Neurogenes med P19 embryonala cancerceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Den P19 mus embryonal carcinoma cellinjer (P19 cellinjer) används ofta för att studera den molekylära mekanismen för neurogenes med stor förenkling jämfört med in vivo analys. Här presenterar vi ett protokoll för retinoinsyra syra-inducerad neurogenes i P19 cell linjen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den P19 cellinjer härrör från en mus embryo-derived teratocarcinom har förmågan att differentiera till de tre bakterie lagren. I närvaro av retinoinsyra syra (RA), den suspension odlade P19 cellinjer induceras för att differentiera till nervceller. Detta fenomen utreds utförligt som en neurogenes modell in vitro. Därför, den P19 cellinjer är mycket användbart för molekylära och cellulära studier i samband med neurogenes. Emellertid, protokoll för neuronala differentiering av P19 cellinjer som beskrivs i litteraturen är mycket komplexa. Den metod som utvecklats i denna studie är enkel och kommer att spela en roll i att belysa de molekylära mekanismerna i neurologiska utvecklingsstörningar och neurodegenerativa sjukdomar.

Introduction

Under embryonal utveckling, ett enda cellskikt omvandlas till tre separata bakterie skikt1,2,3. För att öka forskningsmöjligheterna för fenomen som inträffar in vivo har generering av tredimensionella aggregat (embryonala kroppar) utvecklats som en praktisk modell. Cellulära aggregat bildas på detta sätt kan utsättas för olika förhållanden som orsakar celldifferentiering, som återspeglar utvecklingen av embryot4,5. Den P19 murina embryonal carcinoma cell linje (P19 cellinjer) används ofta som en cellulär modell för neurogenes studier in vitro-6,7,8. Den P19 cellinjer uppvisar typiska pluripotenta stamceller funktioner och kan differentiera till nervceller i närvaro av retinoinsyra (RA) under cell aggregering följt av neurit utväxt under anhängare villkor. Dessutom, den odifferentierade P19 cell linjen är också kapabel att bilda muskel-och kardiomyocyte-liknande celler under påverkan av dimetylsulfoxid (DMSO)9,10,11,12.

Många metoder13,14,15,16 har rapporterats för neuronala differentiering, men metoden är ibland komplicerat och inte lätt att förstå genom att bara läsa beskrivningarna. Till exempel, protokoll kräver ibland en kombination av Dulbecco modifierade Eagle medium (DMEM) medium kompletteras med en blandning av kalv serum (CS) och foster bovint serum (FBS)13. Dessutom, medier som används för neuronala utveckling består ofta av neurobasal och B27 kosttillskott13,14,15,16. Som sådan, befintliga metoder innehåller komplexitet i deras beredning och vårt mål här är att förenkla protokollen. I denna studie, vi visade att DMEM med FBS kan utnyttjas för att upprätthålla P19 cellinjer (DMEM + 10% FBS) samt för neuronala utveckling (DMEM + 5% FBS + RA). Denna förenklade metod för neurogenes med hjälp av P19 cellinjer ger oss möjlighet att studera den molekylära mekanismen för hur neuroner utvecklas. Dessutom bedrivs även forskning om neurodegenerativa sjukdomar som Alzheimers sjukdom med hjälp av P19 cell linje17,18, och vi anser att den metod som utvecklats i denna studie kommer att spela en roll i att belysa molekylära mekanismer i neurologiska utvecklingsstörningar och neurodegenerativa sjukdomar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. underhåll av kulturen

  1. Odla P19 cellinjer i underhålls medium (Dulbecco ' s Modified Eagle ' s medium med 4 500 mg/L glukos kompletterat med 10% FBS, 100 enheter/mL penicillin och 100 enheter/mL streptomycin). Inkubera vid 37 ° c och 5% CO2.

2. subculturering av celler

  1. När cellerna når cirka 80% Confluence, ta bort det förbrukade mediet från cell odlings flaskans kolvar (yta 25 cm2).
  2. Tvätta cellerna med 2 mL fosfatbuffrad saltlösning (PBS) fri från kalcium och magnesium.
  3. Tillsätt 1 mL 0,25% trypsin-EDTA (etylendiamintetraättiksyra) på cellens monolayer.
  4. Placera kolven i CO2 -inkubatorn (37 ° c och 5% Co2) för 2-3 min.
  5. Bedöm cell tillbehöret till kolvens yta. Se till att alla celler är fristående och flytande i mediet.
  6. Tillsätt 9 mL underhålls medium för att stoppa trypsins enzymatiska aktivitet.
  7. Omsuspendera cellerna i underhålls medium.
  8. Överför celler till en 15 mL tub och Centrifugera i 5 min vid 200 x g och rumstemperatur (RT).
  9. Kassera supernatanten och tillsätt 10 mL nytt underhålls medium i 15 mL-röret.
  10. Använd cellsuspensionen för att bestämma cellnumret med hjälp av en cell räknare enligt tillverkarens anvisningar.
  11. Frö celler vid 2 x 104 celler/cm2 i en ny 25 cm2 kolv.
  12. Tillsätt underhålls mediet upp till 10 mL.
  13. Placera kolven med celler i CO2 -inkubatorn (37 ° c och 5% Co2) under 2-3 dagar.

3. trypsin matsmältning

  1. Sug upp underhålls mediet från cell kol ven. Tvätta cellerna en gång med 2 mL kalcium och magnesium fri PBS.
  2. Tillsätt 1 mL 0,25% trypsin-EDTA.
  3. Placera kolven med celler i CO2 -inkubatorn vid 37 ° c i 2-3 min.
  4. Använd 1 mL pipett för att separera cellerna genom att Pipettera celler tio gånger.
  5. Neutralisera trypsin genom att lägga till 9 mL differentiering medium (Dulbecco modifierade Eagle ' s medium med 4500 mg/L av glukos kompletteras med 5% FBS, 100 enheter/mL penicillin och 100 enheter/mL streptomycin) utan RA till cellerna.
  6. Överför celler till en 15 mL tub och Centrifugera i 5 min vid 200 x g och RT.
  7. Kassera supernatanten och tillsätt 1 mL differentierings medium utan retinoinsyra (RA). Omsuspendera cellpelleten.
  8. Använd cellsuspensionen för att bestämma cellnumret med hjälp av en cell räknare enligt tillverkarens instruktion.

4. aggregerad generering

  1. Tillsätt 5 μL RA (1 mM lager upplöst i 99,8% etanol, lagrat vid-20 ° c) till 10 mL differentierings medium och blanda väl (slutlig koncentration av 0,5 μM RA).
    Anmärkning: RA är ljuskänsligt. Låg koncentration av EtOH påverkar inte celldifferentiering19,20,21.
  2. Tillsätt 10 mL differentierings medium (med RA) till den 100 mm icke-behandlade kultur skålen (tillägnad suspensions kulturen).
  3. Frö 1 x 106 celler i 100 mm skålen (skålen yta 56,5 cm2).
  4. Placera kolven med celler i inkubatorn vid 37 ° c och 5% CO2 i 2 dagar för att främja aggregat bildning.
  5. Efter 2 dagar, utbyta differentierings mediet. Aspirera medium innehållande aggregat med en 10 mL pipett och överför till en 15 mL tub vid RT.
  6. Låt aggregaten nöja sig med tyngdkraften för 1,5 min vid RT.
  7. Kassera supernatanten.
  8. Tillsätt en ny 10 ml differentierings medium med 0,5 μm ra med en 10 ml serologiska pipett.
    Försiktighet: Pipettera inte cell aggregaten uppåt eller nedåt.
  9. Frö aggregaten till nya 100 mm icke-behandlade kultur skålen (tillägnad suspension kultur).
  10. Placera plattan i inkubatorn (vid 37 ° c och 5% CO2) i 2 dagar.

5. aggregat dissociation

  1. Aspirera cell aggregaten med hjälp av en 10 mL pipett.
  2. Överför aggregaten till en 15 mL tub. Låt cell aggregaten att reglera med tyngdkraften för 1,5 min.
  3. Ta bort supernatanten.
  4. Tvätta aggregaten med DMEM ensamt (serum-och antibiotika fritt).
  5. Låt cellen aggregat att bosätta sig genom gravitationen sedimentering för 1,5 min vid RT.
  6. Sug upp supernatanten och tillsätt 2 mL trypsin-EDTA (0,25%).
  7. Placera cell aggregaten i ett vattenbad (37 ° c) i 10 min. agitera aggregaten försiktigt varje 2 min genom att knacka med en hand.
  8. Stoppa trypsinization processen genom att tillsätta 4 mL underhålls medium.
  9. Pipetten aggregerar upp och ner 20 gånger med 1 mL pipett.
  10. Centrifugera celler i 5 min vid 200 x g och RT.
  11. Avlägsna supernatanten och Omsuspendera cellpelleten i 5 mL underhålls medium.
  12. Bestäm cellnumret med en cell räknare.

6. pläteringsceller

  1. Tillsätt 3 mL per brunn av underhålls medium till en 6-brunn tallrik.
  2. Frö celler i 6-well kultur plattan med en densitet av 0,5 x 106/well.
  3. Inkubera vid 37 ° c med 5% CO2 -koncentration.
  4. Utsäde cellerna på täckglas i 6 väl kultur plattan och utföra immunofärgning med anti-MAP2 antikropp (20% Confluence). Använd 6-brunn plattan för att isolera RNA och utföra RT-PCR för MAP2, Neun, Oct4, nanog, och GAPDH (20% Confluence).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den förenklade systematiken i protokollet för neurogenes induktion i P19 cellinjer presenteras i figur 1. För att definiera teckenet av den P19 cellen fodrar i ett odifferentierat påstå, och under Neurogenesis användes den RT-PCR (omvänd Transkription-Polymerase kedjar reaktion) metoden. Den odifferentierade P19 cellinaden uttryckte pluripotens gener såsom organisk katjon/karnitin transporter4 (Oct4) och nanog Hedgehog (nanog). Neurogenes induceras av celler aggregering i suspension kultur i närvaro av RA ledde till en snabb minskning av Oct4 och nanog uttryck. I motsats, uttryck av neuron markörer: Microtubule-Associated protein 2 (MAP2), Neun (även känd som RNA-bindande protein, Fox-1 homolog 3 (Rbfox3)) ökade efter utlöst neurogenes (figur 2)6 ,14,15,22. De primrar som används för varje gen indikeras tillsammans med nukleotidsequencesand produktens storlek i tabell 1. En mikroskopisk bild av den odifferentierade P19 cellinaden presenterade en rundformad morfologi (figur 3a). Efter induktion av neurogenes var cellernas neuronala struktur tydligt synlig 4 dagar efter plätering (figur 3B). Dessutom representerar figur 4 fluorescensbilden av MAP2 uttryck i den differentierade P19-celllinjen (4 dagar efter bordläggningen celler)14.

Figure 1
Figur 1 : Protokoll schematiskt för induktion av neurogenes i P19 embryonala cancerceller. Neurogenes induceras genom odling av P19-celllinjen i en 100 mm icke-behandlad kultur rätt med 5% av FBS och 0,5 μM RA. Efter 4 dagar, cell aggregaten dissocieras med trypsin och seedade på anhängare av cellodling plattan för följande nästa 4 dagar. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Förändringar av genuttryck i P19 cellinjer. Band grafen föreställer genuttryck för odifferentierad P19 cellfodra (Oct4, nanog) och under neurogenes (MAP2, Neun). Glyceraldehyd-3-fosfatdehydrogenas (GAPDH) användes som referens gen. Proverna lastas i agaros gel (1,5%) i dubbla replikeringar. Förkortningar: Undifferentierad föreställer den odifferentierade P19 cellen fodrar utan RA-behandling; Dag 1-4 representerar efterföljande dagar efter cellplätering-efter 4 dagar efter behandling med RA och cell Aggregations stadiet. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Representativa bilder av analys av P19 cellinjer. (A) ljus mikroskopiska bilder av odifferentierad P19 cellinjer. (B) ljus mikroskopiska bilder av P19 cellinjer efter 4 dagar av neurogenes-efter 4 dagar efter behandling med ra och cell aggregation skede. Scale bar = 100 μm. vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Representativ immunofluorescensbild av differentierad P19 cellinjer. Sammanslagna immunofluorescensbild av P19 cellinjer färgade med anti-MAP2 och DAPI vid 4 dagar efter plätering. Scale bar = 100 μm. vänligen klicka här för att se en större version av denna siffra.

Primer Primer sekvens Produkt
storlek (BP)
GAPDH F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
MAP2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tabell 1: primrar som används för RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här beskriver vi ett enkelt protokoll för neurogenes med hjälp av P19-celllinjen. Även om många rapporter har publicerats i detta avseende, en detaljerad metod för neurogenes induktion med P19 cellinjer är fortfarande oklart. Dessutom utnyttjade vi en enkel hög glukos (4 500 mg/L) DMEM medium med 10% FBS för hela experimentet. Detta tillät oss att utföra det neurogena experimentet på ett användarvänligt sätt och utöka användningen av denna metod för framtiden.

De mest kritiska punkterna inom detta protokoll är RA-koncentrationen samt generering av cell aggregat i suspensions kulturen. Stimulering av neurogenes i P19 cell linjen kan utföras utan bildandet av aggregat, men antalet neuronala celler som produceras kommer att minskas med två tredjedelar i cellkulturen22. Monzo et al. har visat neurogenes induktion i P19 cellinjer genom att kultera dem i enskiktslager15. Även om deras metod är ganska bekvämt eftersom vi kan eliminera suspension kultur process, ytterligare studier krävs för att jämföra deras metod med andra väl beskrivna metoder. RA-koncentrationen på 0,5 μM i mediet producerade ett stort antal cell aggregat samt nervceller efter plätering jämfört med 1 μM RA. Det är också viktigt att notera att vi inte kunde iaktta en effektiv neurogenes när de flesta av aggregaten är knutna till botten av fjädringen kultur skålen under RA behandling. Det optimala numret på P19-celllinjen som ska användas i början av ingreppet är 1 x 106 för varje 10 ml differentierings medium. Under induktion av neurogenes, den P19 cell linjen former varierande storlek aggregat och även enstaka celler finns i kulturen. För att övervinna detta problem, insamlade vi cell aggregaten efter 1,5 min av fritt fall i en 15 mL tub. Vi konstaterade att detta tillvägagångssätt tillåter uteslutning av kontaminering av enstaka celler. Det rekommenderas också att utföra neuronala berikning med cellkulturen med hjälp av anti-mitotiska läkemedel (t. ex., cytosin arabinoside) för långsiktig kultur för att hämma omfattande spridning av gliaceller23.

Nervceller som härrör från P19 cellinjer uttrycka ionotropa glutamatreceptorer av både N-metyl-D-asparat (NMDA) och alfa-amino-3-hydroxy-5-metyl-4-isoxazol Propionate (AMPA)/kainite (ka) typer24,25, samt funktionell γ-aminosmörsyra (GABA) receptorer25. Därför, den P19 cellinjer används ofta i studierna på molekylära mekanismer som reglerar neuronala differentiering26,27,28. Ännu viktigare, tumörutvecklingen observerades inte efter celltransplantation29,30.

För detta ändamål bedrivs forskning om neurodegenerativa sjukdomar som Alzheimers sjukdom17,18 också med hjälp av P19 cellinjer, och vi anser att den metod som utvecklats i denna studie därmed kommer att spela en roll i att belysa den molekylära mekanismer för neuroutvecklingsstörningar och neurodegenerativa sjukdomar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Studien stöddes ekonomiskt av National Science Centre, Polen (Grant No. UMO-2017/25/N/NZ3 nätters/01886) och KNOW (ledande nationellt forskningscentrum) vetenskapligt konsortium "hälsosamma djur säkra livsmedel", beslut av ministeriet för vetenskap och högre utbildning nr. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics