Нейрогенез с использованием P19 эмбриональных клеток карциномы

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Линия эмбриональной карциномы P19 мыши (линия клеток P19) широко используется для изучения молекулярного механизма нейрогенеза с большим упрощением по сравнению с анализом in vivo. Здесь мы представляем протокол для ретинойной кислоты индуцированного нейрогенеза в линии клеток P19.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Линия клеток P19, полученная из тератокарциномы эмбриона, полученного из эмбриона мыши, имеет способность дифференцироваться в три слоя микробов. При наличии ретинойной кислоты (РА), суспензия культивируемая линия клеток P19 индуцируется, чтобы дифференцироваться в нейроны. Это явление широко исследуется как модель нейрогенеза in vitro. Таким образом, линия клеток P19 очень полезна для молекулярных и клеточных исследований, связанных с нейрогенезом. Тем не менее, протоколы для нейрональной дифференциации линии клеток P19, описанные в литературе, очень сложны. Метод, разработанный в этом исследовании, прост и будет играть определенную роль в выяснении молекулярных механизмов в нейроразвития аномалий и нейродегенеративных заболеваний.

Introduction

Во время эмбрионального развития одноклеточный слой превращается в три отдельных слоя зародыша1,2,3. Для расширения возможностей исследований явлений, происходящих в vivo, в качестве удобной модели были разработаны генерации трехмерных агрегатов (эмбриональных тел). Сотовые агрегаты, образующиеся таким образом, могут подвергаться воздействию различных условий, вызывающих дифференциацию клеток, которые отражают развитие эмбриона4,5. P19 murine эмбриональной линии клеток карциномы (P19 клеточной линии) обычно используется в качестве клеточной модели для нейрогенеза исследований в пробирке6,7,8. Линия клеток P19 демонстрирует типичные плюрипотентные черты стволовых клеток и может дифференцироваться в нейроны в присутствии ретинойной кислоты (РА) во время агрегации клеток, а затем невритовый рост в условиях адепта. Кроме того, недифференцированная линия клеток P19 также способна формировать мышечно-и кардиомиоцитоподобные клетки под воздействием диметилсульфида (ДМСО)9,10,11,12.

Многие методы13,14,15,16 были зарегистрированы для нейронной дифференциации, но методология иногда сложна и не легко понять, только читая описания. Например, протоколы иногда требуют комбинации Dulbecco в модифицированных Eagle Medium (DMEM) среды дополнены смесью сыворотки икры (CS) и сыворотки крупного рогатого скота плода (FBS)13. Кроме того, средства массовой информации, используемые для развития нейронов часто состоят из Neurobasal и B27 добавки13,14,15,16. Таким образом, существующие методы содержат сложность в их подготовке, и наша цель здесь заключается в упрощении протоколов. В этом исследовании мы продемонстрировали, что DMEM с FBS может быть использован для поддержания линии клеток P19 (DMEM и 10% FBS), а также для развития нейронов (DMEM 5% FBS и RA). Этот упрощенный метод нейрогенеза с использованием линии клеток P19 позволяет нам изучать молекулярный механизм развития нейронов. Кроме того, исследования нейродегенеративных заболеваний, таких как болезнь Альцгеймера также проводится с использованием P19 клеточной линии17,18, и мы считаем, что метод, разработанный в этом исследовании будет играть определенную роль в выяснении молекулярные механизмы при нейроразвитиях и нейродегенеративных заболеваниях.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Содержание культуры

  1. Культура P19 клеточной линии в обслуживании среднего (Dulbecco в модифицированной среде Eagle с 4500 мг / л глюкозы дополнены 10% FBS, 100 единиц / мл пенициллин и 100 единиц / мЛ streptomycin). Инкубировать при 37 градусахПо кв. м и 5% CO 2.

2. Подкультинговые клетки

  1. Когда клетки достигают приблизительно 80% слияния, удалите отработанное средство изколбы клеточной культуры (площадь поверхности 25 см 2).
  2. Вымойте клетки с 2 мл фосфатов буферного солья (PBS) без кальция и магния.
  3. Добавьте 1 мл 0,25% трипсин-ЭДТА (этилэндиаминетететраацетическая кислота) на клеточный монослой.
  4. Положите колбу в инкубатор CO2 (37 градусов по Цельсию и 5% CO2)в течение 2-3 мин.
  5. Оцените привязанность клеток к поверхности колбы. Убедитесь, что все ячейки отделены и плавающие в среде.
  6. Добавьте 9 мл средних эксплуатационных посредственых, чтобы остановить ферментативную активность трипсина.
  7. Повторное приостановку работы ячеек в средстве технического обслуживания.
  8. Перенесите клетки в трубку 15 мл и центрифугу на 5 мин при температуре 200 х и комнатной температуре (RT).
  9. Отбросьте супернатант и добавьте 10 мл свежего среднего обслуживания в трубку 15 мл.
  10. Используйте суспензию ячейки, чтобы определить номер ячейки с помощью счетчика ячейки в соответствии с инструкциями производителя.
  11. Семенные клетки на 2 х 104 клетки/см2 в новой 25 см2 колбы.
  12. Добавьте средний уровень обслуживания до 10 мл.
  13. Положите колбу с клетками в инкубатор CO2 (37 градусов по Цельсию и 5% CO2)в течение 2-3 дней.

3. Трипсин пищеварение

  1. Аспирите Обслуживание Средний из колбы клетки. Вымойте клетки один раз с 2 мл кальция и магния без PBS.
  2. Добавьте 1 мл 0,25% трипсин-EDTA.
  3. Положите колбу с клетками в инкубатор CO2 при 37 градусах по Цельсию в течение 2-3 мин.
  4. Используйте 1 мл пипетки, чтобы разъединить клетки трубацией клеток в десять раз.
  5. Нейтрализовать трипсин, добавив 9 мл дифференциации Medium (Dulbecco в модифицированной среде Eagle с 4500 мг / л глюкозы дополняется 5% FBS, 100 единиц / мл пенициллин и 100 единиц / мл streptomycin) без РА в клетки.
  6. Перенесите клетки в трубку 15 мл и центрифугу на 5 мин при 200 х г и РТ.
  7. Откажитесь от супернатанта и добавьте 1 мл дифференциации Medium без ретинойной кислоты (РА). Отреприжите клеточные гранулы.
  8. Используйте суспензию ячейки для определения номера ячейки с помощью счетчика ячейки в соответствии с инструкцией производителя.

4. Агрегированное поколение

  1. Добавьте 5 зЛ РА (1 мМ бульона, растворенного в 99,8% этанола, хранящегося при -20 градусах Цельсия) к 10 мл дифференциации Среднего и хорошо перемешайте (окончательная концентрация 0,5 мкм РА).
    ПРИМЕЧАНИЕ: РА светочувствительный. Низкая концентрация EtOH не влияет на дифференциацию клеток19,20,21.
  2. Добавьте 10 мл дифференциации Medium (с РА) в 100 мм необработанное культурное блюдо (посвященное культуре подвески).
  3. Семя 1 х 106 клеток в 100 мм блюдо (Блюдо площадью 56,5 см2).
  4. Положите колбу с клетками в инкубатор при 37 градусах Цельсия и 5% CO2 в течение 2 дней, чтобы способствовать образованию агрегатов.
  5. Через 2 дня обменяйся на средний дифференциация. Аспирная среда, содержащая агрегаты с помощью 10 мл пипетки и переносима на трубку 15 мл на РТ.
  6. Разрешить агрегаты, чтобы поселиться под действием силы тяжести в течение 1,5 мин на RT.
  7. Отбросьте супернатант.
  8. Добавьте свежий 10 мл дифференциации Medium с 0,5 мкм РА с помощью серологического пипетки 10 мл.
    ПРЕДЕКТО: Не пипетка ячейки агрегатов вверх и вниз.
  9. Семя агрегатов в новый 100 мм необработанных культуры блюдо (посвященный подвесной культуры).
  10. Поместите тарелку в инкубатор (при 37 градусах по Цельсию и 5% CO2)в течение 2 дней.

5. Агрегаты диссоциации

  1. Аспирировать агрегаты ячейки с помощью 10 мл пипетки.
  2. Перенесите агрегаты на трубку объемом 15 мл. Разрешить совокупности клеток, чтобы осесть под действием силы тяжести в течение 1,5 мин.
  3. Удалите супернатант.
  4. Вымойте агрегаты только с DMEM (без сыворотки и антибиотиков).
  5. Разрешить клеточные агрегаты оседать гравитационным осадочным отложением в течение 1,5 мин на RT.
  6. Усилите супернатант и добавьте 2 мл трипсина-ЭДТА (0,25%).
  7. Поместите агрегаты ячейки в водяную ванну (37 градусов по Цельсию) в течение 10 мин. Агитировать агрегаты осторожно каждые 2 минуты, нажав рукой.
  8. Остановите процесс трипсинизации, добавив 4 мл среднего обслуживания.
  9. Пипетка агрегатирует вверх и вниз 20 раз с помощью 1 мл пипетки.
  10. Клетки центрифуги в течение 5 мин при 200 х г и РТ.
  11. Удалите супернатант и resuspend клетки гранулы в 5 мл обслуживания среднего.
  12. Определите номер ячейки с помощью клеточного счетчика.

6. Покрытие ячеек

  1. Добавьте 3 мл на скважину среднего обслуживания в 6-колодную пластину.
  2. Семенные клетки в 6-хорошей культуре пластины при плотности 0,5 х 106/ хорошо.
  3. Инкубировать при 37 градусах Цельсия с концентрацией 5% CO 2.
  4. Семя клетки на крышке стекла в 6 хорошо культуры пластины и выполнять иммуно-пятно с анти-MAP2 антитела (20% слияния). Используйте 6-колодую пластину, чтобы изолировать РНК и выполнить RT-PCR для Map2, NeuN, Oct4, Nanog, и Gapdh (20% слияния).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Упрощенная схема протокола индукции нейрогенеза в линии клеток P19 представлена на рисунке 1. Для определения характера клеточной линии P19 в недифференцированном состоянии и во время нейрогенеза был использован метод RT-PCR (обратная транскрипция-полимераза цепная реакция). Недифференцированная линия клеток P19 выразила гены плюрипотентности, такие как органический катион/карнитин-транспортер4 (Oct4) и Nanog homeobox (Nanog). Нейрогенез, индуцированный агрегацией клеток в культуре подвески в присутствии РА, привел к быстрому снижению экспрессии Oct4 и Nanog. В противоположность, выражение нейронных маркеров: микротрубо-ассоциированный белок 2 (Map2) , NeuN (также известный как РНК связывающий белок, лиса-1 homolog 3 (Rbfox3)) увеличилась после срабатывания нейрогенеза (Рисунок2)6 ,14,15,22. Праймеры, используемые для каждого гена, указаны вместе с нуклеотидными последовательностями и размером продукта в таблице 1. Микроскопическое изображение недифференцированной линии клеток P19 представило круглую морфологию(рисунок 3A). После индукции нейрогенеза, нейрональная структура клеток была хорошо видна через 4 дня после покрытия(рисунок 3B). Кроме того, Рисунок 4 представляет флуоресценцию выражение MAP2 в дифференцированной линии клеток P19 (4 дня после покрытия клеток)14.

Figure 1
Рисунок 1 : Протокол схема для индукции нейрогенеза в клетках эмбриональной карциномы P19. Нейрогенез индуцируется путем культивирования линии клеток P19 в 100 мм необработанных культурных блюд с 5% от FBS и 0,5 мкм РА. После 4 дней, совокупности клеток разъединяются с трипсином и посеяны на пластине культуры адептов клеток в течение следующих 4 дней. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2 : Изменения экспрессии генов в линии клеток P19. Диаграмма полосы представляет выражение гена для недифференцированной линии клетки P19 (Oct4, Nanog) и во время neurogenesis(Map2, NeuN). Глицеальдегид-3-фосфат дегидрогеназы (Gapdh) был использован в качестве эталонного гена. Образцы загружаются в гель агарозы (1,5%) в двойных репликациях. Аббревиативы: Недифференцированный представляет недифференцированную линию клеток P19 без лечения РА; День 1-4 представляет последующие дни после клеточного покрытия- после 4 дней после лечения РА и стадии агрегации клеток. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3 : Репрезентативные изображения анализа линии клеток P19. (A) Легкие микроскопические изображения недифференцированной линии клеток P19. (B) Легкие микроскопические изображения линии клеток P19 после 4 дней нейрогенеза- после 4 дней после лечения РА и стадии агрегации клеток. Шкала бар 100 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4 : Представитель иммунофлуоресценции изображение дифференцированной линии клеток P19. Слияние иммунофлуоресценции изображение линии клеток P19, окрашенное анти-MAP2 и DAPI через 4 дня после покрытия. Шкала бар 100 мкм. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Грунтовка Последовательность праймер Продукта
размер (bp)
Гапх Ф: ТГАККАКТАКАТАКАТГЦТАКА
R: CTTCCCATCTCGCTTG
85
Карта2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211 г.
Окт4 F: GGCGTCTCTTGGAAAGGTGTTC
R: CTCGAACCACATCTCT
313 г.
Нейн F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTCCCCTCTACTACGAT
160 г.
Наног F: АААГГАТГАГАТГГГАГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГГ
R: CTGGCTTGCCCTGACTTAAGC
520 г.

Таблица 1: Праймеры, используемые для RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Здесь мы описываем простой протокол нейрогенеза с использованием линии клеток P19. Хотя многие доклады были опубликованы в этой связи, подробная методология индукции нейрогенеза с использованием линии клеток P19 остается неясным. Кроме того, мы использовали простой высокий уровень глюкозы (4500 мг/л) DMEM среды с 10% FBS для всего эксперимента. Это позволило нам провести нейрогенный эксперимент в удобной для пользователя манере и расширить использование этого метода в будущем.

Наиболее важными точками в этом протоколе являются концентрация РА, а также генерация клеточных агрегатов в культуре подвески. Стимуляция нейрогенеза в линии клеток P19 может осуществляться без образования агрегатов, но количество нейрональных клеток, производимых будет сокращено на две трети в клеточной культуре22. Monzo et al. показали индукцию нейрогенеза в линии клеток P19, культивируя их в монослой15. Хотя их метод довольно удобен, так как мы можем исключить процесс культуры подвески, необходимы дальнейшие исследования, чтобы сравнить их метод с другими хорошо описанными методами. Концентрация РА 0,5 мкм в среде произвела большое количество клеточных агрегатов, а также нейронов после покрытия по сравнению с 1 мкм РА. Важно также отметить, что мы не могли наблюдать эффективный нейрогенез, когда большинство агрегатов прикреплены к нижней части блюда культуры подвески во время лечения РА. Оптимальное количество линии ячейки P19, которая будет использоваться в начале процедуры, составляет 1 х 106 на каждые 10 мл дифференциации Medium. Во время индукции нейрогенеза, линия клеток P19 образует различные размеры агрегатов и даже одиночные клетки находятся в культуре. Чтобы преодолеть эту проблему, мы собрали клеточные агрегаты после 1,5 мин свободного падения в трубке 15 мл. Мы обнаружили, что такой подход позволяет исключить загрязнение одиночных клеток. Также рекомендуется выполнять обогащение нейронов с клеточной культурой с использованием антимитотических препаратов (например, цитозин арабиноз) для долгосрочной культуры, чтобы ингибировать широкое распространение глиальных клеток23.

Нейроны, полученные из линии клеток P19, выражают ионотропный глутаматные рецепторы как N-метил-D-аспартат (NMDA) и альфа-амино-3-гидрокси-5-метил-4-изосказол пропионат (АМПА)/каинит (KA) типов24,25, а также функциональные рецепторы з-аминомасляной кислоты (ГАМК)25. Таким образом, линия клеток P19 широко используется в исследованиях молекулярных механизмов, регулирующих дифференциацию нейронов26,27,28. Что еще более важно, развитие опухоли не наблюдалось после пересадки клеток29,30.

С этой целью, исследования нейродегенеративных заболеваний, таких как болезнь Альцгеймера17,18 также проводится с использованием p19 клеточной линии, и мы считаем, что метод, разработанный в этом исследовании, таким образом, будет играть определенную роль в выяснении молекулярных механизмы нейроразвития аномалий и нейродегенеративных заболеваний.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Исследование было финансово поддержано Национальным научным центром, Польша (грант нет. УМО-2017/25/N/N/N/01886) и KNOW (Ведущий национальный исследовательский центр) Научный консорциум "Здоровое животное - безопасная пища", решение Министерства науки и высшего образования No 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics