Neurogenese met behulp van P19 embryonale carcinoom cellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

De P19 Mouse embryonale carcinoom cellijn (P19 cellijn) wordt veel gebruikt voor het bestuderen van het moleculaire mechanisme van neurogenese met grote vereenvoudiging in vergelijking met in vivo analyse. Hier presenteren we een protocol voor retinoïnezuur-geïnduceerde neurogenese in de P19 cellijn.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De P19 cellijn afgeleid van een muis embryo-afgeleid teratocarcinoom heeft de mogelijkheid om onderscheid te maken in de drie kiem lagen. In aanwezigheid van retinoïnezuur (RA), de suspensie gekweekte P19 cellijn wordt geïnduceerd om te differentiëren in neuronen. Dit fenomeen wordt uitgebreid onderzocht als een neurogenese-model in vitro. Daarom, de P19 cellijn is zeer nuttig voor moleculaire en cellulaire studies in verband met neurogenese. Echter, protocollen voor Neuronale Differentiatie van P19 cellijn beschreven in de literatuur zijn zeer complex. De methode die in deze studie is ontwikkeld, is eenvoudig en zal een rol spelen in het verhelderend zijn van de moleculaire mechanismen in neuroontwikkelingsafwijkingen en neurodegeneratieve ziekten.

Introduction

Tijdens de embryonale ontwikkeling wordt een enkele cellaag omgezet in drie afzonderlijke kiem lagen1,2,3. Om de onderzoeksinspanningen van verschijnselen die zich in vivo voordoen te vergroten, is het genereren van driedimensionale aggregaten (embryonale lichamen) ontwikkeld als een handig model. Cellulaire aggregaten die op deze manier worden gevormd, kunnen worden blootgesteld aan verschillende aandoeningen die celdifferentiatie veroorzaken, die de ontwikkeling van het embryo4,5weerspiegelen. De P19 Murine embryonale carcinoom cellijn (P19 cellijn) wordt vaak gebruikt als een cellulaire model voor neurogenese studies in vitro6,7,8. De P19 cellijn vertoont typische pluripotente stamcel functies en kan zich onderscheiden in neuronen in de aanwezigheid van retinoïnezuur (RA) tijdens celaggregatie gevolgd door neuriet uitgroei onder aanhangers van voorwaarden. Bovendien is de ongedifferentieerde P19 cellijn ook in staat om spier-en cardiomyocyt-achtige cellen te vormen onder invloed van dimethylsulfoxide (DMSO)9,10,11,12.

Veel methoden13,14,15,16 zijn gemeld voor neuronale differentiatie, maar de methodologie is soms ingewikkeld en niet gemakkelijk te begrijpen door alleen het lezen van de beschrijvingen. Bijvoorbeeld, protocollen vereisen soms een combinatie van Dulbecco's gemodificeerde Eagle medium (DMEM) medium aangevuld met een mengsel van kalf serum (CS) en foetaal runderserum (FBS)13. Bovendien, media die worden gebruikt voor neuronale ontwikkeling zijn vaak samengesteld uit neurobasal en B27 supplementen13,14,15,16. Als zodanig, bestaande methoden bevatten complexiteit in hun voorbereiding en ons doel hier is om de protocollen te vereenvoudigen. In deze studie, we hebben aangetoond dat DMEM met FBS kan worden gebruikt voor het handhaven van de P19 cellijn (DMEM + 10% FBS) evenals voor neuronale ontwikkeling (DMEM + 5% FBS + RA). Deze vereenvoudigde methode voor neurogenese met behulp van de P19 cellijn stelt ons in staat om het moleculaire mechanisme van hoe neuronen worden ontwikkeld bestuderen. Bovendien, onderzoek naar neurodegeneratieve ziekten zoals de ziekte van Alzheimer wordt ook uitgevoerd met behulp van P19 cellijn17,18, en wij geloven dat de in deze studie ontwikkelde methode een rol zal spelen in het verhelderend moleculaire mechanismen in neuroontwikkelingsafwijkingen en neurodegeneratieve ziekten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. cultuur onderhoud

  1. Cultuur de P19 cellijn in onderhouds medium (Dulbecco's gemodificeerde Eagle's medium met 4.500 mg/L glucose aangevuld met 10% FBS, 100 eenheden/mL penicilline en 100 eenheden/mL streptomycine). Incuberen bij 37 °C en 5% CO2.

2. subculturing cellen

  1. Wanneer cellen ongeveer 80% samenloop bereiken, verwijdert u het verbruikte medium uit de celkweek kolven (oppervlakte 25 cm2).
  2. Was de cellen met 2 mL fosfaatgebufferde zoutoplossing (PBS) vrij van calcium en magnesium.
  3. Voeg 1 mL 0,25% trypsine-EDTA (ethyleendiaminetetraazijnzuur) toe op de celmonolaag.
  4. Plaats de kolf in de CO2 -incubator (37 °c en 5% Co2) gedurende 2-3 min.
  5. Evalueer de celbevestiging op het oppervlak van de kolf. Zorg ervoor dat alle cellen zijn losgemaakt en zwevend in het medium.
  6. Voeg 9 mL onderhouds medium toe om de enzymatische activiteit van trypsine te stoppen.
  7. Respendeer de cellen in het onderhouds medium.
  8. Breng cellen over naar een buis van 15 mL en Centrifugeer gedurende 5 minuten bij 200 x g en kamertemperatuur (RT).
  9. Gooi het supernatant weg en voeg 10 mL vers onderhouds medium toe aan de buis van 15 mL.
  10. Gebruik de celsuspensie om het celnummer te bepalen met behulp van een celteller volgens de instructies van de fabrikant.
  11. Zaadcellen bij 2 x 104 cellen/cm2 in een nieuwe kolf van 25 cm2 .
  12. Voeg het onderhouds medium toe tot 10 mL.
  13. Plaats de kolf met cellen in de CO2 -incubator (37 °c en 5% Co2) gedurende 2-3 dagen.

3. trypsine-spijsvertering

  1. Aspirate onderhoudsmiddel uit de celkolf. Was de cellen één keer met 2 mL calcium-en magnesium vrije PBS.
  2. Voeg 1 mL 0,25% trypsine-EDTA toe.
  3. Plaats de kolf met cellen in de CO2 -incubator bij 37 °c gedurende 2-3 min.
  4. Gebruik een pipet van 1 mL om de cellen tien keer te ontkoppelen door Pipetteer cellen.
  5. Neutraliseer trypsine door 9 mL differentiatie medium toe te voegen (Dulbecco's gemodificeerde Eagle's medium met 4500 mg/L glucose aangevuld met 5% FBS, 100 eenheden/mL peniciline en 100 eenheden/mL streptomycine) zonder RA aan de cellen.
  6. Breng cellen over naar een buis van 15 mL en Centrifugeer gedurende 5 minuten bij 200 x g en RT.
  7. Gooi het supernatant weg en voeg 1 mL differentiatie medium toe zonder retinoïnezuur (RA). Respendeer de celpellet.
  8. Gebruik de celsuspensie om het celnummer te bepalen met behulp van een celteller volgens de instructies van de fabrikant.

4. aggregaat genereren

  1. Voeg 5 μL RA (1 mM Stock opgelost in 99,8% ethanol, opgeslagen bij-20 °C) toe aan de 10 mL differentiatie medium en meng goed (eindconcentratie van 0,5 μM RA).
    Opmerking: RA is lichtgevoelig. Lage concentratie van EtOH heeft geen invloed op de celdifferentiatie19,20,21.
  2. Voeg 10 mL differentiatie medium (met RA) toe aan de 100 mm niet-behandelde kweek schaal (gewijd aan de suspensie cultuur).
  3. Zaai de 1 x 106 cellen in de 100 mm schaal (schaal oppervlakte 56,5 cm2).
  4. Plaats de kolf met cellen in de incubator bij 37 °C en 5% CO2 gedurende 2 dagen om de vorming van aggregaten te bevorderen.
  5. Ruil na 2 dagen het differentiatie medium in. Aspirate medium bevattende aggregaten met behulp van een 10 mL pipet en overbrengen naar een 15 mL buis op RT.
  6. Laat de aggregaten om te vestigen door de zwaartekracht voor 1,5 min bij RT.
  7. Gooi het supernatant weg.
  8. Voeg met een serologische Pipet van 10 mL een vers 10 ml differentiatie medium toe met 0,5 μM RA.
    Let op: Pipetteer de celaggregaten niet op en neer.
  9. Zaai de aggregaten in nieuwe 100 mm niet-behandelde cultuur schotel (gewijd aan de suspensie cultuur).
  10. Plaats de plaat in de incubator (bij 37 °C en 5% CO2) gedurende 2 dagen.

5. aggregeert dissociatie

  1. Aspireren de celaggregaten met behulp van een 10 mL pipet.
  2. Breng de aggregaten over in een buis van 15 mL. Laat de celaggregaten om te vestigen door zwaartekracht voor 1,5 min.
  3. Verwijder het supernatant.
  4. Was de aggregaten met alleen DMEM (serum-en antibioticum vrij).
  5. Laat de celaggregaten zich vestigen door zwaartekracht sedimentatie voor 1,5 min bij RT.
  6. Aspireren de supernatant en voeg 2 mL trypsine-EDTA (0,25%).
  7. Plaats de celgranulaten in een waterbad (37 °C) gedurende 10 min. agitate de aggregaten zachtjes elke 2 min door te tikken met een hand.
  8. Stop het trypsinisatie proces door 4 mL onderhouds medium toe te voegen.
  9. Pipetteer aggregaten 20 keer op en neer met een pipet van 1 mL.
  10. Centrifugeer cellen gedurende 5 minuten bij 200 x g en RT.
  11. Verwijder de supernatant en rebreng de celpellet in 5 mL onderhouds medium.
  12. Bepaal het celnummer met een celteller.

6. plating cellen

  1. Voeg 3 mL per goed onderhoudsmiddel toe aan een 6-put plaat.
  2. Zaadcellen in de 6-Wells cultuur plaat met een dichtheid van 0,5 x 106/well.
  3. Inincuberen bij 37 °C met 5% CO2 concentratie.
  4. Zaai de cellen op afdekglas in 6 goed cultuur plaat en voer immunokleuring uit met anti-MAP2 antilichaam (20% samenvloeiing). Gebruik 6-well plaat om RNA te isoleren en de RT-PCR uit te voeren voor map2, neun, Oct4, nanogen gapdh (20% samenvloeiing).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Het vereenvoudigde schema van het protocol voor neurogenese inductie in P19 cellijn wordt weergegeven in Figuur 1. Om het karakter van de P19 cellijn in een ongedifferentieerde toestand en tijdens neurogenese te definiëren, werd de methode RT-PCR (reverse transcriptie-polymerase chain reaction) gebruikt. De ongedifferentieerde P19 cellijn uitgedrukt de pluripotentie genen zoals organische cation/carnitine transporter4 (Oct4) en nanog Homeobox (nanog). Neurogenese geïnduceerd door cellen aggregatie in suspensie cultuur in aanwezigheid van RA leidde tot een snelle afname van Oct4 en nanog expressie. Integendeel, uitdrukking van neuron markers: microtubulus-geassocieerde proteïne 2 (map2), neun (ook bekend als RNA binding Protein, Fox-1 homo 3 (Rbfox3)) verhoogd na geactiveerde neurogenese (Figuur 2)6 ,14,15,22. De primers die voor elk gen worden gebruikt, worden samen met nucleotide sequencesen de grootte van het product in tabel 1 aangegeven. Een microscopisch beeld van de ongedifferentieerde P19 cellijn presenteerde een ronde vormige morfologie (Figuur 3a). Na inductie van neurogenese was de neuronale structuur van de cellen duidelijk zichtbaar 4 dagen na het beplating (Figuur 3B). Daarnaast staat Figuur 4 voor het fluorescentie beeld van Map2 expressie in de gedifferentieerde P19 cellijn (4 dagen na het plateren van cellen)14.

Figure 1
Figuur 1 : Protocol schematische voor inductie van neurogenese in P19 embryonale carcinoom cellen. Neurogenese wordt geïnduceerd door het kweken van de P19 cellijn in een 100 mm niet-behandelde kweek schotel met 5% van de FBS en 0,5 μM RA. Na 4 dagen worden de celaggregaten losgekoppeld van trypsine en op een hecht celkweek plaat voor volgende 4 dagen. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 : Veranderingen van genexpressie in P19 cellijn. De band grafiek vertegenwoordigt genexpressie voor ongedifferentieerde P19 cellijn (Oct4, nanog) en tijdens neurogenese (map2, neun). Glyceraldehyde-3-fosfaat dehydrogenase (Gapdh) werd gebruikt als het referentie-gen. Monsters worden geladen in de agarose gel (1,5%) in dubbele replicaties. Afkortingen: ongedifferentieerde representeert de ongedifferentieerde P19 cellijn zonder RA behandeling; Dag 1-4 vertegenwoordigt volgende dagen na celplating-na 4 dagen na behandeling met RA en cel aggregatie fase. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Representatieve afbeeldingen van de analyse van P19 cellijn. A) lichte microscopische beelden van ongedifferentieerde P19 cellijn. (B) lichte microscopische beelden van P19 cellijn na 4 dagen van neurogenese-na 4 dagen na behandeling met Ra en cel aggregatie fase. Schaalbalk = 100 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 : Representatieve immunofluorescentie beeld van gedifferentieerde P19 cellijn. Samengevoegd immunofluorescentie beeld van P19 cellijn gekleurd met anti-MAP2 en DAPI op 4 dagen na het beplating. Schaalbalk = 100 μm. Klik hier om een grotere versie van dit cijfer te bekijken.

Primer Primer sequentie Product
grootte (BP)
Gapdh F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
Map2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
NeuN F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tabel 1: primers gebruikt voor RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier beschrijven we een eenvoudig protocol voor neurogenese met behulp van de P19 cellijn. Hoewel veel rapporten zijn gepubliceerd in dit verband, een gedetailleerde methodologie voor neurogenese inductie met behulp van P19 cellijn blijft onduidelijk. Bovendien gebruikten we een eenvoudige hoge glucose (4.500 mg/L) DMEM medium met 10% FBS voor het hele experiment. Dit liet ons toe om het neurogene experiment op een gebruiksvriendelijke manier uit te voeren en het gebruik van deze methode voor de toekomst uit te breiden.

De meest kritische punten binnen dit protocol zijn de RA-concentratie en de generatie van celaggregaten in de suspensie cultuur. Het stimuleren van neurogenese in de P19 cellijn kan worden uitgevoerd zonder de vorming van aggregaten, maar het aantal neuronale cellen geproduceerd zal worden verminderd door tweederde in de celcultuur22. Monzo et al. hebben aangetoond neurogenese inductie in P19 cellijn door het kweek hen in monolaag15. Hoewel hun methode is heel handig als we het proces van de schorsing cultuur kunnen elimineren, verdere studies zijn nodig om hun methode te vergelijken met andere goed beschreven methoden. De RA-concentratie van 0,5 μM in het medium produceerde een groot aantal celaggregaten en neuronen na het beplating in vergelijking met 1 μM RA. Het is ook belangrijk op te merken dat we niet konden observeren een efficiënte neurogenese wanneer de meeste van de aggregaten zijn bevestigd aan de onderkant van de suspensie cultuur gerecht tijdens RA behandeling. Het optimale aantal van de P19 cellijn dat aan het begin van de procedure moet worden gebruikt, is 1 x 106 voor elke 10 ml van het differentiatie medium. Tijdens de inductie van neurogenese, de P19 cellijn vormt variërende aggregaten en zelfs enkele cellen zijn te vinden in de cultuur. Om dit probleem te overwinnen, we verzameld de celaggregaten na 1,5 min van vrije val in een 15 mL buis. We constateerden dat deze aanpak de uitsluiting van verontreiniging van afzonderlijke cellen mogelijk maakt. Het wordt ook aanbevolen om neuronale verrijking uit te voeren met de celcultuur met behulp van anti-mitotische geneesmiddelen (bijv. Cytosine arabinoside) voor lange termijn cultuur voor de remming van de uitgebreide proliferatie van gliacellen23.

Neuronen afgeleid van de P19 Cell line Express ionotropic glutamaat receptoren van zowel N-methyl-D-aspartaat (NMDA) en alpha-Amino-3-hydroxy-5-methyl-4-isoxazol propionaat (AMPA)/kainite (ka) types24,25, evenals functionele γ-aminoboterzuur (GABA) receptoren25. Daarom wordt de P19 cellijn veel gebruikt in de studies over moleculaire mechanismen voor Neuronale Differentiatie26,27,28. Belangrijker nog, de ontwikkeling van de tumor werd niet waargenomen na de transplantatie van de cel29,30.

Om dit te doen, onderzoek naar neurodegeneratieve ziekten zoals de ziekte van Alzheimer17,18 wordt ook uitgevoerd met behulp van P19 cellijn, en wij geloven dat de methode ontwikkeld in deze studie zal dus een rol spelen in het verhelderende de moleculaire mechanismen in neuroontwikkelingsafwijkingen en neurodegeneratieve ziekten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De studie werd financieel gesteund door het National Science Centre, Polen (Grant No. UMO-2017/25/N/NZ3/01886) en KNOW (leidend nationaal onderzoekscentrum) wetenschappelijk consortium "gezonde dieren veilig voedsel", besluit van het ministerie van Wetenschappen en hoger onderwijs No. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics