נוירוגנזה באמצעות P19 Embryonal קרצינומה של תאים

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

העכבר P19 מתחלקים קרצינומה של קו התא (קו התא P19) משמש רבות לחקר המנגנון המולקולרי של נוירוגנזה עם פישוט גדול בהשוואה לניתוח vivo. כאן, אנו מציגים פרוטוקול עבור נוירוגנזה הנגרמת חומצה המושרה P19 קו התא.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

קו התא P19 נגזר העובר העכבר הנגזר teratocarcinoma יש את היכולת להבדיל לתוך שלוש שכבות הנבט. בנוכחות חומצה retinoic (RA), ההשעיה תרבותי P19 קו התא הוא המושרה להבדיל לנוירונים. תופעה זו נחקר בהרחבה כמודל נוירוגנזה בתוך מבחנה. לכן, קו התא P19 הוא מאוד שימושי עבור המחקרים המולקולריים והסלולריים הקשורים נוירוגנזה. עם זאת, פרוטוקולים עבור הבחנה עצבית של קו התא P19 המתואר בספרות הם מורכבים מאוד. השיטה המפותחת במחקר זה פשוטה והיא תשחק תפקיד בהסבר למנגנון המולקולרי בחריגות נוירונטיות ומחלות ניווניות.

Introduction

במהלך embryonal פיתוח, שכבת תא אחת הופכת לשלוש שכבות הנבט הנפרדות1,2,3. כדי להגביר את אפשרויות המחקר של תופעות המתרחשות בvivo, התפתחו הדור של אגרגטים תלת-ממדיים (גופים עובריים) כמודל נוח. אגרגטים סלולריים שנוצרו בדרך זו ניתן לחשוף לתנאים שונים גרימת בידול התא, אשר משקפים את ההתפתחות של העובר4,5. קו קרצינומה עובריים P19 murine (קו תא P19) משמש בדרך כלל כמודל הסלולר ללימודי נוירוגנזה ב מבחנה6,7,8. קו התא P19 מציג תכונות מסוימות של תא גזע בעוצמה pluripotent והוא יכול להבדיל לנוירונים בנוכחות של חומצה retinoic (RA) במהלך צבירת תאים ואחריו neurite מוצלח תחת תנאים חסיד. יתר על כן, קו תא P19 מובחן הוא גם מסוגל להרכיב תאים שרירים וקרדיולציט בדומה תחת השפעת diמתיל סולפוקסיד (dmso)9,10,11,12.

שיטות רבות שונות13,14,15,16 דווחו על בידול עצבי, אבל המתודולוגיה היא לפעמים מסובכת ולא קל לתפוס רק על ידי קריאת התיאורים. לדוגמה, פרוטוקולים דורשים לפעמים שילוב של מדיום הנשר המתוקן של Dulbecco (DMEM) בינוני עם תערובת של סרום עגל (CS) וסרום של שור עוברי (FBS)13. יתרה מזאת, מדיה המשמשת להתפתחות עצבית מורכבת לעתים קרובות מנוירוסיס ותוספי B2713,14,15,16. ככאלה, שיטות קיימות מכילות את המורכבות שבהכנות והמטרה שלנו כאן היא לפשט את הפרוטוקולים. במחקר זה, הדגמנו כי DMEM עם FBS יכול להיות מנוצל עבור שמירה על קו התא P19 (Dמאמ + 10% FBS), כמו גם עבור פיתוח עצבי (DMEM גברת + 5% FBS + RA). זו שיטה פשוטה עבור נוירוגנזה באמצעות קו התא P19 מאפשר לנו ללמוד את המנגנון המולקולרי של איך הנוירונים מפותחים. יתר על כן, מחקר על מחלות ניווניות כגון מחלת אלצהיימר מתנהל גם באמצעות P19 cell קו17,18, ואנו מאמינים כי השיטה שפותחה במחקר זה ישחק חלק בהסבר לצאת ה מנגנונים מולקולריים בחריגות נוירו-התפתחותיות ומחלות ניווניות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. תחזוקת התרבות

  1. תרבות קו התא P19 בינונית תחזוקה (מדיום הנשר שונה של מאוד עם 4,500 mg/L של גלוקוז שיושלם עם 10% FBS, 100 יחידות/מ"ל פניצילין ו 100 יחידות/mL סטרפטומיצין). מודטה ב 37 ° צ' ו 5% CO2.

2. תאים תת-משניים

  1. כאשר התאים מגיעים כ 80% המפגש, להסיר את המדיום המושקע מבחנות תרבות התא (שטח המשטח 25 ס מ2).
  2. לשטוף את התאים עם 2 מ ל של פוספט מלוחים באגירה (PBS) ללא סידן ומגנזיום.
  3. להוסיף 1 מ ל של 0.25% טריפסין-EDTA (חומצה אטיליאדיאמאאת) אל התא מונאולייר.
  4. שים את הבקבוקון בחממה CO2 (37 ° צ' ו 5% CO2) עבור 2-3 דקות.
  5. העריכו את התא המצורף למשטח הבקבוקון. ודא שכל התאים מנותקים וצפים במדיום.
  6. הוסף 9 מ ל של מדיום תחזוקה כדי להפסיק את הפעילות האנזימטית של טריפסין.
  7. השהה מחדש את התאים במדיום תחזוקה.
  8. העבר תאים לצינור 15 מ"ל ו צנטריפוגה עבור 5 דקות ב 200 x g וטמפרטורת החדר (RT).
  9. השמט את הסופרנטאנט והוסף 10 מ ל של מדיום תחזוקה רעננה לתוך השפופרת של 15 מ ל.
  10. השתמש בהשעיה של התא כדי לקבוע את מספר התא באמצעות מונה תאים בהתאם להוראות היצרן.
  11. תאי הזרע ב 2 x 104 תאים/cm2 בבקבוקון 25 ס מ חדש2 .
  12. הוסיפו את מדיום התחזוקה עד 10 מ ל.
  13. לשים את הבקבוקון עם תאים בחממה CO2 (37 ° צ' ו 5% CO2) עבור 2-3 ימים.

3. טריפסין העיכול

  1. . מתוך הבקבוקון של התא לשטוף את התאים פעם אחת עם 2 מ ל של סידן ומגנזיום חינם PBS.
  2. הוסף 1 מ ל של 0.25% טריפסין-EDTA.
  3. לשים את הבקבוקון עם תאים לתוך החממה CO2 ב 37 ° c עבור 2-3 דקות.
  4. השתמש בפיפטה משנת 1 mL כדי לנתק את התאים על ידי מלטף תאים עשר פעמים.
  5. לנטרל טריפסין על ידי הוספת 9 מ ל של בידול בינונית (מדיום הנשר שונה של בינוני עם 4500 mg/L של גלוקוז שיושלם עם 5% FBS, 100 יחידות/מחלת הפניצילין ו 100 יחידות/mL סטרפטומיצין) ללא RA לתאים.
  6. העבר תאים לצינור 15 מ"ל ו צנטריפוגה עבור 5 דקות ב 200 x g ו RT.
  7. להיפטר supernatant ולהוסיף 1 מ ל של בידול בינונית ללא חומצה retinoic (RA). . השהה מחדש את הגלולה הסלולרית
  8. השתמש בהשעיה של התא כדי לקבוע את מספר התא באמצעות מונה תאים בהתאם להוראת היצרן.

4. הדור המצטבר

  1. הוסף 5 μL של RA (במלאי 1 מ"מ הומס 99.8% אתנול, מאוחסן ב-20 ° c) ל 10 מ ל של הבדלה בינונית ומערבבים היטב (הריכוז הסופי של 0.5 μM RA).
    הערה: . רה א רגיש באור ריכוז נמוך של אטוה אינו משפיע על בידול תא19,20,21.
  2. הוסף 10 מ ל של בידול בינוני (עם RA) אל מאכל התרבות 100 מ"מ (מוקדש תרבות ההשעיה).
  3. הזרע את 1 x 106 תאים במנה 100 מ"מ (שטח המשטח 56.5 ס"מ2).
  4. לשים את הבקבוקון עם תאים לתוך החממה ב 37 ° צ' ו 5% CO2 עבור 2 ימים כדי לקדם את היווצרות אגרגטים.
  5. לאחר יומיים, החלף את המדיום בידול. משוכי מדיום המכיל אגרגטים באמצעות מנקז 10 מ ל ולהעביר לצינור 15 מ ל ב-RT.
  6. לאפשר לאגרגטים להתיישב על ידי כוח הכבידה עבור 1.5 דקות ב RT.
  7. . מחק את הסופרנטאנט
  8. הוסף חדש 10 מ ל של בידול בינוני עם 0.5 μm RA באמצעות הצינורות 10 mL סרולוגית.
    זהירות: אין לנקות את מצרפים את התאים למעלה ולמטה.
  9. הזרע האגרגטים לתוך המנה החדשה 100 mm לא מטופלים התרבות (מוקדש תרבות ההשעיה).
  10. מניחים את הצלחת בחממה (ב 37 ° צ' ו 5% CO2) במשך יומיים.

5. אגרגטים דיסוציאציה

  1. מתיף את האגרגטים בתאים. באמצעות פיפטה של 10 מ ל
  2. העבירו את האגרגטים. לשפופרת של 15 מ ל לאפשר לאגרגטים תאים להתיישב על ידי כוח הכבידה עבור 1.5 דקות.
  3. . הסר את הסופרנטאנט
  4. רוחצים את האגרגטים בלבד (סרום-וללא אנטיביוטיקה).
  5. לאפשר לאגרגטים תאים להתפשר על ידי משקעי כוח הכבידה עבור 1.5 דקות ב RT.
  6. הוסיפו את הסופרנטנט ומוסיפים 2 מ ל טריפסין-אדטה (0.25%).
  7. מניחים את אגרגטים התא לתוך אמבט מים (37 ° c) במשך 10 דקות. מתפרעים את האגרגטים בעדינות כל 2 דקות על ידי הקשה עם יד.
  8. להפסיק את תהליך הטריסינוניזציה על ידי הוספת 4 מ ל של מדיום תחזוקה.
  9. פיפטה מגיע למעלה ולמטה 20 פעמים. באמצעות פיפטה 1 מ ל
  10. תאים צנטריפוגה עבור 5 דקות ב 200 x g ו RT.
  11. הסר את הסופרנטאנט והשהה מחדש את הגלולה הסלולרית ב-5 מ ל של אמצעי תחזוקה.
  12. קבע את מספר הטלפון באמצעות מונה תאים.

6. ציפוי תאים

  1. הוסף 3 מ ל לכל טוב של תחזוקה בינונית לצלחת 6.
  2. תאי הזרע בצלחת התרבות 6-היטב בצפיפות של 0.5 x 106/well.
  3. מודטה ב 37 ° c עם 5% CO2 ריכוז.
  4. זרע את התאים על זכוכית לכסות ב 6 היטב לוחית התרבות ולבצע הכתמים עם נוגדן anti-MAP2 (20% המפגש). השימוש בצלחת 6-הבאר כדי לבודד RNA ולבצע RT-PCR עבור Map2, neun, Oct4, ננוg, ו-הגנד (20% המפגש).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

הערכה פשוטה של פרוטוקול אינדוקציה נוירוגנזה ב P19 קו התא מוצג באיור 1. על מנת להגדיר את האופי של קו התא P19 במצב מובחן ובמהלך נוירוגנזה, RT-PCR (הפוכה שרשרת של תגובת השרשרת) שימוש. קו התאים P19 מובחן הביע את גנים הפלדה כגון קטיון אורגני/carnitine transporter4 (Oct4) ו nanog הומבוקס (nanog). נוירוגנזה הנגרמת על ידי צבירת תאים בתרבות ההשעיה בנוכחות RA הוביל ירידה מהירה של Oct4 ו nanog ביטוי. בניגוד, הביטוי של תא העצב סמנים: חלבון מיקרוכדורית 2 (Map2), neun (הידוע גם בשם החלבון כריכת RNA, פוקס -1 הומולוג 3 (Rbfox3)) גדל לאחר נוירוגנזה המופעל (איור 2)6 ,14,15,22. התחל של כל אחד מהגנים מצוין יחד עם הגלים של נוקלאוטיד והגודל של המוצר בטבלה 1. תמונה מיקרוסקופית של קו התא P19 מובחן הציג מורפולוגיה בצורת עגול (איור 3א). לאחר האינדוקציה של נוירוגנזה, המבנה העצבי של התאים היה גלוי בבירור 4 ימים לאחר ציפוי (איור 3ב). בנוסף, איור 4 מייצג את התמונה הפלואורסצנטית של ביטוי MAP2 ב קו P19 cell הבדיל (4 ימים לאחר הציפוי תאים)14.

Figure 1
איור 1 : סכימטי פרוטוקול עבור אינדוקציה של נוירוגנזה בתאים P19 embryonal קרצינומה. נוירוגנזה נגרמת על ידי culturing קו התא P19 בצלחת תרבות 100 mm לא מטופלים עם 5% FBS ו 0.5 μM RA. לאחר 4 ימים, יחידות התאים ממונתק עם טריפסין ומזריעה את לוח התרבות של תאי התאים לאחר 4 הימים הבאים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2 : שינויים בביטוי הגנים בשורת התא P19. גרף הלהקה מייצג ביטוי גנטי עבור קו מובחן P19 cell (Oct4, ננוg) ובמהלך נוירוגנזה (Map2, neun). גליצראלדהיד-3-פוספט דהידרוגנאז (הידרוdh) שימש כגן ההתייחסות. דגימות מוטענים ג'ל (1.5%) כפולים כפולים. קיצורים: מובחן מייצג את קו התא P19 מובחן ללא טיפול RA; יום 1-4 מייצג ימים שלאחר מכן לאחר ציפוי תאים-בעקבות 4 ימים לאחר טיפול RA וצבירת תאים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3 : תמונות מייצגות של ניתוח של קו התא P19. (א) תמונות מיקרוסקופיים אור של קו התא P19 מובחן. (ב) תמונות מיקרוסקופיים קלות של קו תא P19 לאחר 4 ימים של נוירוגנזה-בעקבות 4 ימים לאחר טיפול RA וצבירת תאים. סרגל קנה מידה = 100 μm. נא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4 : הנציגה החיסונית של הנציג של קו P19 הבדיל. ממוזג התמונה החיסונית של קו P19 cell מוכתם אנטי MAP2 ו DAPI ב 4 ימים לאחר ציפוי. סרגל קנה מידה = 100 μm. נא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

פריימר תחל מוצר
גודל (bp)
שגנד F: TGACTCACGGTA
מדריך המחקר
85
Map2 כיצד לעשות זאת
שאלה: כמוסות מקסיאחים
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: מדריך הגנה
313
נאון כיצד לעשות זאת
שאלה: מאור
160
ננו-ג'י F: AAAGGATGAAGTGCAAGCGGTGG
מדריך כמוסות-מרקט
520

שולחן 1: תחל בשימוש עבור RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כאן, אנו מתארים פרוטוקול פשוט עבור נוירוגנזה באמצעות קו התא P19. למרות דיווחים רבים פורסמו בהקשר זה, מתודולוגיה מפורטת עבור אינדוקציה נוירוגנזה באמצעות קו P19 line נשאר ברור. יתר על כן, אנו מנוצלים גלוקוז גבוה פשוט (4,500 mg/L) DMEM בינוני עם 10% FBS עבור הניסוי כולו. הדבר איפשר לנו לבצע את הניסוי הנוירוגניים באופן ידידותי למשתמש ולהרחיב את השימוש בשיטה זו לעתיד.

הנקודות הקריטיות ביותר בפרוטוקול זה הן ריכוז RA, כמו גם הדור של אגרגטים תאים בתרבות ההשעיה. גירוי של נוירוגנזה בתוך קו התא P19 יכול להתבצע ללא היווצרות של אגרגטים, אבל מספר התאים העצביים המיוצרים יהיה מופחת על ידי שני שלישים בתרבות התא22. Monzo et al. הראו אינדוקציה נוירוגנזה ב P19 cell על ידי culturing אותם במונאולייר15. למרות שהשיטה שלהם היא נוחה למדי כמו שאנחנו יכולים לחסל את תהליך התרבות ההשעיה, מחקרים נוספים נדרשים להשוות את השיטה שלהם עם שיטות אחרות מתוארים היטב. ריכוז RA של 0.5 μM במדיום הפיק מספר גבוה של אגרגטים תאים, כמו גם נוירונים לאחר ציפוי לעומת 1 μM של RA. חשוב גם לציין כי לא יכולנו לצפות נוירוגנזה יעילה כאשר רוב האגרגטים מחוברים לתחתית הצלחת תרבות ההשעיה במהלך הטיפול RA. המספר האופטימלי של קו התא P19 לשמש בתחילת ההליך הוא 1 x 106 עבור כל 10 מ ל של בידול בינוני. במהלך אינדוקציה של נוירוגנזה, קו התא P19 צורות משתנות בגודל ואפילו תאים בודדים נמצאים בתרבות. כדי להתגבר על בעיה זו, אספנו את אגרגטים התאים לאחר 1.5 דקות של נפילה חופשית בשפופרת של 15 מ ל. מצאנו שגישה זו מאפשרת החרגה של מזהמים של תאים בודדים. מומלץ גם לבצע העשרה עצביים עם תרבות התאים באמצעות תרופות נגד mitotic (למשל, ציטוסין האראנוסייד) עבור תרבות ארוכת טווח לעכב התפשטות נרחבת של תאים גליאל23.

נוירונים הנגזרים מהקו הP19 לבטא את קולטני גלוטמט השני של N-מתיל-D-aspartate (NMDA) ו-alpha-אמינו 3-הידרוxy-5-מתיל-4-isoxazole propionate (אמפא)/kainite (KA) סוגים24,25, כמו גם חומצה γ-בוטירית תפקודית25. לפיכך, קו התא P19 משמש רבות במחקרים על מנגנונים מולקולריים המסדירים בידול עצבי26,27,28. חשוב יותר, התפתחות הגידול לא נצפתה לאחר השתלת תא29,30.

לשם כך, מחקר על מחלות ניווניות כגון מחלת אלצהיימר17,18 מתנהל גם באמצעות קו P19 cell, ואנו מאמינים כי השיטה שפותחה במחקר זה יהיה ובכך לשחק חלק בהסבר המולקולרי מנגנונים ליקויים נוירוהתפתחותיים ומחלות ניווניות.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

המחקר היה נתמך כספית על ידי מרכז המדע הלאומי, פולין (מענק לא. מו-2017/25/N/NZ3/01886) ויודע (מרכז המחקר הלאומי המוביל) קונסורציום מדעי "בעלי חיים בריאים-מזון בטוח", החלטה של משרד המדע והשכלה גבוהה מס ' 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics