस अध्ययन में विकसित विधि सरल कर रहे हैं और neurodevelopmental असामान्यताएं और neurodegenerative रोगों में आणविक तंत्र स्पष्ट करने में एक भूमिका निभानी होगी.

Introduction

भ्रूणीय विकास के दौरान एकल कोशिका परत को तीन अलग -अलग रोगाणु परतों1,2,3में परिवर्तित कर दिया जाता है . विवो में होने वाली परिघटनाओं की अनुसंधान संभावनाओं को बढ़ाने के लिए त्रि-आयामी समुच्चयों (भ्रूण निकायों) का उत्पादन एक सुविधाजनक मॉडल के रूप में विकसित किया गया है। इस प्रकार से बनने वाले कोशिकीय समुच्चयों को विभिन्न स्थितियों से अवगत कराया जा सकता है जिससे कोशिका विभेदन उत्पन्न होता है जो भ्रूण4,5के विकास को प्रतिबिंबित करती है. P19 murine भ्रूण कार्सिनोमा सेल लाइन (P19 सेल लाइन) आमतौर पर इन विट्रो6,7,8में neurogenesis अध्ययन के लिए एक सेलुलर मॉडल के रूप में प्रयोग किया जाता है. P19 सेल लाइन ठेठ pluripotent स्टेम सेल सुविधाओं को दर्शाती है और रेटिनोइक एसिड की उपस्थिति में न्यूरॉन्स में अंतर कर सकते हैं (आरए) सेल एकत्रीकरण के दौरान पालन शर्तों के तहत neurite outgrowth द्वारा पीछा किया. इसके अलावा, अलग-अलग पी 19 सेल लाइन डाइमेथिल सल्फोक्साइड (डीएमएसओ)9,10,11,12के प्रभाव में मांसपेशियों और कार्डियोमायोसाइट जैसी कोशिकाओं को बनाने में भी सक्षम है।

कई तरीकों13,14,15,16 न्यूरॉन भेदभाव के लिए सूचित किया गया है, लेकिन पद्धति कभी कभी जटिल है और केवल विवरण पढ़ने से समझ में आसान नहीं है. उदाहरण के लिए, प्रोटोकॉल कभी कभी है Dulbecco संशोधित ईगल मध्यम (DMEM) मध्यम बछड़ा सीरम (सीएस) और भ्रूण गोजातीय सीरम (FBS)13के मिश्रण के साथ पूरक का एक संयोजन की आवश्यकता है. इसके अलावा, न्यूरोनल विकास के लिए इस्तेमाल किया मीडिया अक्सर neurobasal और B27 की खुराक से बना रहे हैं13,14,15,16. जैसे, मौजूदा तरीकों में उनकी तैयारी में जटिलता होती है और हमारा लक्ष्य यहाँ प्रोटोकॉल को सरल बनाना है। इस अध्ययन में, हम प्रदर्शन किया है कि FBS के साथ DMEM P19 सेल लाइन को बनाए रखने के लिए उपयोग किया जा सकता (DMEM + 10% FBS) के रूप में के रूप में अच्छी तरह से न्यूरॉन विकास के लिए (DMEM + 5% FBS + आरए). P19 सेल लाइन का उपयोग neurogenesis के लिए यह सरलीकृत विधि हमें कैसे न्यूरॉन्स विकसित कर रहे हैं की आणविक तंत्र का अध्ययन करने के लिए अनुमति देता है. इसके अलावा, अल्जाइमर रोग जैसे neurodegenerative रोगों पर अनुसंधान भी P19 सेल लाइन का उपयोग कर आयोजित किया जाता है17,18, और हमें विश्वास है कि इस अध्ययन में विकसित विधि स्पष्ट करने में एक भूमिका निभानी होगी neurodevelopmental असामान्यताओं और neurodegenerative रोगों में आणविक तंत्र.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. संस्कृति रखरखाव

  1. रखरखाव माध्यम में P19 सेल लाइन संस्कृति (Dulbecco संशोधित ईगल के माध्यम के साथ 4,500 मिलीग्राम /L ग्लूकोज के साथ पूरक 10% FBS, 100 इकाइयों / 37 डिग्री सेल्सियस और 5% सीओ2पर इनक्यूबेट ।

2. उप-कुलीकरण सेल

  1. जब कोशिकाएं लगभग 80% संगम तक पहुँचती हैं, तो सेल कल्चरफ्लास्क (सतह क्षेत्र 25 बउ 2) से खर्च किए गए माध्यम को हटा दें।
  2. कैल्शियम और मैग्नीशियम से मुक्त फॉस्फेट बफर नमकीन (पीबीएस) के 2 एमएल के साथ कोशिकाओं को धो लें।
  3. सेल मोनोलेयर पर 0.25% ट्रिप्सिन-एडटा (एथिलीडिमिनेटेट्रासेटिक एसिड) का 1 एमएल जोड़ें।
  4. फ्लास्क को 2-3 मिनट के लिए सीओ2 इनक्यूबेटर (37 डिग्री सेल्सियस और 5% ब्व्2) में डाल दो।
  5. फ्लास्क सतह से कोशिका अनुलग्नक का आकलन करें। सुनिश्चित करें कि सभी कोशिकाओं को अलग कर रहे हैं और माध्यम में चल रहा है।
  6. ट्रिप्सिन की एंजाइमी गतिविधि को रोकने के लिए रखरखाव माध्यम के 9 एमएल जोड़ें।
  7. रखरखाव माध्यम में कक्षों को पुन: निलंबित करें.
  8. 200 x ग्राम और कमरे के तापमान (आरटी) पर 5 मिनट के लिए एक 15 एमएल ट्यूब और अपकेंद्रित्र के लिए कोशिकाओं स्थानांतरण।
  9. सुपरनेंट को छोड़ दें और 15 एमएल ट्यूब में 10 एमएल ताजा रखरखाव माध्यम जोड़ें।
  10. निर्माता के निर्देशों के अनुसार एक सेल काउंटर का उपयोग कर सेल नंबर निर्धारित करने के लिए सेल निलंबन का उपयोग करें।
  11. एक नए 25 सेमी2 फ्लास्क में 2 x 104 कोशिकाओं/सेमी2 पर बीज कोशिकाओं।
  12. रखरखाव माध्यम को 10 एमएल तक जोड़ें.
  13. 2-3 दिनों के लिए सीओ2 इनक्यूबेटर (37 डिग्री सेल्सियस और 5% सीओ2) में कोशिकाओं के साथ फ्लास्क रखो।

3. ट्रिप्सिन पाचन

  1. सेल फ्लास्क से एस्पायर रखरखाव मध्यम। 2 एमएल कैल्शियम और मैग्नीशियम मुक्त पीबीएस के साथ एक बार कोशिकाओं को धो लें।
  2. 0.25% trypsin-EDTA के 1 एमएल जोड़ें.
  3. 2-3 मिनट के लिए 37 डिग्री सेल्सियस पर सीओ2 इनक्यूबेटर में कोशिकाओं के साथ फ्लास्क रखो।
  4. कोशिकाओं को दस बार पाइपिंग द्वारा कोशिकाओं को अलग करने के लिए 1 एमएल पिपेट का उपयोग करें।
  5. 9 एमएल डिफरेंट मीडियम (Dulbecco के संशोधित ईगल के माध्यम को 4500 mg/L ग्लूकोज के साथ जोड़कर trypsin को निष्क्रिय करना 5% एफबीएस, 100 इकाइयों/एमएल पेनिसिलिन और 100 यूनिट्स/एमएल स्ट्रेप्टोमाइसिन के साथ कोशिकाओं को आरए के बिना।
  6. 200 x g और RT में 5 मिनट के लिए 15 एमएल ट्यूब और अपकेंद्रित्र में कोशिकाओं को स्थानांतरित करें।
  7. सुपरनेंट को त्याग ें करें और रेटिनोइक एसिड (आरए) के बिना 1 एमएल डिफरेंट मीडियम जोड़ें। कोशिका गोली को पुन: निलंबित करें.
  8. निर्माता के निर्देश के अनुसार एक सेल काउंटर का उपयोग कर सेल संख्या निर्धारित करने के लिए सेल निलंबन का उपयोग करें।

4. सकल पीढ़ी

  1. आरए के 5 डिग्री एल (1 एमएम स्टॉक 99.8% इथेनॉल में भंग, -20 डिग्री सेल्सियस पर संग्रहीत) भेदभाव मध्यम के 10 एमएल करने के लिए जोड़ें और अच्छी तरह से मिश्रण (0.5 डिग्री एम आरए के अंतिम एकाग्रता).
    नोट: आरए प्रकाश संवेदनशील है. एतओएच की कम सांद्रता कोशिका विभेदन19,20,21को प्रभावित नहीं करती .
  2. 100 मिमी गैर इलाज संस्कृति पकवान (निलंबन संस्कृति के लिए समर्पित) के लिए भेदभाव मध्यम (आरए के साथ) के 10 एमएल जोड़ें।
  3. 100 मिमी डिश में 1 x 106 कोशिकाओं को बीज दें (डिश सतह क्षेत्र 56.5 सेमी2)।
  4. कुल ों के गठन को बढ़ावा देने के लिए 37 डिग्री सेल्सियस और 5% सीओ2 में 2 दिनों के लिए इनक्यूबेटर में कोशिकाओं के साथ फ्लास्क डालें।
  5. 2 दिनों के बाद, भेदभाव माध्यम का आदान-प्रदान करें। Aspirate मध्यम एक 10 एमएल पाइपेट का उपयोग कर समुच्चय युक्त और आरटी पर एक 15 एमएल ट्यूब के लिए स्थानांतरण।
  6. आरटी में 1.5 मिनट के लिए गुरुत्वाकर्षण से व्यवस्थित करने के लिए समुच्चय की अनुमति दें।
  7. महादलित को त्याग दें।
  8. एक 10 एमएल सीरम संबंधी पिपेट का उपयोग करके 0.5 डिग्री सेल्सियस आरए के साथ एक ताजा 10 एमएल डिफरेंट मीडियम जोड़ें।
    चेतावनी: सेल समुच्चय ऊपर और नीचे पिपेट न करें।
  9. नए 100 मिमी गैर इलाज संस्कृति पकवान (निलंबन संस्कृति के लिए समर्पित) में समुच्चय बीज.
  10. प्लेट को इन्क्यूबेटर में 37 डिग्री सेल्सियस और 5% ब्व्2) में 2 दिनों के लिए रखें।

5. सकल अलगाव

  1. 10 एमएल पिपेट का उपयोग करके सेल समुच्चय को प्रेरित करें।
  2. समुच्चय को 15 एमएल ट्यूब में स्थानांतरित करें। सेल समुच्चय 1.5 मिनट के लिए गुरुत्वाकर्षण से व्यवस्थित करने के लिए अनुमति दें।
  3. सुपरनेंट निकालें.
  4. अकेले DMEM (सीरम और एंटीबायोटिक मुक्त) के साथ समुच्चय धो लें।
  5. सेल समुच्चय को आरटी में 1.5 मिनट के लिए गुरुत्वाकर्षण अवसादन से व्यवस्थित होने दें।
  6. सुपरनेंट को प्रेरित करें और 2 एमएल trypsin-EDTA (0.25%) जोड़ें।
  7. कोशिका को 10 मिनट के लिए एक पानी के स्नान (37 डिग्री सेल्सियस) में रखें। हाथ से टैप करके हर 2 मिनट में समुच्चय को धीरे-धीरे उत्तेजित करें।
  8. 4 एमएल रखरखाव माध्यम जोड़कर trypsinization प्रक्रिया बंद करो।
  9. पिपेट 1 एमएल पिपेट का उपयोग करके 20 बार ऊपर और नीचे समुच्चय करता है।
  10. 200 x ग्राम और आरटी पर 5 मिनट के लिए सेंट्रीफ्यूज कोशिकाओं।
  11. सुपरनेंट निकालें और रखरखाव माध्यम के 5 एमएल में सेल गोली को फिर से निलंबित करें।
  12. कक्ष काउंटर के साथ कक्ष संख्या निर्धारित करें.

6. चढ़ाना कोशिकाओं

  1. रखरखाव मध्यम के प्रति अच्छी तरह से 3 एमएल एक 6 अच्छी तरह से थाली में जोड़ें.
  2. 0.5 x 106/ अच्छी तरह से एक घनत्व पर 6 अच्छी तरह से संस्कृति प्लेट में बीज कोशिकाओं.
  3. 5% सीओ2 एकाग्रता के साथ 37 डिग्री सेल्सियस पर इनक्यूबेट।
  4. 6 अच्छी तरह से संस्कृति प्लेट में कवर ग्लास पर कोशिकाओं बीज और विरोधी MAP2 एंटीबॉडी (20% संगम) के साथ इम्यूनोस्टेनिंग प्रदर्शन करते हैं। आरएनए को अलग करने के लिए 6-वेल प्लेट का उपयोग करें और Map2, NeuN, Oct4, Nanog,और Gapdh (20% संगम) के लिए आरटी-पीसीआर प्रदर्शन करें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

पी 19 सेल लाइन में तंत्रिकाजनन प्रेरण के लिए प्रोटोकॉल की सरलीकृत योजना चित्र 1में प्रस्तुत की गई है। एक अलग अलग राज्य में और neurogenesis के दौरान P19 सेल लाइन के चरित्र को परिभाषित करने के लिए, आरटी-पीसीआर (रिवर्स प्रतिलेखन-बहुलम श्रृंखला प्रतिक्रिया) विधि का इस्तेमाल किया गया था। अपृथक्कृत पी19 सेल लाइन ने कार्बनिक धनायन/कार्निटाइन ट्रांसपोर्टर4 (Oct4) और Nanog होमियोबॉक्स (नानोग) जैसे pluripotency जीन ों को व्यक्त किया। आरए की उपस्थिति में निलंबन संस्कृति में कोशिकाओं के एकत्रीकरण द्वारा प्रेरित न्यूरोजेनेसिस ने अक्टूबर 4 और नैनोग अभिव्यक्ति की तेजी से कमी की। इसके विपरीत, न्यूरॉन मार्करों की अभिव्यक्ति: microtubule-संबद्ध प्रोटीन 2 ( Map2), NeuN (भी आरएनए बाध्यकारी प्रोटीन के रूप में जाना जाता है, लोमड़ी-1 homolog 3 (Rbfox3)) तंत्रिकाजनन ट्रिगर के बाद वृद्धि हुई (चित्र 2) 6 ) ,14,15,22. प्रत्येक जीन के लिए प्रयुक्त प्राइमर को न्यूक्लिओटाइड अनुक्रमों तथा सारणी 1 में उत्पाद के आकार के साथ संकेत दिया जाता है। अपृथक्कृत च19 कोशिका रेखा की एक सूक्ष्म प्रतिबिंब ने एक गोल-आकार की आकृतिविज्ञान प्रस्तुत की (चित्र 3क)। तंत्रिकाजनन के प्रेरण के बाद, कोशिकाओं की तंत्रिका संरचना प्लेटिंग के 4 दिनों के बाद स्पष्ट रूप से दिखाई दे रही थी (चित्र 3)। इसके अतिरिक्त, चित्र 4 विभेदित P19 सेल लाइन (4 दिनों के बाद कोशिकाओं चढ़ाना)14में MAP2 अभिव्यक्ति की फ्लोरोसेंट छवि का प्रतिनिधित्व करता है।

Figure 1
चित्र 1 : प्रोटोकॉल P19 भ्रूण कार्सिनोमा कोशिकाओं में neurogenesis के प्रेरण के लिए योजनाबद्ध. Neurogenesis FBS के 5% और 0.5 डिग्री एम आरए के साथ एक 100 मिमी गैर इलाज संस्कृति पकवान में P19 सेल लाइन culturing द्वारा प्रेरित है. 4 दिनों के बाद, सेल समुच्चय trypsin के साथ अलग कर रहे हैं और अगले 4 दिनों के लिए अनुयायी सेल संस्कृति प्लेट पर बीज. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2 : P19 सेल लाइन में जीन अभिव्यक्ति के परिवर्तन. बैंड ग्राफ अलग-अलग P19 सेल लाइन के लिए जीन अभिव्यक्ति का प्रतिनिधित्व करता है (Oct4, Nanog) और neurogenesis के दौरान (Map2, NeuN) . ग्लिसरऐल्डिहाइड-3-फॉस्फेट डिहाइड्रोजेनेज (गपाध) का उपयोग संदर्भ जीन के रूप में किया जाता था। नमूने agarose जेल में लोड कर रहे हैं (1.5%) डबल प्रतिकृतियां में. संक्षिप्त जानकारी: अलग-अलग आरए उपचार के बिना अलग-अलग P19 सेल लाइन का प्रतिनिधित्व करता है; दिन 1-4 सेल चढ़ाना के बाद बाद के दिनों का प्रतिनिधित्व करता है- आरए उपचार और सेल एकत्रीकरण चरण के बाद 4 दिनों के बाद। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3 : P19 सेल लाइन के विश्लेषण के प्रतिनिधि छवियों. (ए) अपृथक्करणित पी 19 सेल लाइन के हल्के सूक्ष्म चित्र। (बी) न्यूरोजेनेसिस के 4 दिनों के बाद पी 19 सेल लाइन के हल्के सूक्ष्म चित्र- आरए उपचार और कोशिका एकत्रीकरण चरण के बाद 4 दिनों के बाद। स्केल बार ] 100 डिग्री मी. कृपया इस आकृति का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 4
चित्र 4 : अलग P19 सेल लाइन के प्रतिनिधि इम्यूनोफ्लोरेसेंस छवि। चढ़ाना के बाद 4 दिनों में विरोधी MAP2 और DAPI के साथ दाग P19 सेल लाइन के विलय इम्यूनोफ्लोरेसेंस छवि। स्केल बार ] 100 डिग्री मी. कृपया इस आकृति का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

प्राइमर प्राइमर अनुक्रम उत्पाद
आकार (बीपी)
गपध एफ: TGACCTCACATGGTCTACA
आर: CTCCCATTCGGCCTTG
85
मानचित्र2 एफ: GCTGAGATCACACAGTC
आर: TCCTGCCAAGAGCTCCC
211
अक्टूबर 4 एफ: GGCGTTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCCTCT
313
न्यूएन एफ: GGCAAATGTCGGGCAATCG
आर: टीसीएएटीटीटीसीसीटीसीसीटीसीटीसीटीएटीएटी
160
नैनोग एफ: AAAGGATGAGTGCAAGCGGGG
आर: CTGGCTTTGCCCTGACTTAAGC
520

तालिका 1: प्राइमर आरटी-पीसीआर के लिए इस्तेमाल किया।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यहाँ, हम Neurogenesis के लिए एक सरल प्रोटोकॉल का वर्णन P19 सेल लाइन का उपयोग कर. हालांकि इस संबंध में कई रिपोर्टों को प्रकाशित किया गया है, P19 सेल लाइन का उपयोग कर neurogenesis प्रेरण के लिए एक विस्तृत पद्धति स्पष्ट नहीं है. इसके अलावा, हम पूरे प्रयोग के लिए 10% FBS के साथ एक साधारण उच्च ग्लूकोज (4,500 mg/L) DMEM माध्यम का उपयोग किया. यह हमें एक उपयोगकर्ता के अनुकूल तरीके से neurogenic प्रयोग प्रदर्शन और भविष्य के लिए इस विधि के उपयोग का विस्तार करने की अनुमति दी.

इस प्रोटोकॉल के भीतर सबसे महत्वपूर्ण बिंदु आरए एकाग्रता के साथ ही निलंबन संस्कृति में सेल समुच्चय की पीढ़ी हैं. पी 19 सेल लाइन में neurogenesis की उत्तेजना समुच्चयों के गठन के बिना किया जा सकता है, लेकिन उत्पादित न्यूरॉन कोशिकाओं की संख्या कोशिका संस्कृति22में दो तिहाई से कम हो जाएगा. मोनज़ो एट अल ने पी 19 सेल लाइन में न्यूरोजेनेसिस प्रेरण को मोनोलेयर15में उन्हें culturing द्वारा दिखाया है। हालांकि उनकी विधि काफी सुविधाजनक है के रूप में हम निलंबन संस्कृति की प्रक्रिया को खत्म कर सकते हैं, आगे के अध्ययन के लिए अन्य अच्छी तरह से निर्धारित तरीकों के साथ उनकी विधि की तुलना की आवश्यकता है. माध्यम में 0ण्5 उ की आरए सांद्रता ने 1 डिग्री द आरए की तुलना में प्लेटिंग के बाद कोशिका समुच्चय के साथ-साथ न्यूरॉन्स की उच्च संख्या का उत्पादन किया। यह भी ध्यान दें कि हम एक कुशल neurogenesis निरीक्षण नहीं कर सकता है जब समुच्चय के अधिकांश आरए उपचार के दौरान निलंबन संस्कृति पकवान के नीचे से जुड़े रहे हैं महत्वपूर्ण है. प्रक्रिया की शुरुआत में इस्तेमाल किया जा करने के लिए P19 सेल लाइन की इष्टतम संख्या है 1 x 106 भेदभाव माध्यम के हर 10 एमएल के लिए. neurogenesis के प्रेरण के दौरान, P19 सेल लाइन रूपों अलग आकार समुच्चय और यहां तक कि एकल कोशिकाओं संस्कृति में पाए जाते हैं. इस समस्या को दूर करने के लिए, हमने 15 एमएल ट्यूब में 1.5 मिनट की निःशुल्क गिरावट के बाद सेल समुच्चय एकत्र किया। हमने पाया है कि इस दृष्टिकोण एकल कोशिकाओं के संदूषण के बहिष्करण की अनुमति देता है. यह भी लंबे समय तक संस्कृति के लिए एंटी-माइटोटिक दवाओं का उपयोग कर सेल संस्कृति के साथ न्यूरोनल संवर्धन प्रदर्शन करने के लिए सिफारिश की है23glial कोशिकाओं के व्यापक प्रसार को बाधित करने के लिए .

P19 सेल लाइन से व्युत्पन्न न्यूरॉन्स दोनों एन-मेथिल-डी-एसपार्टेट (NMDA) और अल्फा-एमिनो-3-हाइड्रॉक्सी-5-मेथिल-4-isoxazole प्रोपिओनेट (AMPA)/ कार्यात्मक $-aminobutyric एसिड (GABA) रिसेप्टर्स25| अतः पी 19 कोशिका रेखा का व्यापक रूप से न्यूरोनल विभेदनकोनियंत्रित करने वाले आण्विक तंत्रों के अध्ययनों में व्यापक रूप से प्रयोग किया जाता है 26,27,28. इससे भी महत्वपूर्ण बात यह है कि कोशिका प्रत्यारोपण29,30के बाद ट्यूमर का विकास नहीं देखा गया .

यह अंत करने के लिए, अल्जाइमर रोग के रूप में neurodegenerative रोगों पर अनुसंधान17,18 भी P19 सेल लाइन का उपयोग किया जाता है, और हमें विश्वास है कि इस अध्ययन में विकसित विधि इस प्रकार आणविक स्पष्ट करने में एक भूमिका निभानी होगी neurodevelopmental असामान्यताओं और neurodegenerative रोगों में तंत्र.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

अध्ययन वित्तीय राष्ट्रीय विज्ञान केंद्र, पोलैंड द्वारा समर्थित किया गया था (नहीं अनुदान. UMO-2017/25/N/N/N/N/N/N/N/01886) और KNOW (लीडिंग नेशनल रिसर्च सेंटर) वैज्ञानिक कंसोर्टियम "स्वस्थ पशु - सुरक्षित खाद्य", विज्ञान और उच्च शिक्षा मंत्रालय का निर्णय संख्या 05-1/

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics