Neurogenesis bruke P19 embryo kreftceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Den P19 musen embryonale kreftcelle linje (P19 cellelinje) er mye brukt for å studere den molekylære mekanismen av neurogenesis med stor forenkling i forhold til in vivo analyse. Her presenterer vi en protokoll for retinoic acid-indusert neurogenesis i P19 cellelinjen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den P19 cellelinje avledet fra en mus embryo-avledet teratocarcinoma har evnen til å differensiere til tre bakterie lag. I nærvær av retinoic syre (RA), suspensjonen kultivert P19 cellelinjen er indusert å differensiere til neurons. Dette fenomenet undersøkes i stor utstrekning som en neurogenesis modell in vitro. Derfor er P19 cellelinjen svært nyttig for molekylær og cellulær studier knyttet til neurogenesis. Men protokoller for neuronal differensiering av P19 cellelinje beskrevet i litteraturen er svært komplekse. Metoden utviklet i denne studien er enkel og vil spille en rolle i Elucidating av molekylære mekanismer i neurodevelopmental unormalt og nevrodegenerative sykdommer.

Introduction

Under embryoutvikling omdannes et enkelt celle lag til tre separate bakterie lag1,2,3. For å øke forsknings mulighetene for fenomener som forekommer i Vivo, har generering av tredimensjonale aggregater (embryonale organer) blitt utviklet som en praktisk modell. Cellulære aggregater dannet på denne måten kan utsettes for ulike forhold forårsaker celle differensiering, som reflekterer utviklingen av embryo4,5. P19 murine embryonale kreftcelle linje (P19 cellelinje) brukes vanligvis som en cellulær modell for neurogenesis studier in vitro6,7,8. Den P19 cellelinjen utstillinger typiske pluripotent stilk cellen funksjoner og kan differensiere til neurons i nærvær av retinoic syre (RA) under celle aggregering etterfulgt av neurite utvekst under tilhenger forhold. Videre er udifferensierte P19 cellelinje også i stand til å forme muskel-og cardiomyocyte-lignende celler under påvirkning av dimethyl sulfoxide (DMSO)9,10,11,12.

Mange metoder13,14,15,16 har blitt rapportert for neuronal differensiering, men metodikken er noen ganger komplisert og ikke lett å forstå ved bare å lese beskrivelsene. For eksempel, protokoller noen ganger krever en kombinasjon av Dulbecco ' s modifisert Eagle medium (DMEM) medium supplert med en blanding av kalv serum (CS) og fosterets storfe serum (FBS)13. Videre medier brukes for neuronal utvikling er ofte sammensatt av Neurobasal og B27 kosttilskudd13,14,15,16. Som sådan, eksisterende metoder inneholder kompleksitet i forberedelsene og vårt mål her er å forenkle protokollene. I denne studien, viste vi at DMEM med FBS kan utnyttes for å opprettholde P19 cellelinjen (DMEM + 10% FBS) samt for neuronal utvikling (DMEM + 5% FBS + RA). Denne forenklede metoden for neurogenesis ved hjelp av P19 cellelinje tillater oss å studere den molekylære mekanismen av hvordan neurons utvikles. Videre er forskning på nevrodegenerative sykdommer som Alzheimers sykdom også gjennomført ved hjelp P19 cellelinje17,18, og vi tror at metoden utviklet i denne studien vil spille en rolle i Elucidating molekylære mekanismer i neurodevelopmental unormalt og nevrodegenerative sykdommer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. kultur vedlikehold

  1. Kultur P19 cellelinjen i vedlikehold medium (Dulbecco ' s modifiserte Eagle ' s medium med 4 500 mg/L av glukose supplert med 10% FBS, 100 enheter/mL penicillin og 100 enheter/mL Streptomycin). Ruge ved 37 ° c og 5% CO2.

2. dyrking celler

  1. Når cellene nå ca 80% samløpet, fjerne brukt medium fra cellen kulturen kanner (areal 25 cm2).
  2. Vask cellene med 2 mL fosfat bufret saltvann (PBS) uten kalsium og magnesium.
  3. Tilsett 1 mL 0,25% Trypsin-EDTA (ethylenediaminetetraacetic syre) på cellen monolag.
  4. Sett flasken i CO2 inkubator (37 ° c og 5% co2) for 2-3 min.
  5. Vurdere celle vedlegget til kolbe overflaten. Sørg for at alle cellene er løsrevet og flytende i mediet.
  6. Tilsett 9 mL vedlikeholds medium for å stanse enzymatisk aktivitet av Trypsin.
  7. Resuspend cellene i vedlikehold medium.
  8. Overfør celler til et 15 mL rør og sentrifuger for 5 min ved 200 x g og romtemperatur (RT).
  9. Kast supernatanten og tilsett 10 mL friskt vedlikeholds medium inn i 15 mL røret.
  10. Bruk celle fjæringen til å bestemme celle nummeret ved hjelp av en celle teller i henhold til produsentens instruksjoner.
  11. Seed celler ved 2 x 104 celler/cm2 i en ny 25 cm2 kolbe.
  12. Tilsett vedlikeholds mediet opptil 10 mL.
  13. Sett flasken med celler i CO2 inkubator (37 ° c og 5% co2) for 2-3 dager.

3. Trypsin fordøyelsen

  1. Aspirer Maintenance medium fra celle flasken. Vask cellene én gang med 2 mL kalsium og magnesium fri PBS.
  2. Tilsett 1 mL 0,25% Trypsin-EDTA.
  3. Sett flasken med celler i CO2 inkubator ved 37 ° c for 2-3 min.
  4. Bruk 1 mL pipette for å distansere cellene ved pipettering celler ti ganger.
  5. Nøytralisere Trypsin ved å legge til 9 mL differensiering medium (Dulbecco ' s modifisert Eagle ' s medium med 4500 mg/L av glukose supplert med 5% FBS, 100 enheter/mL penicillin og 100 enheter/mL Streptomycin) uten RA til cellene.
  6. Overfør celler til et 15 mL rør og sentrifuger for 5 min ved 200 x g og RT.
  7. Kast supernatanten og tilsett 1 mL differensiering medium uten retinoic syre (RA). Resuspend cellen pellet.
  8. Bruk celle fjæringen til å bestemme celle nummeret ved hjelp av en celle teller i henhold til produsentens instruksjoner.

4. samlet generasjon

  1. Tilsett 5 μL av RA (1 mM lager oppløst i 99,8% etanol, lagret ved-20 ° c) til 10 mL differensiering medium og bland godt (siste konsentrasjon på 0,5 μM RA).
    Merk: RA er lysfølsom. Lav konsentrasjon av EtOH påvirker ikke celle differensiering19,20,21.
  2. Tilsett 10 mL differensiering medium (med RA) til 100 mm ikke-behandlet kultur rett (dedikert til suspensjon kultur).
  3. Seed 1 x 106 celler i 100 mm parabolen (parabolen areal 56,5 cm2).
  4. Sett flasken med celler inn i inkubator ved 37 ° c og 5% CO2 for 2 dager for å fremme aggregater formasjon.
  5. Etter 2 dager, utveksle differensiering medium. Aspirer medium som inneholder aggregater med en 10 mL pipette og overføres til et 15 mL rør ved RT.
  6. La aggregater bosette seg ved tyngdekraften for 1,5 min ved RT.
  7. Kast supernatanten.
  8. Tilsett en frisk 10 mL differensiering medium med 0,5 μM RA ved hjelp av en 10 mL serologisk pipette.
    Forsiktig: Ikke Pipetter celle aggregater opp og ned.
  9. Seed aggregater i nye 100 mm ikke-behandlet kultur rett (dedikert til suspensjon kultur).
  10. Plasser platen i inkubator (ved 37 ° c og 5% CO2) i 2 dager.

5. aggregater dissosiasjon

  1. Aspirer cellen aggregater med en 10 mL pipette.
  2. Overfør aggregater til et 15 mL rør. Tillat celle aggregater å bosette ved tyngdekraften for 1,5 min.
  3. Fjern supernatanten.
  4. Vask aggregater med DMEM alene (serum-og antibiotika fritt).
  5. Tillat celle aggregater å bosette ved tyngdekraften sedimentering for 1,5 min ved RT.
  6. Aspirer supernatanten og tilsett 2 mL Trypsin-EDTA (0,25%).
  7. Plasser celle aggregater i et vannbad (37 ° c) i 10 min. agitere aggregater forsiktig hver 2 min ved å trykke med en hånd.
  8. Stopp trypsinization prosessen ved å legge til 4 mL vedlikeholds medium.
  9. Pipette samler opp og ned 20 ganger med 1 mL pipette.
  10. Sentrifuger celler i 5 min ved 200 x g og RT.
  11. Fjern supernatanten og resuspend celle pellet i 5 mL vedlikeholds medium.
  12. Bestem celle tallet med en celle teller.

6. plating celler

  1. Tilsett 3 mL per brønn av vedlikeholds medium til en 6-brønn plate.
  2. Seed celler i 6-brønn kultur plate med en tetthet på 0,5 x 106/well.
  3. Ruge ved 37 ° c med 5% CO2 -konsentrasjon.
  4. Seed cellene på coveret glass i 6 brønn kultur plate og utføre immunostaining med anti-MAP2 antistoff (20% samløpet). Bruk 6-brønn plate for å isolere RNA og utføre RT-PCR for Map2, NeuN, Oct4, Nanogog Gapdh (20% samløpet).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Den forenklede ordningen med protokollen for neurogenesis induksjon i P19 cellelinjen er presentert i figur 1. For å definere tegnet av P19 cellelinjen i en udifferensierte tilstand og under neurogenesis, RT-PCR (omvendt transkripsjon-polymerase kjedere reaksjon) metoden ble brukt. Den udifferensierte P19 cellelinje uttrykte pluripotency gener som organisk/carnitine transporter4 (Oct4) og Nanog Homeobox (Nanog). Neurogenesis indusert av celler aggregering i suspensjon kultur i nærvær av RA førte til en rask reduksjon av Oct4 og Nanog uttrykk. I motsetning, uttrykk for Nevron markører: mikrotubulinettverket-Associated protein 2 (Map2), NeuN (også kjent som RNA bindende protein, Fox-1 homologe 3 (Rbfox3)) økte etter utløst neurogenesis (figur 2)6 ,14,15,22. Den primere som brukes for hvert gen er angitt sammen med nukleotid sequencesand størrelsen på produktet i tabell 1. Et mikroskopisk bilde av den udifferensierte P19 cellelinje presenterte en rund-formet morfologi (Figur 3a). Etter induksjon av neurogenesis, den neuronal strukturen av cellene var godt synlig 4 dager etter plating (Figur 3B). I tillegg representerer Figur 4 det fluorescens bildet av MAP2 uttrykk i differensiert P19 cellelinje (4 dager etter plating celler)14.

Figure 1
Figur 1 : Protokoll skjematisk for induksjon av neurogenesis i P19 embryo kreftceller. Neurogenesis er indusert av dyrking P19 cellelinje i en 100 mm ikke-behandlet kultur parabol med 5% av FBS og 0,5 μM RA. Etter 4 dager, cellen aggregat er dissosiert med Trypsin og seeded opp på tilhenger cellen kulturen tallerken for fulgte neste 4 dager. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Endringer i genuttrykk i P19 cellelinje. Bandet grafen representerer genuttrykk for udifferensierte P19 cellelinje (Oct4, Nanog) og under neurogenesis (Map2, NeuN). Glyceraldehyde-3-fosfat dehydrogenase (Gapdh) ble brukt som referanse gen. Prøvene er lastet i agarose gel (1,5%) i dobbel replikeringer. Forkortelser: udifferensierte representerer udifferensierte P19 cellelinje uten RA-behandling; Dag 1-4 representerer påfølgende dager etter celle plating-følgende 4 dager etter RA-behandling og celle aggregering scenen. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Representative bilder av analyse av P19 cellelinje. (A) lys mikroskopiske bilder av udifferensierte P19 cellelinje. (B) lette mikroskopiske bilder av P19 cellelinje etter 4 dagers neurogenesis – etter 4 dager etter ra-behandling og trinn i celle aggregering. Scale bar = 100 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Representative immunofluorescence bilde av differensiert P19 cellelinje. Fusjonerte immunofluorescence bilde av P19 cellelinje beiset med anti-MAP2 og DAPI på 4 dager etter plating. Scale bar = 100 μm. Vennligst klikk her for å se en større versjon av dette tallet.

Primer Primer sekvens Produktet
størrelse (BP)
Gapdh F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
Map2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
NeuN F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tabell 1: primere brukt for RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Her beskriver vi en enkel protokoll for neurogenesis ved hjelp av P19 cellelinje. Selv om mange rapporter har blitt publisert i denne forbindelse, er en detaljert metodikk for neurogenesis induksjon bruker P19 cellelinje uklart. Videre benyttet vi en enkel høy glukose (4 500 mg/L) DMEM medium med 10% FBS for hele eksperimentet. Dette tillot oss å utføre neurogenic eksperimentet på en brukervennlig måte og utvide bruken av denne metoden for fremtiden.

De mest kritiske punktene i denne protokollen er RA-konsentrasjonen, så vel som generering av celle aggregater i fjærings kulturen. Stimulering av neurogenesis i P19 cellelinje kan utføres uten dannelsen av aggregater, men antall neuronal celler produsert vil bli redusert med to tre deler i celle kulturen22. Monzo et al. har vist neurogenesis induksjon i P19 cellelinje ved dyrking dem i monolag15. Selv om deres metode er ganske praktisk som vi kan eliminere suspensjon kultur prosessen, er videre studier som kreves for å sammenligne deres metode med andre godt beskrevet metoder. RA-konsentrasjonen av 0,5 μM i mediet produserte et høyt antall celle aggregater samt neurons etter plating sammenlignet med 1 μM av RA. Det er også viktig å merke seg at vi ikke kunne observere en effektiv neurogenesis når de fleste av aggregater er festet til bunnen av suspensjonen kultur parabolen under RA behandling. Det optimale tallet på P19 cellelinjen som skal brukes i begynnelsen av prosedyren er 1 x 106 for hver 10 ml differensiering medium. Under induksjon av neurogenesis, P19 cellelinje former varierende størrelse aggregater og selv enkeltceller er funnet i kulturen. For å løse dette problemet, samlet vi inn celle aggregater etter 1,5 min av fritt fall i en 15 mL tube. Vi fant ut at denne tilnærmingen tillater utelukkelse av forurensning av enkeltceller. Det anbefales også å utføre neuronal berikelse med celle kulturen ved hjelp av anti-mitotisk legemidler (f. eks, cytosin arabinoside) for langsiktig kultur for å hemme omfattende spredning av gliacellene celler23.

Neurons avledet fra P19 Cell line Express ionotrope glutamat reseptorer av både N-metyl-D-aspartate (NMDA) og Alpha-amino-3-AHA-5-metyl-4-isoxazole propionate (AMPA)/kainite (ka) typer24,25, samt funksjonell γ-aminobutyric acid (GABA) reseptorer25. Derfor er P19 cellelinjen mye brukt i studiene på molekylære mekanismer som regulerer neuronal differensiering26,27,28. Enda viktigere, tumor utvikling ble ikke observert etter celle transplantasjon29,30.

For dette formål, forskning på nevrodegenerative sykdommer som Alzheimers sykdom17,18 er også gjennomført ved hjelp P19 cellelinje, og vi tror at metoden utviklet i denne studien vil dermed spille en rolle i elucidating den molekylære mekanismer i neurodevelopmental unormalt og nevrodegenerative sykdommer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Studien ble økonomisk støttet av National Science Centre, Polen (Grant no. UMO-2017/25/N/NZ3/01886) og KNOW (ledende nasjonalt forskningssenter) vitenskapelig konsortium "sunn dyr-trygg mat", vedtak av departementet for vitenskap og høyere utdanning no. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics