Neurogenèse à l'aide de cellules de carcinome embryonnaire P19

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

La lignée cellulaire embryonnaire de carcinome de souris P19 (ligne cellulaire P19) est largement utilisée pour étudier le mécanisme moléculaire de la neurogenèse avec une grande simplification par rapport à l'analyse in vivo. Ici, nous présentons un protocole pour la neurogenèse acide-induite rétinoïque dans la ligne de cellules de P19.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La lignée cellulaire P19 dérivée d'un tératocarcinome dérivé de l'embryon de souris a la capacité de se différencier en trois couches germinales. En présence d'acide rétinoïque (RA), la lignée cellulaire P19 cultivée en suspension est induite pour se différencier en neurones. Ce phénomène est largement étudié comme un modèle de neurogenèse in vitro. Par conséquent, la lignée cellulaire P19 est très utile pour les études moléculaires et cellulaires associées à la neurogenèse. Cependant, les protocoles pour la différenciation neuronale de la lignée cellulaire P19 décrite dans la littérature sont très complexes. La méthode développée dans cette étude est simple et jouera un rôle dans l'élucidation des mécanismes moléculaires dans les anomalies neurodéveloppementales et les maladies neurodégénératives.

Introduction

Pendant le développement embryonnaire, une seule couche cellulaire est transformée en trois couches germinales distinctes1,2,3. Pour augmenter les possibilités de recherche des phénomènes se produisant in vivo, la génération d'agrégats tridimensionnels (corps embryonnaires) a été développée comme modèle pratique. Les agrégats cellulaires formés de cette façon peuvent être exposés à diverses conditions causant la différenciation cellulaire, qui reflètent le développement de l'embryon4,5. La lignée cellulaire embryonnaire de carcinome murine P19 (lignée cellulaire P19) est couramment utilisée comme modèle cellulaire pour les études de neurogenèse in vitro6,7,8. La lignée cellulaire P19 présente des caractéristiques typiques des cellules souches pluripotentes et peut se différencier en neurones en présence d'acide rétinoïque (RA) lors de l'agrégation cellulaire suivie d'une excroissance neurite dans des conditions adhérentes. En outre, la lignée cellulaire Indifférenciée P19 est également capable de former des cellules musculaires et cardiomyocytes sous l'influence du sulfoxyde de diméthyle (DMSO)9,10,11,12.

Beaucoup de méthodes13,14,15,16 ont été signalées pour la différenciation neuronale, mais la méthodologie est parfois compliquée et pas facile à saisir en lisant seulement les descriptions. Par exemple, les protocoles exigent parfois une combinaison du milieu moyen d'aigle modifié (DMEM) de Dulbecco complété par un mélange de sérum de veau (CS) et de sérum bovin foetal (FBS)13. En outre, les médias utilisés pour le développement neuronal sont souvent composés de neurobasal et B27 suppléments13,14,15,16. En tant que tel, les méthodes existantes contiennent de la complexité dans leur préparation et notre objectif ici est de simplifier les protocoles. Dans cette étude, nous avons démontré que dMEM avec FBS peut être utilisé pour maintenir la lignée cellulaire P19 (DMEM - 10% FBS) ainsi que pour le développement neuronal (DMEM - 5% FBS - RA). Cette méthode simplifiée pour la neurogenèse utilisant la lignée cellulaire P19 nous permet d'étudier le mécanisme moléculaire de la façon dont les neurones sont développés. En outre, la recherche sur les maladies neurodégénératives telles que la maladie d'Alzheimer est également menée en utilisant la lignée cellulaire P1917,18, et nous croyons que la méthode développée dans cette étude jouera un rôle dans l'élucidation de la mécanismes moléculaires dans les anomalies neurodéveloppementales et les maladies neurodégénératives.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Entretien de la culture

  1. Culture de la lignée cellulaire P19 dans le milieu d'entretien (le milieu modifié d'aigle de Dulbecco avec 4 500 mg/L de glucose complété par 10 % de FBS, 100 unités/mL de pénicilline et 100 unités/mL de streptomycine). Incuber à 37 oCet 5 % de CO 2.

2. Cellules de sous-culture

  1. Lorsque les cellules atteignent environ 80 % de confluence, retirez le milieu usé des flacons de culture cellulaire (surface de 25 cm2).
  2. Laver les cellules avec 2 ml de phosphate tamponné salin (PBS) exempt de calcium et de magnésium.
  3. Ajouter 1 ml de trypsine-EDTA (acide éthylènediaminetetraacetic) sur la monocouche cellulaire.
  4. Mettre le flacon dans l'incubateur co2 (37 oC et 5 % de CO2) pendant 2 à 3 min.
  5. Évaluer l'attachement de la cellule à la surface du flacon. Assurez-vous que toutes les cellules sont détachées et flottantes dans le milieu.
  6. Ajouter 9 ml de support d'entretien pour arrêter l'activité enzymatique de la trypsine.
  7. Resuspendre les cellules dans le milieu d'entretien.
  8. Transférer les cellules dans un tube et une centrifugeuse de 15 ml pendant 5 min à 200 x g et à température ambiante (RT).
  9. Jeter le supernatant et ajouter 10 ml de milieu d'entretien frais dans le tube de 15 ml.
  10. Utilisez la suspension cellulaire pour déterminer le numéro de cellule à l'aide d'un compteur cellulaire selon les instructions du fabricant.
  11. Cellules de semence à 2 x 104 cellules/cm2 dans un nouveau flacon de 25 cm2.
  12. Ajouter le milieu d'entretien jusqu'à 10 ml.
  13. Mettre le flacon avec des cellules dans l'incubateur de CO2 (37 oC et 5 % de CO2)pendant 2 à 3 jours.

3. Digestion de trypsine

  1. Aspirer Le milieu d'entretien du flacon cellulaire. Laver les cellules une fois avec 2 ml de calcium et de PBS sans magnésium.
  2. Ajouter 1 ml de 0,25 % trypsine-EDTA.
  3. Mettre le flacon avec les cellules dans l'incubateur de CO2 à 37 oC pendant 2-3 min.
  4. Utilisez une pipette de 1 ml pour dissocier les cellules en tapotaleurs dix fois.
  5. Neutraliser la trypsine en ajoutant 9 mL de moyen de différenciation (le milieu modifié de l'aigle de Dulbecco avec 4500 mg/L de glucose complété avec 5% de FBS, 100 unités/mL de pénicilline et 100 unités/mL de streptomycine) sans POLY aux cellules.
  6. Transférer les cellules dans un tube de 15 ml et une centrifugeuse pendant 5 min à 200 x g et RT.
  7. Jeter le supernatant et ajouter 1 ml de différenciation moyenne sans acide rétinoïque (RA). Resuspendre la pastille cellulaire.
  8. Utilisez la suspension cellulaire pour déterminer le numéro de cellule à l'aide d'un compteur cellulaire selon les instructions du fabricant.

4. Génération agrégée

  1. Ajouter 5 ll de RA (1 mM de bouillon dissous dans 99,8 % d'éthanol, stocké à -20 oC) aux 10 ml de différenciation moyenne et bien mélanger (concentration finale de 0,5 M RA).
    REMARQUE: La PR est sensible à la lumière. La faible concentration d'EtOH n'affecte pas la différenciation cellulaire19,20,21.
  2. Ajouter 10 ml de différenciation moyenne (avec RA) au plat de culture non traité de 100 mm (dédié à la culture de suspension).
  3. Ensemencez les 1 x 106 cellules dans le plat de 100 mm (surface de plat 56,5 cm2).
  4. Mettre le flacon avec des cellules dans l'incubateur à 37 oC et 5 % de CO2 pendant 2 jours afin de favoriser la formation d'agrégats.
  5. Après 2 jours, échangez le Moyen de Différenciation. Aspirer le milieu contenant des agrégats à l'aide d'une pipette de 10 ml et le transférer dans un tube de 15 ml à RT.
  6. Laisser les agrégats se déposer par gravité pendant 1,5 min à RT.
  7. Jetez le supernatant.
  8. Ajouter un nouveau 10 ml de moyen de différenciation avec 0,5 M RA à l'aide d'une pipette sérologique de 10 ml.
    MISE EN GARDE: Ne pas pipette la cellule agrégats de haut en bas.
  9. Ensemencer les agrégats dans un nouveau plat de culture non traité de 100 mm (dédié à la culture de suspension).
  10. Placer la plaque dans l'incubateur (à 37 oC et 5 % de CO2)pendant 2 jours.

5. Agrégate la dissociation

  1. Aspirer les agrégats cellulaires à l'aide d'une pipette de 10 ml.
  2. Transférer les agrégats dans un tube de 15 ml. Laisser les agrégats cellulaires se déposer par gravité pendant 1,5 min.
  3. Retirez le supernatant.
  4. Laver les agrégats avec le DMEM seul (sans sérum et antibiotique).
  5. Laisser les agrégats cellulaires se déposer par sédimentation gravitationnelle pendant 1,5 min à RT.
  6. Aspirez le supernatant et ajoutez 2 mL de trypsin-EDTA (0,25%).
  7. Placer les agrégats cellulaires dans un bain d'eau (37 oC) pendant 10 min. Agiter délicatement les agrégats toutes les 2 min en tapant avec une main.
  8. Arrêtez le processus de trypsinisation en ajoutant 4 ml de support d'entretien.
  9. Pipette agrége 20 fois à l'aide d'une pipette de 1 ml.
  10. Cellules centrifugeuses pendant 5 min à 200 x g et RT.
  11. Retirez le supernatant et suspendez à nouveau la pastille cellulaire en 5 ml de milieu d'entretien.
  12. Déterminez le numéro de cellule avec un compteur cellulaire.

6. Cellules de placage

  1. Ajouter 3 ml par puits de milieu d'entretien à une assiette de 6 puits.
  2. Cellules de graines dans la plaque de culture de 6 puits à une densité de 0,5 x 106/bien.
  3. Incuber à 37 oC avec une concentration de CO2 de 5 %.
  4. Ensemencer les cellules sur le verre de couverture dans 6 plaques de culture de puits et effectuer immunostaining avec anti-MAP2 anticorps (20% confluence). Utilisez la plaque 6-bien pour isoler l'ARN et effectuer RT-PCR pour Map2, NeuN, Oct4, Nanog, et Gapdh (20% confluence).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Le schéma simplifié de protocole pour l'induction de neurogenèse dans la lignée cellulaire P19 est présenté dans la figure 1. Afin de définir le caractère de la lignée cellulaire P19 dans un état indifférencié et pendant la neurogenèse, la méthode RT-PCR (réaction en chaîne de transcription-polymériase inversée) a été utilisée. La lignée cellulaire Indifférenciée P19 exprimait les gènes de la pluripotence tels que le transporteur de cation/carnitine organique4 (Oct4) et la homéoboîte Nanog (Nanog). La neurogenèse induite par l'agrégation de cellules dans la culture de suspension en présence de RA a mené à une diminution rapide de l'expression d'Oct4 et de Nanog. Au contraire, l'expression des marqueurs neuronaux : protéine associée aux microtubules 2 (Map2), NeuN (également connue sous le nom de protéine de liaison de l'ARN, homolog fox-1 3 (Rbfox3)) a augmenté après la neurogenèse déclenchée (Figure 2)6 ,14,15,22. Les amorces utilisées pour chaque gène sont indiquées avec les séquences de nucléotide et la taille du produit dans le tableau 1. Une image microscopique de la lignée cellulaire Indifférenciée P19 présentait une morphologie en forme ronde (Figure 3A). Après l'induction de la neurogenèse, la structure neuronale des cellules était clairement visible 4 jours après le placage (Figure 3B). En outre, la figure 4 représente l'image de fluorescence de l'expression MAP2 dans la lignée cellulaire P19 différenciée (4 jours après les cellules de placage)14.

Figure 1
Figure 1 : Schéma de protocole pour l'induction de la neurogenèse dans les cellules embryonnaires de carcinome de P19. La neurogenèse est induite par la culture de la lignée cellulaire P19 dans un plat de culture non traité de 100 mm avec 5 % de FBS et 0,5 M de POLY. Après 4 jours, les agrégats cellulaires sont dissociés avec la trypsine et enseisés sur la plaque de culture cellulaire adhérente pour les 4 prochains jours suivants. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Changements d'expression génique dans la lignée cellulaire P19. Le graphique de bande représente l'expression de gène pour la lignée cellulaire indifférenciée de P19 (Oct4, Nanog) et pendant la neurogenèse (Map2, NeuN). Glyceraldéhyde-3-phosphate dehydrogénase (Gapdh) a été utilisé comme gène de référence. Les échantillons sont chargés dans le gel d'agarose (1,5%) dans les doubles réplications. Abréviations : Indifférencié représente la lignée cellulaire P19 indifférenciée sans traitement de PR ; Le jour 1-4 représente les jours suivants après le placage cellulaire- après 4 jours après le traitement de RA et l'étape d'agrégation cellulaire. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Images représentatives de l'analyse de la lignée cellulaire P19. (A) Images microscopiques légères de la lignée cellulaire P19 indifférenciée. (B) Images microscopiques légères de la lignée cellulaire P19 après 4 jours de neurogenèse, après 4 jours après le traitement de la PR et le stade d'agrégation cellulaire. Barre d'échelle de 100 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Image représentative d'immunofluorescence de la lignée cellulaire P19 différenciée. Image fusionnée d'immunofluorescence de la ligne de cellules de P19 souillée avec l'anti-MAP2 et le DAPI à 4 jours après placage. Barre d'échelle de 100 m. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

apprêt Séquence d'apprêt produit
taille (bp)
Gapdh Gapdh MS: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCCGGCCTTG
85 Annonces
Carte2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAGagCTCATGCC
211 ( états-unis qu'il y
Le 4 octobre F: GGCGTTCTTTTGGAAAGGTGTTC
R: CTCGAACCACATCTTCTTTTTT
313, états-unis
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160 Annonces
Nanog F: AAAGGATGAAGTGCAAGCGGTGGGG
R: CTGGCTTGCCCTGACTTTAAGC
520 Annonces

Tableau 1 : Amorces utilisées pour RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ici, nous décrivons un protocole simple pour la neurogenèse utilisant la ligne cellulaire de P19. Bien que de nombreux rapports aient été publiés à cet égard, une méthodologie détaillée pour l'induction de neurogenèse utilisant la lignée cellulaire De P19 demeure peu claire. En outre, nous avons utilisé un simple high glucose (4,500 mg/L) milieu DMEM avec 10% FBS pour l'ensemble de l'expérience. Cela nous a permis d'effectuer l'expérience neurogène d'une manière conviviale et d'élargir l'utilisation de cette méthode pour l'avenir.

Les points les plus critiques dans ce protocole sont la concentration de RA ainsi que la génération d'agrégats cellulaires dans la culture de suspension. La stimulation de la neurogenèse dans la lignée cellulaire P19 peut être effectuée sans la formation d'agrégats, mais le nombre de cellules neuronales produites sera réduit des deux tiers dans la culture cellulaire22. Monzo et coll. ont montré l'induction de neurogenèse dans la ligne cellulaire P19 en les conturing dans monolayer15. Bien que leur méthode soit très pratique car nous pouvons éliminer le processus de culture de suspension, d'autres études sont nécessaires pour comparer leur méthode avec d'autres méthodes bien décrites. La concentration de RA de 0,5 M dans le milieu a produit un nombre élevé d'agrégats cellulaires ainsi que des neurones après le placage par rapport à 1 M de PR. Il est également important de noter que nous n'avons pas pu observer une neurogenèse efficace lorsque la plupart des agrégats sont attachés au fond du plat de culture de suspension pendant le traitement de la PR. Le nombre optimal de la lignée cellulaire P19 à utiliser au début de la procédure est de 1 x 106 pour chaque 10 ml de moyen de différenciation. Pendant l'induction de la neurogenèse, la lignée cellulaire P19 forme des agrégats de taille variable et même des cellules simples se trouvent dans la culture. Pour surmonter ce problème, nous avons recueilli les agrégats cellulaires après 1,5 min de chute libre dans un tube de 15 ml. Nous avons constaté que cette approche permet l'exclusion de la contamination des cellules individuelles. Il est également recommandé d'effectuer l'enrichissement neuronal avec la culture cellulaire en utilisant des médicaments anti-mitotiques (par exemple, cytosine arabinoside) pour la culture à long terme pour inhiber la prolifération étendue des cellules gliales23.

Les neurones dérivés de la lignée cellulaire P19 expriment des récepteurs de glutamate ionotropes des types N-méthyl-D-aspartate (NMDA) et alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA)/kainite (KA) récepteurs fonctionnels d'acide aminobutyrique (GABA)25. Par conséquent, la lignée cellulaire P19 est largement utilisée dans les études sur les mécanismes moléculaires régissant la différenciation neuronale26,27,28. Plus important encore, le développement de tumeur n'a pas été observé après la transplantation de cellules29,30.

À cette fin, la recherche sur les maladies neurodégénératives telles que la maladie d'Alzheimer17,18 est également menée en utilisant la lignée cellulaire P19, et nous croyons que la méthode développée dans cette étude jouera donc un rôle dans l'élucidation de la moléculaire dans les anomalies neurodéveloppementales et les maladies neurodégénératives.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgments

L'étude a été soutenue financièrement par le Centre national des sciences, Pologne (accord no. UMO-2017/25/N/NZ3/01886) et KNOW (Leading National Research Centre) Consortium scientifique "Healthy Animal - Safe Food", décision du ministère des Sciences et de l'Enseignement supérieur No 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics