Använda CRISPR/Cas9 för att slå ut GM-CSF i CAR-T-celler

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här presenterar vi ett protokoll för att genetiskt redigera CAR-T-celler via ett CRISPR/Cas9-system.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Chimeric antigen receptor T (CAR-T) cellterapi är en skäregg och potentiellt revolutionerande nya behandlingsalternativ för cancer. Det finns dock betydande begränsningar för dess utbredda användning vid behandling av cancer. Dessa begränsningar inkluderar utveckling av unika toxiciteter såsom cytokin release syndrome (CRS) och neurotoxicitet (NT) och begränsad expansion, effektor funktioner, och anti-tumör aktivitet i solida tumörer. En strategi för att förbättra bil-T effekt och/eller kontroll toxiciteter av bil-T-celler är att redigera genomet av bil-T-celler själva under bil-T cell tillverkning. Här beskriver vi användningen av CRISPR/Cas9 genredigering i CAR-T-celler via transduktion med en lentiviral konstruktion som innehåller en guide RNA till granulocytmakrofagkolonistimulerande faktor (GM-CSF) och Cas9. Som ett exempel beskriver vi CRISPR/Cas9 medierad knockout av GM-CSF. Vi har visat att dessa GM-CSFk/o Car-T-celler effektivt producera mindre GM-CSF samtidigt bibehålla kritisk T-cells funktion och resultera i förbättrad anti-tumöraktivitet in vivo jämfört med vilda typ bil-t-celler.

Introduction

Chimeric antigen receptor T (CAR-T) cellterapi uppvisar stora löfte vid behandling av cancer. 1 , 2 två bil-T cellterapier inriktning CD19 (CART19) godkändes nyligen i Förenade anges och i Europa för användning i B-cellmaligniteter efter att ha visat slående resultat i multicenter kliniska prövningar. 3 , 4 , 5 hinder för en mer utbredd användning av bil-T-celler är begränsad aktivitet i solida tumörer och tillhörande toxicitet inklusive cytokinfrigörarsyndrom (CRS) och neurotoxicitet (NT). 3 , ,5 , 6 , 7 , 8 , 9 för att förbättra det terapeutiska indexet för bil-t cellterapi, genom tekniska verktyg såsom zink finger nukleaser, talens, och CRISPR används för att ytterligare modifiera Car-t-celler i ett försök att generera mindre giftiga eller effektivare bil-t-celler. 10 , elva

I den här artikeln beskriver vi en metod för att generera CRISPR/Cas9 redigerade CAR-T-celler. Det specifika målet med denna metod är att genetiskt modifiera CAR-T-celler under bil-T cell tillverkning via CRISPR/Cas9 för att generera mindre giftiga eller effektivare bil-T-celler. Den logiska grunden för att utveckla denna metod bygger på lärdomar från klinisk erfarenhet av bil-T cellterapi, vilket tyder på ett brådskande behov av nya strategier för att öka det terapeutiska fönstret av bil-T cellterapi och att utvidga tillämpningen till andra tumörer och stöds av de senaste framstegen inom syntetisk biologi tillåter flera modifieringar av bil-T-celler som har börjat komma in i kliniken. Medan flera arvs tekniska verktyg utvecklas och appliceras i olika miljöer, såsom zinkfingernukleaser, TALENs och CRISPR, beskriver vår metodik CRISPR/Cas9 modifiering av CAR-T-celler. 10 , 11 CRISPR/Cas9 är en RNA-baserad bakteriell försvarsmekanism som är utformad för att eliminera främmande DNA. CRISPR förlitar sig på endonukleaser för att klyva en målsekvens som identifierats genom en guide RNA (gRNA). CRISPR-redigering av CAR-T-celler ger flera fördelar jämfört med andra genomtekniska verktyg. Dessa inkluderar precision i gRNA sekvens, enkelhet att utforma en gRNA inriktning genen av intresse, hög genredigering effektivitet, och förmågan att rikta flera gener eftersom flera gRNAs kan användas på samma gång.

Specifikt i de metoder som beskrivs här, vi använde en lentivirus kodning CRISPR guide RNA och Cas9 att störa en gen under bil transduktion av T-celler. Vid val av en lämplig teknik för att redigera bil-T-celler, föreslår vi den teknik som beskrivs här är en effektiv mekanism för att generera forskning grade CAR-T-celler, men eftersom den långsiktiga effekten av permanent integration av Cas9 i arvsmassan är okänd, vi föreslå denna metod för att utveckla bevis på begreppet forskning klass bil-T-celler men inte för att producera god tillverkningssed grade CAR-T-celler.

I synnerhet, här beskriver vi generering av granulocyt makrofagkolonistimulerande faktor (GM-CSF) knockout CAR-T-celler riktade mot Human CD19. Dessa CAR-T-celler genererades genom transduktion med lentivirala partiklar som kodar en guide RNA som är specifik för GM-CSF (gen namn CSF2) och Cas9. Vi fann tidigare att GM-CSF neutralisering Ameliorates CRS och NT i en xenograft modell. 12 GM-CSFk/o Car-t-celler möjliggör hämning av GM-CSF under tillverkningsprocessen, effektivt minska produktionen av GM-CSF samtidigt förbättra Car-t cell anti-tumör aktivitet och överlevnad in vivo jämfört med vildtyp bil-t celler. 12 således, här ger vi en metod för att generera CRISPR/CAS9 redigerade Car-T-celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Detta protokoll följer riktlinjerna från Mayo Clinic ' s institutionella Review Board (IRB) och institutionella Biosäkerhetskommittén (IBC).

1. CART19 cell produktion

  1. T cell isolering, stimulering och ex-vivo-kultur
    1. Utföra alla cellkultur arbete i en cellkultur huva utnyttja lämplig personlig skyddsutrustning. Skörda perifera mononukleära blodceller (PBMCs) från avidentifierade normala blod kottar som samlats in under aferes eftersom dessa är kända för att vara en livskraftig källa till PBMCs.13
    2. För att isolera PBMCs, tillsätt 15 mL av ett densitetsgradientmedium till ett 50 mL densitet gradient separations rör. Späd blod givar blodet med en lika mängd fosfatbuffrad saltlösning (PBS) som innehåller 2% fetalt bovint serum (FBS) för att undvika cell fångst.
      1. Tillsätt den utspädda donatorn blod från konen i separations röret, noga med att inte störa gränssnittet mellan blodet och densitetsgradienten medium. Centrifugera vid 1 200 x g i 10 minuter vid RT.
      2. Dekantera supernatanten i en ny 50 mL konisk, tvätta med PBS + 2% FBS genom att ta upp till 40 mL, Centrifugera vid 300 x g för 8 min vid RT, Aspirera supernatanten, Omsuspendera i 40 ml buffert, och räkna celler.
    3. Isolera T-celler från PBMCs via en negativ markering magnetisk pärla kit med en helt automatiserad cell separator enligt tillverkarens protokoll.
    4. För att odla isolerade T-celler, Förbered T cell medium (TCM) som består av 10% Human AB serum (v/v), 1% penicillin-streptomycin-glutamin (v/v), och serumfritt hematopoietiska cell medium. Sterilisera mediet genom att filtrera genom ett 0,45 μm sterilt vakuum filter och sedan med ett 0,22 μm sterilt vakuum filter.
    5. På dag 0 (dagen för T-cellsstimulering), tvätta CD3/CD28 pärlor före stimulering av T-celler. För att tvätta, placera den erforderliga volymen av pärlor (Använd tillräckligt CD3/CD28 pärlor för ett förhållande av 3:1 pärlor: T-celler; Observera koncentrationen av pärlor kan variera) i en steril 1,5 mL microcentrifug rör och Omsuspendera i 1 mL TCM.
    6. Plats i kontakt med en magnet.
    7. Efter 1 min, aspirera TCM och Omsuspendera i 1 mL färsk TCM för att tvätta pärlorna.
    8. Upprepa proceduren för totalt tre tvättar.
    9. Efter den tredje tvätten, Omsuspendera pärlorna i 1 mL TCM.
    10. Räkna T-cellerna.
    11. Överför pärlor till T-cellerna i förhållandet 3:1 pärlor: celler.
    12. Späd celler till en slutlig koncentration av 1 x 106 celler/ml.
    13. Inkubera vid 37 ° c, 5% CO2 för 24 h.
  2. T cell transfektion och transduktion
    1. Utföra lentiviral arbete med BSL-2 + försiktighetsåtgärder, inklusive cellkultur huvor, personlig skyddsutrustning, och desinfektion av begagnade material med blekmedel före bortskaffande.
    2. Förvärva en CART19 konstruera i en lentiviral vektor.
      Anmärkning: den CART19 konstruera utnyttjas här utformades och sedan syntetiseras de Novo med hjälp av en kommersiellt tillgänglig proteinsyntes leverantör. BILEN konstruktionen var sedan klonade till en tredje generationens lentivirus under kontroll av en EF-1 α promotor. Den enda kedjan variabel region fragment härleds från FMC63-klon och känner igen mänsklig CD19. Den CAR19 konstruera äger en andra generationens 4-1BB Co-domän och CD3ζ stimulering (FMC63-41bbz). 12
    3. Utföra lentiviral produktion som tidigare beskrivits. 12
      1. I korthet, att producera lentivirus, utnyttja 293T celler som har uppnått 70-90% confluency.
      2. Tillåt inkubation i 30 min vid rumstemperatur av transfektionsmedel, inklusive 15 μg lentiviral plasmid, 18 μg av en gag/pol/tat/rev-paketvektor, 7 μg VSV-G-kuvert vektor, 111 μL av pre-complexing-reagens, 129 μL av transfektionsreagens och 9,0 mL av transfektionmediet innan du lägger till 293T-cellerna. Sedan odla de transfekterade cellerna vid 37 ° c, 5% Co2.
      3. Skörd, Centrifugera (900 x g för 10 min), filter (0,45 μm nylonfilter), och koncentrera supernatanten vid 24 och 48 h av ultracentrifugering på antingen 13 028 x g för 18 h eller 112 700 x g för 2 h.
      4. Frys vid-80 ° c för framtida bruk.
    4. På dag 1, försiktigt Omsuspendera T-celler för att bryta upp rosetter av T-celler som hade stimulerats vid 1 x 106/ml på dag 0.
    5. Under lämpliga BSL-2 + försiktighetsåtgärder för alla lentivirala arbete, tillsätt färskt eller fryst skördat virus till de stimulerade T-celler vid en mångfald av infektion (MOI) av 3,0.
  3. BIL-T cell expansion
    1. Under expansionsfasen, Fortsätt att Inkubera de omvandade T-cellerna vid 37 ° c, 5% CO2. Räkna CAR-T-celler på dag 3 och 5, och tillsätt färsk, förvärmd TCM till kulturen för att upprätthålla en bil-T-cell koncentration av 1 x 106/ml.
    2. Ta bort pärlor från de omvandade T-cellerna 6 dagar efter stimulering (dag 6) med en magnet. Skörd, Omsuspendera och placera T-celler i 50 mL koniska rör i en magnet i 1 min. Sedan samla supernatanten (innehåller CAR-T-celler), och kassera pärlorna.
    3. Placera de insamlade bil-T-cellerna tillbaka i kulturen vid en koncentration av 1 x 106 celler/ml för att återuppta expansionen.
    4. På dag 6, bedöma ytans uttryck för bilen genom flödescytometri.
      Anmärkning: flera metoder kan användas för att detektera ytan uttryck av bil, såsom färgning med en get anti-mus IgG (H + L) Cross-adsorberad sekundär antikropp eller genom färgning med en CD19 specifik peptid, konjugerat till en fluorokrom. Här, ta en alikvot (ca 100 000 T celler) från kulturen och tvätta med flödesbuffert beredd med Dulbecco s fosfat-buffrad saltlösning, 2% foster bovint serum, och 1% natriumazid. Färga cellerna med anti-bil-antikroppen och tvätta två gånger. Färga cellerna med levande/död fläck och CD3 monoklonal antikropp (OKT3). Tvätta cellerna och Omsuspendera i flödebufferten. Förvärva på en flödescytometerns för att bestämma transduktionseffektiviteten.
  4. Bil-T cell frysförvaring
    1. Att skörda och kryopreserve CAR-T-celler 8 dagar efter stimulering (dag 8 av T-cell expansion), skörda cellerna från kulturen.
    2. Snurra ner i 5 min vid 300 x g.
    3. Omsuspendera i frys medium vid 10 000 000 celler per mL per injektionsflaska i frys medium bestående av 10% dimetylsulfoxid och 90% foster bovint serum.
    4. Frys i en frys behållare för att uppnå en kyl hastighet av-1 ° c/min i en-80 ° c frys och sedan överföra till flytande kväve efter 48 h.
    5. Innan de används för in vitro-eller in vivo experiment, Tina bil-T-celler i varm TCM.
    6. Tvätta cellerna för att späda ut och ta bort dimetylsulfoxid och Omsuspendera till en koncentration av 2 x 106 celler/ml i varm TCM. Vila över natten vid 37 ° c, 5% CO2.

2. GM-CSF k/o CART19 produktion

  1. För att störa GM-CSF, använda en guide RNA (gRNA) inriktning exon 3 av Human GM-CSF (CSF2) väljs via screening gRNAs tidigare rapporterats ha hög verkningsgrad för CSF2 genen som kodar för den humana cytokin GM-CSF. fjorton
    Anmärkning: en kommersiellt syntetiserade forskning grade Cas9 tredje generationen lentiviral konstruera som innehåller denna gRNA (under en U6 promotor) användes. Konstruktionen innehåller en puromycin motstånds gen. Sekvensen av gRNA är GACCTGCCTACAGACCCGCC. 12
  2. Att producera lentivirus, använda 293T celler som har uppnått 70-90% confluency.
  3. Tillåt 15 μg av lentiviral plasmid av intresse, 18 μg av en gag/pol/tat/rev förpacknings vektor, 7 μg VSV-G kuvert vektor, 111 μL av pre-complexing reagens, 129 μL av transfektionsreagens, och 9,0 mL av transfection mediet att Inkubera i 30 min vid rumte temperatur det bildas.
  4. Tillsätt transfektionsreagens till 293T-cellerna. Sedan kultur vid 37 ° c, 5% CO2.
  5. Skörd, Centrifugera (900 x g för 10 min), filter (0,45 μm nylonfilter) och koncentrera supernatanten vid 24 och 48 h av ultracentrifugering på antingen 13 028 x g för 18 h eller 112 700 x g för 2 h och frys vid-80 ° c för framtida bruk.
  6. På dag 1, försiktigt Omsuspendera T-cellerna för att bryta upp rosetter.
  7. I ett BSL-2 + godkänt laboratorium, tillsätt fryst eller nyskördat virus till de stimulerade T-cellerna för att generera bil-T-celler. Transduce T-celler med både CAR19 lentivirus och GM-CSF som riktar sig mot CRISPR lentivirus. Lägg CAR19 lentivirus på en MOI av 3. Eftersom titrering av CRISPR lentivirus inte var genomförbart, Använd viruspartiklar som genereras från en 15 UG plasmid beredning till transduce 10 x 106 T celler.
  8. Se återstående steg av T-cell stimulering, expansion och frysförvaring som beskrivs i steg 1.
  9. För lentiCRISPR-redigerade T-celler som transporterar puromycin resistens, behandla celler med puromycin dihydroklorid vid en koncentration av 1 μg puromycin per 1 mL dag 3 och dag 5.

3. GM-CSF avbrott effektivitet och funktionell bedömning av GM-CSF k/o CART19

  1. GM-CSF störningar effektivitet: spårning av indels genom nedbrytning (TIDE) sekvensering och analys
    1. För att sekvensera exon av intresse för GM-CSF gen, Använd följande primers. Använd en framåtriktad primer sekvens för GM-CSF (CSF2) av TGACTACAGAGAGGCACAGA, och en omvänd primer sekvens av TCACCTCTGACCTCATTAACC.
    2. Extrahera DNA från upp till 5 000 000 CAR-T-celler med en genomisk extraktionssats. För PCR-reaktionen, Använd 25 μL av en Taq Mastermix per reaktion med en slutlig koncentration av varje primer i PCR-reaktionen på μM, 0,1-0,5 μg av mallDNA, och en total volym av PCR-reaktionen med upp till 50 μL med nukleasfritt vatten.
    3. Se de PCR-cyklings förhållanden som beskrivs i tabell 1.
    4. Kör PCR-prov på en 1-2% aguppstod gel på 100 V i 30 min och extrahera med hjälp av en gel extraktion kit.
    5. Sekvens PCR amplicons. Beräkna allel modifiering frekvens genom att ladda upp rådata till en lämplig tidvatten programvara. 15
  2. GM-CSF produktion och funktionell bedömning av GM-CSFk/o CART19
    1. För att bestämma cytokin produktion av bil-T-celler, inkubera vild typ CART19 celler och GM-CSFk/o CART19 med CD19 uttrycker akut lymfatisk leukemi cellinjer NALM6 vid en 1:5 förhållandet för 4 h vid 37 ° c, 5% Co2 i närvaro av monensin lösning, anti-human CD49d, anti-mänsklig CD28, och anti-human CD107a.
    2. Skörd celler från kultur för flödescytometri. Tvätta cellerna med flödescytometri buffert. Färga cellerna med en levande/död färgning kit. Inkubera i mörkret vid rumstemperatur i 15 min. fixera cellerna med ett fixeringsmedium och inkubera i mörkret vid rumstemperatur i 15 min.
    3. Efter tvättning, fläcken cellerna intracellulärt med depolarisering medium i kombination med anti-human ifnγ monoklonal antikropp, anti-human GM-CSF, anti-humant MIP-1 β, anti-human Il-2, och anti-human CD3 och inkubera i mörkret vid rumstemperatur under 30 min. Tvätta och Omsuspendera proverna. Förvärva prover på en flödescytometer och analyseras för procent av intracellulära GM-CSF uttryck.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 visar REDUKTION av GM-CSF ik/o CART19-celler i GM-CSF. För att kontrollera att genomet av T-cellerna ändrades till att blockera GM-CSF användes tidvatten sekvensering ik/o CART19-cellerna (figur 1a) i GM-CSF. BIL-T cellytan färgning kontrollerar att T-celler framgångsrikt uttrycka bilen ytan receptorn in vitro genom gating på levande CD3 + celler (figur 1b). Intracellulär färgning av GM-CSF med flödescytometri visar minskat uttryck av GM-CSF i GM-CSFk/o CART19 celler genom gating på levande CD3 + celler, kontrollera funktionell framgång av knockout (figur 1c). GM-CSFk/o Car-t-celler uppvisar en minskning av GM-CSF jämfört med vild typ anti-CD19 Car-t-celler (CART19) via intracellulär färgning (figur 1b). Dessutom har vi tidigare visat att GM-CSFk/o Car-t-celler minska produktionen av GM-CSF samtidigt förbättra anti-tumör aktivitet och överlevnad jämfört med vildtyp bil-t celler in vivo. 12 

Steg Temp (° c) Tid Cykler
Initial denaturering 94 3 minuters 1
Denaturering 94 45 SEK 35
Glödgning 60 30 SEK
Förlängning 72 2 min
Efter förlängning 72 10 min 1
4

Tabell 1: PCR cykling villkor för tidvatten sekvensering av GM-CSFk/o CART19 celler.

Figure 1
Figur 1 : GM-CSFk/o CART19 celler visar minskning av GM-CSF. A) en representativ tidvatten sekvens kontrollerar genom förändring av GM-CSF CRISPR/Cas9 GM-CSFk/o CART19 celler med en störnings effektivitet på ~ 71%. B) representativa flödesdiagram skildrar framgångsrik bil-T cell produktion med liknande bil uttryck på Wild typ CART19 och GM-CSFk/o CART19. C) som analyseras genom intracellulär FÄRGNING, GM-CSFk/o CART19 celler visar minskad GM-CSF jämfört med vild typ CART19 när STIMULERAS med CD19 positiva alla cellinjer NALM6. Vänligen klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denna rapport beskriver vi en metodik för att använda CRISPR/Cas9 teknik för att inducera sekundära modifieringar i CAR-T-celler. Specifikt, detta demonstreras med hjälp av lentiviral transduktion med en viral vektor som innehåller gRNA inriktning genen av intresse och Cas9 att generera GM-CSFk/o CART19 celler. Vi hade tidigare visat att GM-CSF neutralisering Ameliorates CRS och NT i en xenograft modell. 12 som tidigare beskrivits medger GM-CSFk/o Car-T-celler HÄMNING av GM-CSF under tillverkningsprocessen, vilket effektivt minskar produktionen av GM-CSF samtidigt som andra kritiska T-cellsfunktioner bibehålls, vilket leder till ökad anti-tumöraktivitet in vivo jämfört med "vildtyp" Car-T-celler. 12

Eftersom permanent integration av Cas9 i arvsmassan kan associeras med oönskade effekter vid omräkning till en kliniskt livskraftig produkt, föreslår vi denna specifika metod som ett sätt att generera forskningsresultat CRISPR/Cas9 modifierade CART19 för bevis på koncept Experiment.

Medan Car-T-celler håller löfte i cancerbehandling,1,2 deras effekt kan fortsätta att förbättras och deras tillhörande toxicitet bättre kontrollerad. CRISPR/Cas9 Technology tillhandahåller en strategi för att direkt inrikta sig på genomet i CAR-T-celler för att konstruera lösningar på aktuella kliniska brister. I denna artikel, vi beskriver generering av GM-CSFk/o CART19 celler.

GM-CSFk/o Car-t celler genererades genom transduktion med en lentiviral VEKTOR för Car-t cell plasmid och en lentivirus konstruera som innehåller en guide RNA till GM-CSF och Cas9. För att generera GM-CSFk/o, en tredje generationens lentivirus konstruera (lentiCRISPRv2) som innehåller Cas9 och en rapporterad högeffektiv guide RNA (grna) inriktning exon 3 av Human GM-CSF (CSF2)14 under kontroll av en U6 promotor utnyttjades. Särskild försiktighet bör iakttas under transduktionstegen i förfarandet eftersom dessa är de mest kritiska för utvecklingen av de modifierade bil-T-celler. Knockout-effektivitet kan verifieras och bedömas via spårning av indels genom nedbrytning (TIDE) sekvenser. Funktionell aktivitet av bil-T-celler undersöks genom antigenspecifik stimulering av bil konstruktionen med CD19 + målceller, följt av mätning av olika T-cellsfunktioner, inklusive produktion av GM-CSF. 12 av anmärkning, FÄRGNING för bil uttryck med en get anti-musantikropp bör inträffa innan andra antikroppar färgning med två tvättar som inträffar före ytan färgning på grund av den enda kedja variabel region fragment av CART19 varelse av mus ursprung. Detta är en punkt av betoning i felsökning om bra bil uttryck inte initialt observerats.

Dessa modifierade CAR-T-celler kan användas i in vitro-studier och in vivo xenograft modeller för bevis på koncept experiment. En fördel med denna teknik är att bil-T cell produktion och genetisk manipulation kan båda förekomma i ett steg med god effektivitet jämfört med andra tekniker. 10 , 11 medan Dual lentiviral transduktion är en bekväm och effektiv metod för att generera forskning grade GM-CSFk/o CART19 celler, DNA införlivas i genomet och långvarig Cas9 uttryck kan destabilisera genomet och öka risk för off-Target effekter. En begränsning av denna teknik är att god tillverkningssed klass Knockouts skulle kräva modifiering av tekniken till ett ribonukleoprotein CRISPR/Cas9 system eftersom denna metod inte leder till permanent inkorporering av Cas9 i genomet och minskar risken för off-Target effekter. Den metod som beskrivs i protokollet här kan potentiellt tillämpas på en mängd olika gener för att genetiskt modifiera CAR-T-celler via CRISPR/Cas9 för att hjälpa till att generera mindre giftiga eller effektivare bil-T-celler.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK är en uppfinnare av patent inom området bil T-cellterapi som är licensierade till Novartis (enligt ett avtal mellan Mayo Clinic, University of Pennsylvania, och Novartis). Dessa studier finansierades delvis av ett bidrag från Humanigen (SSK). RMS, MJC, RS och SSK är uppfinnarear av patent relaterade till detta arbete. Laboratoriet (SSK) erhåller finansiering från Tolero, Humanigen, kite, Lentigen, Morphosys och actinium.

Acknowledgments

Detta arbete stöddes genom bidrag från K12CA090628 (SSK), National omfattande cancer Network (SSK), Mayo Clinic Center för individualiserad medicin (SSK), den Predolin Foundation (SSK), Mayo Clinic Office of Translation till Practice (SSK), och den Mayo Clinic medicinsk vetenskapsman utbildningsprogram Robert L. Howell läkare-forskare stipendium (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics