Inducerende og karakteriserende vesikulær steatosis i differentierede HepaRG-celler

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

I denne undersøgelse beskriver vi en detaljeret protokol for at inducere levervesikulær steatose i differentierede heparg-celler med fedtsyresalt natriumoleat og anvende metoder til påvisning og kvantificering af lipid-akkumulering, herunder sammenhængende anti-Stokes Raman spredning (biler) mikroskopi, cytofluorimetriske analyse, olie rød O farvning, og qPCR.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Di Cocco, S., Belloni, L., Nunn, A. D., Salerno, D., Piconese, S., Levrero, M., Pediconi, N. Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells. J. Vis. Exp. (149), e59843, doi:10.3791/59843 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hepatisk steatose repræsenterer en metabolisk dysfunktion, der skyldes en ophobning af triglycerid-holdige lipid dråber i hepatocytter. Overdreven fedt ophobning fører til ikke-alkoholisk fedt leversygdom (NAFLD), som er potentielt reversibel og kan udvikle sig til ikke-alkoholisk steatohepatitis (Nash) og i sidste ende cirrhose og hepatocellulære karcinom (HCC). De molekylære mekanismer, der forbinder lipid ophobning i hepatocytter med progression til NASH, irreversibel leverskader, fibrose, cirrhose, og selv HCC stadig uklar. Til dette formål er flere in vitro-og in vivo-modeller blevet udviklet for at belyse de patologiske processer, der forårsager NAFLD. I nærværende undersøgelse beskriver vi en cellulær model for induktion af lever vesikulær steatose, der består af DMSO-differentierede humane hepatiske heparg-celler, som er behandlet med fedtsyre salt natriumoleat. Faktisk akkumulerer natriumoleatbehandlede HepaRG celler lipid dråber i cytoplasmaet og viser typiske funktioner af steatosis. Denne in vitro menneskelige model repræsenterer et værdifuldt alternativ til in vivo mus modeller samt til den primære humane hepatocytter. Vi præsenterer også en sammenligning af flere metoder til kvantificering og evaluering af fedt ophobning i HepaRG celler, herunder olie rød O farvning, cytofluorimetriske Bodipy måling, metabolisk genekspression analyse af qPCR, og sammenhængende anti-Stokes Raman spredning (biler) mikroskopi. CARS Imaging kombinerer den kemiske specificitet af Raman spektroskopi, en kemisk analyseteknik velkendt i materialevidenskab applikationer, med fordelene ved høj hastighed, høj opløsning ikke-lineære optiske mikroskoper at give præcise kvantificering af lipid ophobning og lipid dråbe dynamik. Etableringen af en effektiv in vitro-model til induktion af vesikulær steatosis sammen med en nøjagtig metode til kvantificering og karakterisering af lipid-akkumulering kan føre til udvikling af tidlig stadie diagnose af NAFLD via identifikation af molekylære markører og til generering af nye behandlingsstrategier.

Introduction

Hepatisk steatose er defineret som intrahepatisk fedt ophobning, i triglycerid-holdige lipid dråber, på mindst 5% af leveren vægt. Langvarig hepatisk Lipid opbevaring er en potentielt reversibel proces, men, det kan føre til lever metabolisk dysfunktion, inflammation og avancerede former for ikke-alkoholiske fedt leversygdom (NAFLD), den fremherskende årsag til kronisk leversygdom i mange dele af verden1,2. NAFLD er en multifaktoriel sygdom, der kan udvikle sig til den mere aggressive ikke-alkoholiske steatohepatitis (Nash), som igen kan fremskridt til cirrhose og, i en lille procentdel af patienterne, til hepatocellulære karcinom (HCC)1,3. Ingen godkendt behandling er i øjeblikket tilgængelig som en specifik behandling for NAFLD og kombinationen af kost og livsstils modifikationer forbliver søjlen i NAFLD og Nash Management4,5,6.

De molekylære mekanismer, der fører til udvikling af hepatisk steatose i patogenesen af NAFLD stadig være belyst7. I denne sammenhæng er musemodeller blevet udviklet til at studere Human steatose sygdomsprogression. Der findes et utal af forskellige modeller, og hver enkelt har sine fordele og ulemper, herunder genetiske, ernæringsmæssige og kemisk inducerede modeller, der kombinerer forskellige tilgange. Genetisk modificerede (transgene eller knockout) mus udvikler spontant leversygdom. Det skal dog bemærkes, at disse mutationer er meget sjældne hos mennesker og sletning eller over-ekspression af et enkelt gen (f. eks OB/OB mus) kan ikke efterligne etiologien af den multifaktoriale menneskelige sygdom på molekyleniveau8,9. Ligeledes, sygdommen erhvervet af mus efter kosten eller farmakologisk manipulation kan ikke efterligne virkningerne af menneskelige kost i forbindelse med udviklingen af NAFLD i man8. Dyremodeller har imidlertid fremmet udviklingen i forståelsen af NAFLD, og denne fremgangsmåde er i øjeblikket den hyppigst anvendte strategi inden for laboratorieforskning. Ikke desto mindre, replikation i mennesker af resultater opnået i dyremodeller har gentagne gange slået fejl, forårsager dårlig oversættelse til klinikken10.

Derfor kan in vitro-modeller af NAFLD spille en grundlæggende rolle i at belyse de molekylære mekanismer i NAFLD progression, og de repræsenterer et værdifuldt værktøj til at screene et stort antal forbindelser. Primære cellekulturer, udødeliggjort cellelinjer og leverbiopsier er blevet flittigt anvendt til forskningsformål11. Primære humane hepatocytter ligner nøje humane kliniske tilstande, men der er et begrænset antal donorer, og primære cellekulturer viser dårlig reproducerbarhed på grund af variabiliteten af cellerne. Disse observationer har sammen med etiske og logistiske spørgsmål resulteret i en begrænset anvendelse af humane primære hepatocytter12. Således, lever cellelinjer repræsenterer en bekvem alternativ, der har flere væsentlige fordele i forhold til primær kultur, som hepatiske cellelinjer vokse støt, har en næsten ubegrænset levetid, og har en stabil fænotype. Desuden er cellelinjer let tilgængelige, og dyrkningsbetingelserne for hepatiske cellelinjer er enklere end de primære hepatocytter og er standardiseret blandt forskellige laboratorier.

Her beskriver vi i detaljer en in vitro celle-baseret model af lever vesikulær steatosis, repræsenteret ved hepatisk differentierede HepaRG celler behandlet med fedtsyre natriumoleat. HepaRG celle linjen blev etableret fra en kvindelig patient ramt af hepatitis C infektion og en Edmondson grade jeg veldifferentieret lever tumor14. HepaRG celle linjen er en menneskelig bipotent stamcelle linje, der kan skelne ved udsættelse for 2% dimethylsulfoxid (DMSO) mod to forskellige celle fænotyper: biliær-lignende og hepatocyt-lignende celler. Differentierede HepaRG celler (dHepaRG) dele nogle funktioner og egenskaber med voksne hepatocytter og besidder evnen til stabilt at udtrykke lever-specifikke gener såsom albumin, AldolaseB, cytochrom P450 2E1 (CYP2E1), og cytochrom P450 3A4 (CYP3A4)13 (trin 3). Behandling af dheparg celler med fedtsyre salt natriumoleat (250 μM) i 5 dage føre til generering af cytoplasmiske lipid dråber, efterligne virkningerne af fede lever14,15,17,18 ( trin 4). Ophobning af lipid dråber kan let påvises ved olie rød O farvning (trin 5), en lysokrom fedtopløseligt farvestof, der pletter neutrale triglycerider og lipiderne rød-orange. For effektivt at kvantificere lipiderne i fedt dHepaRG her illustrerer vi cytofluorimetrisk analyse efter farvning med 4, 4-difluoro-1, 3, 5, 7-tetramethyl-4-Bora-3a, 4a-Diaza-s-indacen (Bodipy 505/515) (trin 6), en lipophisk fluorescerende sonde, der lokaliserer til intracellulære lipid organer og er blevet brugt til at mærke lipid dråber19. Desuden viser vi her, hvordan man evaluerer steatose ved kvantitativ polymerase kædereaktion (qPCR) (trin 7) genekspression deregulering af flere metaboliske gener i dheparg-celler. For yderligere at karakterisere og kvantificere ophobning af lipid dråber efter natriumoleat behandling, vi udførte sammenhængende anti-Stokes Raman spredning (biler) mikroskopi (trin 8), en innovativ teknik, der muliggør visualisering og kvantificering af lipid dråber uden mærkning20,21.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. forberedelse af kultur medier og reagenser

  1. Prolifererende medium: supplement William's E medium med GlutaMAX, 10% føtal kvægserum (FBS), 1% penicillin/streptomycin, 5 μg/mL insulin og 0,5 μM hydrocortison hemisuccinat.
  2. Differentiering medium: supplere William's E medium med GlutaMAX, 10% FBS, 1% penicillin/streptomycin, 5 μg/mL insulin, 50 μM hydrocortison hemisuccinat og 2% DMSO.
  3. Frysning medium: supplement prolifererende medium med 10% DMSO.
  4. Natriumoleat: opløses i 99% methanol ved en 100 mM koncentration, Stir O/N og opbevares ved-20 °C.
  5. Olie rød O: Forbered en stamopløsning. Vejer 0,35 g olie rød O og opløses i 100 mL isopropanol. Rør O/N, Filtrer (0,2 μm), og opbevar den på RT. Forbered en arbejdsopløsning: Bland 6 mL olie rød O stamopløsning med 4 mL ddH2o. Lad sidde ved stuetemperatur (RT) i 20 min, og derefter filtrere med et 0,2 μm filter. Korrekt filtrering anbefales stærkt for vellykket farvning for at undgå baggrund.
  6. Bodipy (505/515): Opløs Bodipy (505/515) farvestof i DMSO ved en 100 μM bestand koncentration, opbevares ved-20 °C i mørke, og brug ved en endelig 100 nM koncentration.
  7. Erhverve gennemsigtige glasbundne retter til biler eksperimenter.

2. optøning, forstærkning og Kryopreservering af HepaRG-celler

  1. Tø kvælstof kryopreserverede HepaRG celler ved at fordybe et parti i et 37 °C bad indtil optøet. Vælg en lav passage batch (< 20). HepaRG-celler er kommercielt tilgængelige.
  2. Cellerne overføres hurtigt til et 15 mL rør, der indeholder 10 mL prolifererende medium og centrifugeres i 5 min (200 x g, 4 °c).
  3. Supernatanten kasseres, og cellerne opslæmmes med 5 mL prolifererende medium.
  4. Tæl cellerne og fortyndes for at plade 2,5 x 104 celler/cm2.
  5. Forny mediet hver 2 eller 3 dage. Celler prolifererer med en fordobling tid på omkring 24 h.
  6. HepaRG-cellerne frakobling ved 80% konfluency med 3-5 min inkubation med trypsin opløsning 0,05%. Cellerne opsamles i prolifererende medium og centrifugeres i 5 min. (200 x g, 4 °c).
  7. Supernatanten kasseres, og cellerne opslæmmes med 5 mL prolifererende medium.
  8. Tæl cellerne og fortyndes for at plade 2,5 x 104 celler/cm2.
  9. På dette tidspunkt, forstærke cellerne ved at gentage trin 2.5-2.8 for at nå et passende antal celler til at starte eksperimenter, eller embryonog som i trin 2,10.
  10. Til embryonog heparg celler, frigør cellerne 24 timer efter plating med 3-5 min inkubation med trypsin opløsning 0,05%. Cellerne opsamles i prolifererende medium og centrifugeres i 5 min. (200 x g, 4 °c). Supernatanten kasseres, resuspenderes cellerne i 1 mL/batch af fryse middel, 1,5 x 106 celler/batch og kryopreserverer batcher i flydende nitrogen.

3. differentiering af HepaRG-celler (dag 0 – 21) (figur 1A)

  1. Dag 0. Frøheparg celler ved lav densitet (2,5 x 104 celler/cm2) i kultur behandlede retter med passende volumen af sprednings medium (figur 1B). To retter skal være belagt for hver analyse (olie rød O farvning, FACS analyse, qPCR): en for kontrol celler og en for Oleate-behandlede celler. Hvis du udfører biler målinger (trin 8), frø cellerne parallelt i gennemsigtige glasbundne retter. Som en kontrol, høst en ubehandlet skål (prolifererende celler dag 0) til at udføre genekspression analyse af differentiering markørgener (Se trin 3,6).
  2. Dag 2 og dag 4. Skift mediet med passende volumen af sprednings medium og lad cellerne vokse indtil sammenløbet.
  3. Dag 7. Cellerne skal være 100% konflydende (figur 1C). Cellerne vaskes én gang med 1x fosfat-bufferet saltvand (PBS). Fjern 1x PBS og tilsæt et passende volumen differentierings medium.
  4. Dag 8, 9, 12, 15, 18.  Vask cellerne én gang med 1x PBS. Fjern 1x PBS og tilsæt et passende volumen differentierings medium.
  5. Dag 21. Overhold HepaRG-cellerne under et mikroskop, og sørg for, at cellerne er konflydende differentierede kulturer (figur 1D).
  6. Som en kontrol, høst en kontrol skål (differentieret celler dag 21) at udføre genekspression analyse (trin 7) af differentiering markørgener (figur 1E).
  7. På dag 21 kan differentierede HepaRG-celler kryopreserveres i flydende nitrogen.

4. induktion af vesikulær steatosis (dag 21 – 26)

  1. Dag 21. Fortyndet natriumoleat (100 mM) med et passende volumen af komplet differentierings medium til en endelig koncentration på 250 μM (1:400). Tilsæt 99% methanol 1:400 (samme rumfang som natriumoleat) til en anden alikvot differentierings medium for at gøre køretøjets kontrol behandling. (F. eks. tilsættes 25 μL natriumoleat til 10 mL medium og parallelt tilsættes 25 μL 99% methanol til 10 mL medium). Vask cellerne én gang med 1x PBS og tilsæt køretøj eller natriumoleat medium.
  2. Dag 23 og dag 25. Skift mediet med passende volumen af frisklavet medium som i trin 4,1.
  3. Dag 26. Observere ved optisk mikroskop, at lipid dråber ophobes i de natriumoleate-behandlede celler og er let synlige som gennemsigtige dråber i cytoplasmaet som i figur 2A.

5. evaluering ofLipid overbelastning og steatosis induktion: olie rød O farvning

  1. Vask han celler en gang med 1x PBS og fjern 1x PBS helt.
  2. Tilsæt 4% PARAFORMALDEHYD (fortyndet i 1x PBS) og Inkuber i 15 minutter ved RT.
    Forsigtig: PARAFORMALDEHYD er giftigt, så dette trin skal udføres i en røg hætte, med beskyttende udstyr, herunder handsker, en lab frakke, og en maske.
  3. Fjern PARAFORMALDEHYD og vask cellerne to gange med 1x PBS. Cellerne kan opbevares i 1x PBS ved 4 °C i et par dage før farvning. Wrap med parafilm og dække med aluminiumsfolie for at forhindre cellerne i at tørre.
  4. Fjern 1x PBS. Cellerne inkubates med 60% isopropanol i 5 minutter ved RT.
  5. Fjern isopropanol og lad cellerne tørre helt ved RT.
  6. Tilsæt olie rød O arbejdsopløsning og Inkuber ved RT i 30 min. Den mængde arbejdsopløsning, der kræves for hver prøve, svarer til den mængde medier, der anvendes til dyrkning af cellerne.
  7. Fjern olie rød O opløsning og tilsæt straks ddH2o. vask cellerne 4 gange med DDH2o.
  8. Hent billeder under mikroskop til analyse (figur 2B).
  9. At elueres olie rød O farvestof: fjerne alle vand og lad det tørre; Tilsæt 1 mL 100% isopropanol og Inkuber i 10 min med blid omrystning ved RT.
  10. Pipet isopropanol med elueret Oil Red o Dye op og ned flere gange, hvilket sikrer, at alle olie røde o er i opløsningen. Overfør opløsningen til en kuvette. Mål OD500 nm ved spektrofotometri og brug 100% isopropanol som blank (figur 2C).

6. vurdering af lipid overbelastning og steatosis induktion: Bodipy farvning og Cytofluorimetrisk analyse

  1. Vask cellerne én gang med 1x PBS. Inkuber med 100 nM af Bodipy fortyndet i 1x PBS i mørke for 40 min ved 37 °C. En ufarvet kontrol bør inkluderes i strømnings cytometri målingerne. Fra dette punkt, beskytte prøverne fra lys så meget som muligt.
    Bemærk: Den mængde farvningsopløsning, der kræves for hver prøve, svarer til den mængde medier, der anvendes til dyrkning af celler.
  2. Fjern Farvningsopløsningen, og vask cellerne én gang med 1x PBS. Fortsæt til trin 6.3-6.6. for FACS (Fluorescens-aktiveret celle sortering) eller for trin 6,7 for mikroskop-billeddannelse.
  3. Skrabe cellerne forsigtigt med 1x PBS og overfør det til et 15 mL rør. Centrifugeres i 10 min. (200 x g, 4 °c).
  4. Fjern forsigtigt Supernatanterne uden at forstyrre pillerne og vask med 3 mL 1x PBS. Centrifugeres i 5 min. (200 x g, 4 °c).
  5. Fjern Supernatanterne og resuspension i 300 μL 1x PBS, derefter overføres til en FACS rør.
  6. Straks måle Bodipy fluorescens intensitet ved cytofluorimetrisk analyse med excitation/emission bølgelængder på 505/515 nm (figur 3A, B).
  7. Vask cellerne én gang med 1x PBS og fjern PBS helt.
  8. Tilsæt 4% PARAFORMALDEHYD (fortyndet i 1x PBS) og Inkuber i 15 minutter ved RT.
    Forsigtig: PARAFORMALDEHYD er giftigt, så dette trin skal udføres i en røg hætte, med beskyttende udstyr, herunder handsker, en lab frakke, og en maske.
  9. Fjern PARAFORMALDEHYD og vask prøverne 3x i 5 min i PBS. Celler kan opbevares i 1x PBS ved 4 °c eller afbildet straks (figur 3C). Til opbevaring, wrap med parafilm og dække med aluminiumsfolie for at forhindre cellerne i at tørre.

7. evaluering af overbelastning af lipid og steatosis induktion: qPCR

  1. Vask cellerne én gang med 1x PBS. Skrabe cellerne med 1x PBS, centrifuge ved 200 x g, og kassér supernatanten. På dette trin kan cellerne høstes ved-80 °C eller forarbejdes som i trin 7,2.
  2. Udfør total RNA-isolation med standardmetoder ved hjælp af kommercielle reagenser efter producentens anvisninger.
  3. Vurder RNA-koncentrationen ved UV-spektrofotometrisk måling, der sikrer, at RNA-renheden er høj (tæt på 2,0) baseret på A260/A280-læsningen.
  4. Syntetisere cDNA fra 1 μg total RNA med et standard cDNA-syntese sæt.
  5. CDNA fortyndes til en endelig 50 μL volumen med H2O.
  6. Analysér hver cDNA-prøve i triplicat ved qPCR: Forbered én qPCR Master Mix (tabel 1), der er tilstrækkelig til de nødvendige reaktioner for hver primer, herunder primere specifikt for de tre husholdning gener som kontrol: gliceraldeid-3-Fosfato deidrogenasi (GAPDH), actinB og ribosomale 18s (Se tabel over materialer til primer-sekvenser):
  7. Der dispenserer 18 μL Master Mix pr. brønd i en PCR-multiwall-plade.
  8. Tilsæt 2 μL cDNA-prøve i hver brønd. Forsegl pladen.
  9. Kør prøverne i henhold til den termiske cycler instruktion.

8. evaluering af lipid overbelastning og steatosis induktion: biler

  1. Fastgør de celler, der tidligere er tilberedt på glasbundne retter, som beskrevet i trin 5.1-5.3.
  2. Tænd for et kommercielt tunbart pikosekund Pulse Lasersystem, tuning det for at opnå to udgange af forskellige bølgelængder. Frekvens forskellen mellem udgangene skal være 2.840 cm-1 for at generere det intense Billys signal, der svarer til den symmetriske metylen strækning. for en fast bølgelængde udgang ved 1.064 nm ("Stokes" lys), den anden bølgelængde skal indstilles til 817 nm ("pumpe" lys).
  3. Sørg for, at 817 nm-udgangen er rumligt og tidsmæssigt overlappet med 1.064 nm-udgang: Brug et passende koldtlysreflektorlamper-spejl (dvs. med et snit mellem 817 og 1.064 nm) til rumligt at kombinere bjælkerne og bruge en optisk forsinkelses linje for at opnå tidsmæssig overlapning af laseren Pulser.
  4. Sørg for, at de to kopropagerende bjælker begge er farvelægge, og at deres diametre har tilsvarende værdier, der passer til det optiske system inden for mikroskopet, som vil fokusere dem på prøven. Hvis det er nødvendigt, separat kollimere bjælkerne før koldtlysreflektorlamper spejl, der kombinerer dem.
  5. Tænd for et kommercielt inverteret mikroskop system, som skal omfatte en infrarød laser scanningsenhed og en Dual-Channel rød/grøn EPI-detekterings enhed, og Juster de copropagerende laserstråler ind i scanningsenheden.
  6. Åbning af Dual-Channel EPI-detekterings enheden, Fjern filter kuben og Udskift dens detekterings filter med rødt bølgelængde med et båndpas-filter, der kan vælge 2.840 cm-1 Cars- signalet, der er centreret ved 663 nm for 817/1064 nm-pumpen/Stokes excitation Ordningen. En smalbånd bredde (20 nm) filter foretrækkes for at undgå indsamling af høje niveauer af fluorescerende baggrunds signaler.
  7. Placer en skål på scenen af de inverterede biler mikroskop, og ved hjælp af en 100x olie-nedsænkning mål, flytte den lodrette position af målet at fokusere på cellerne.
  8. Konfigurer mikroskop-softwaren til at indsamle billeder i høj opløsning (1024 x 1024 pixels) i et synsfelt, der spænder over 127 μm x 127 μm.
  9. Indstil mikroskop softwaren til kontinuerligt at erhverve og vise billeder af 127 μm x 127 μm synsfelt og kontrollere de viste billeder, mens optimering af billedet samling parametre. Sørg for, at laser magterne er afbalancerede til hurtig billed opsamling og minimal beskadigelse, og Indsæt passende neutrale tætheds filtre i stråle stierne efter behov, og vælg en pixel opholdstid, der gør det muligt at indsamle billeder med et godt signal til støj det valgte laser effektforhold.
  10. Erhverve og gemme billeder af flere forskellige synsfelter i skålen under de optimerede betingelser. Eventuelt multiphoton fluorescensbilleder, genereret af en grøn bølgelængde emission (hovedsagelig fra to-photon excitation ved 817 nm), kan samtidig indsamles via den anden EPI detektor. Gentag trin 8.7-8.10 for hver skål.
  11. For bilerne billedanalyse, proces billeder ved hjælp af FIJI implementering af ImageJ. Betjen Despeckle funktionen (eller et lignende super-værktøj) på hvert billede før yderligere analyse for at forbedre signal-støj-forhold uden tab af detaljer.
  12. Brug FIJI til at vælge celler manuelt og derefter automatisk tælle lipid dråber inden segmenterede individuelle celler til at producere statistikker om lipid dråbe områder og tal for hver celle og for hele billedet datasæt for hver skål.

9. analyse af MTT-cellernes levedygtighed

  1. Plade differentierede HepaRG celler i en 96-brønd plade med en densitet på 1 x 105 celler/godt i en endelig 100 μl volumen af differentiering kulturmedium.
  2. 24 timer efter såning behandles cellerne med 99% methanol (køretøj) og med 100 μM, 250 μM og 500 μM natriumoleat og natriumpalmitat fortyndet i 100 μL differentierings kulturmedium/godt i tre eksemplarer.
  3. Skift mediet med 99% methanol og med 100 μM, 250 μM og 500 μM natriumoleat og natriumpalmitat fortyndet i 100 μL differentierings kulturmedium/godt hver 24 h.
  4. 96 h efter methanol/natriumoleat/natriumpalmitat behandling, Behandl cellerne med 2 μM doxorubicin fortyndet i 100 μL differentierings kulturmedium/godt i triplicat som en kontrol.
  5. 18 timer efter doxorubucin-behandling ændres mediet med 100 μL differentierings kulturmedium.
  6. Pipet 20 μL af 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium reagens MTT (tabel over materialer) i hver brønd af 96-brønd analyse pladen indeholdende cellerne i 100 μl differentierings kulturmedium . Medtag en baggrundskontrol ved at afpipettere 20 μL reagens i en kontrol brønd uden celler i 100 μL differentierings dyrkningsmedium i tre eksemplarer.
  7. Pladen inkubates ved 37 °C i en luft furet, 5% CO2 -atmosfære.
  8. Efter inkubeering for 30, 60 og 90 min med MTT tetrazolium reagens, Optag absorbansen ved 490 nm ved hjælp af en 96-brønd plade læser. Trække baggrunds absorbansen af No-Cell kontrol brøndene fra absorbansværdierne for de andre prøver.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Denne protokol beskriver en effektiv metode til at fremkalde og karakterisere vesikulær steatose i DMSO-differentierede heparg-celler ved natriumoleatbehandling (figur 1A).

Differentiering af HepaRG-celler.
For effektivt at inducere differentiering skal prolifererende celler seedet med lav densitet (2,5 x 104 celler/cm2) i sprednings mediet. Når seedede ved lav densitet, cellerne opdele og erhverve en aflang udifferentieret morfologi (figur 1B). Cellerne bør overlades til at vokse i sprednings mediet i 7 dage, indtil 100% flughed er nået (figur 1C). Efter udsættelse for 2% DMSO begynder cellerne at differentiere og danne typiske hepatocytter-lignende kolonier omgivet af galde epiteliale celler (figur 1D). Differentierede HepaRG-celler udtrykker hepato-specifikke markører, såsom albumin, Cyp3A4 og aldolase B. For at verificere korrekt differentiering blev ekspressions niveauerne for disse hepatiske markørgener i de differentierede celler (dag 21) og i de prolifererende celler (dag 0) analyseret af qPCR (figur 1E). Albumin, Cyp3A4 og aldolase B gener bør være upregulated i de differentierede HepaRG celler i forhold til de prolifererende HepaRG celler, og vi observerede denne tendens, bekræfter effektiviteten af vores differentiering protokol.

Induktion af vesikulær steatose i heparg-celler ved behandling med natriumoleat.
Natriumoleat behandling af dHepaRG celler inducerer fedt ophobning, synlig under et optisk mikroskop som lipid dråber i cytoplasmer (figur 2A). At verificere effektiv induktion af steatosis, oleat-behandlede og kontrol HepaRG celler blev plettet med olie rød O farvestof. Efter farvning er lipid dråber let synlige som røde dråber (figur 2B) og kan kvantificeres ved spektrofotometrisk måling af olie rødt O farvestof elueret med isopropanol (figur 2C). Absorbans af elueret olie rød O fra cellerne er direkte proportional med cytoplasmisk lipid dråbe ophobning.

Natriumoleatkoncentrationen og eksponeringstid blev bestemt af MTT colorimetrisk cellelevedygtighed assay (trin 9). Natriumoleat behandling blev sammenlignet med natriumpalmitat behandling og apoptotiske Drug doxorubucin (2 μM) blev anvendt som en kontrol (figur 2D). Cytoksicitet af forbindelser blev evalueret af MTT, drage fordel af en kommerciel forbindelse (tabel over materialer), der indeholder MTT tetrazolium. Den vandopløselige gule MTT tetrazolium-forbindelse er bioreduced af metabolisk aktive celler i et lilla vand uopløseligt formazan-produkt. Formazan-produktet kvantificeres ved dets absorbans ved 490 nm, og beløbet er direkte proportionalt med antallet af levende celler i kulturen (figur 2D).

Kvantificering af vesikulær steatose i natriumoleatbehandlede heparg-celler
At kvantificere stigningen af cellulære lipid indhold efter natriumoleat behandling, vi udførte farvning med Bodipy farvestof, en sonde, der etiketter lipid dråber. Ved hjælp af cytofluorimetrisk analyse er det muligt at kvantificere triglycerid indholdet ved Bodipy Mean fluorescerende intensitet, som er højere i oleatbehandlede celler sammenlignet med kontrol celler (figur 3A, B), hvilket indikerer effektiv fedt akkumulering efter oleatbehandling. Faktisk billeder af Bodipy-farvede celler viser lyse grønne fluorescerende lipid dråber i Oleate-behandlede celler, der ikke er synlige i kontrol cellerne (figur 3C).

Natriumoleat behandling af dHepaRG celler deregulerer lipid metabolisme og inflammatorisk genekspression. For at evaluere effektiv induktion af vesikulær steatosis analyserede vi ved qPCR ekspressions niveauerne for udvalgte gener i natriumoleatbehandlede celler sammenlignet med kontrol cellernes (figur 4). Acetyl-COA pyruvatcorboxylase Beta (acacb), glycerol-3-fosfat acyltransferase mitokondrie (gpam), perilipins (PLIN2, PLIN4), apolipoprotein B (apob), pyruvat dehydrogenase kinase isozym 4 (PDK4), carnitin palmitoyltransferase 1a (CPT1A) og interleukin 6 (IL6) var upregulated i oleatbehandlede dheparg-celler, hvorimod opløst stof Carrier familie 2-medlem 1 (SLC2A1), apolipoprotein C-III (APOC3) og stearoyl-COA-desaturase (SCD) var nedreguleret (figur 4). For yderligere at karakterisere og kvantificere Lipid opbevaring i dråber ved tilsætning af natriumoleat til differentierede HepaRG celler, vi udnyttede en innovativ mikroskopi teknik, sammenhængende anti-Stokes Raman spredning (biler) mikroskopi, som gør det muligt visualisering og kvantificering af lipid dråber uden mærkning (figur 5A). Lipid dråber blev statistisk kvantificeret i form af tal, fordeling og morfologi på enkelt celleniveau ved hjælp af biler billeder. Behandling med natriumoleat (250 μM) inducerede en signifikant stigning i antallet af lipiddråber (figur 5B), hvilket førte til et højere samlet dråbe areal pr. celle (figur 5C) og et højere procent dråbe område pr. celle ( Figur 5D), sammenlignet med kontrol celler, hvilket indikerer, at dHepaRG celler effektivt ophobes fedt efter natriumoleatbehandling.

Figure 1
Figur 1 : Differentiering af HepaRG-celler. A) repræsentativt diagram,derviser HepaRG-celle differentierings/behandlingsprotokol som beskrevet i trin 3 og 4. (B-D) Billeder, der viser unstained prolifererende HepaRG celler på dag 0 efter såning (B), ved sammenløbet dag 7 efter såning (C), og differentieret Heparg (dheparg) på dag 21 efter såning (D). (E) total RNA blev ekstraheret fra prolifererende og dHepaRG celler, cDNA blev syntetiseret og analyseret af qPCR ved hjælp af primere specifikt for de angivne gener (tabel over materialer). Prøverne blev normaliseret til middelværdien af GAPDH, actinB og ribosomale 18s husholdning gener. Histogrammer viser fold induktion af prolifererende (dag 0) versus differentierede celler (dag 21) (stænger indikerer S.D.; p-værdier blev beregnet af elevens t-tests). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Natriumoleat behandling af dHepaRG celler induceret lipid dråbe ophobning. A) billeder af ufarvede differentierede heparg-celler (dheparg) behandlet i 5 dage med køretøj (kontrol) (venstre billede) eller med 250 μM natriumoleat (højre billede). (B) efter behandling blev cellerne plettet med olie rødt O-farvestof; lipid dråber er synlige i rødt. C) olie rødt O-farvestof blev elueret, og OD blev målt ved 570 nm. Resultaterne udtrykkes som et middel til tre uafhængige eksperimenter (søjler indikerer S.D.; p-værdi af elevens t-test). D) celle levedygtig vurdering af dHepaRG-cellernes køretøj (99% methanol) behandlet (CTRL) eller behandlet i 5 dage med natriumoleat og natriumpalmitat (100 μm, 250 μM eller 500 μM) eller behandlet 18 timer med doxorubucin (2 μM).  Vurderingen af cytotoksicitet blev udført ved hjælp af et MTT-Analysesæt (tabel over materialer), optagelsesabsorbans ved 490 nm i henhold til producentens instruktion. Resultaterne udtrykkes ved hjælp af tre uafhængige eksperimenter (stænger indikerer S.D.; p-værdier blev fastlagt ved hjælp af elevens t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Kvantificering af fedt ophobning efter natriumoleat behandling med Bodipy farvning. Differentierede HepaRG-celler (dHepaRG) blev behandlet med et køretøj (kontrol) eller med 250-μM natriumoleat i 5 dage. Efter behandling, dHepaRG celler blev farvet med Bodipy farvestof og analyseret af flow cytometry. A) repræsentative overlay-profiler (% af maks.: procentdel af maksimal farvnings intensitet). B) histogrammer viser den gennemsnitlige fluorescens INTENSITET (MFI) som en procentdel af de behandlede celler over kontrol fra tre uafhængige eksperimenter (stænger indikerer S.D.; p-værdier blev fastlagt ved hjælp af elevens t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). C) cellerne blev fikseret med 4% PARAFORMALDEHYD. Billeder viser Bodipy-farvede lipid dråber i grøn. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Natriumoleat behandling af dHepaRG-celler inducerer deregulering af lipid metabolisme og inflammatorisk genekspression. Differentierede HepaRG-celler (dHepaRG) blev behandlet med et køretøj (kontrol) eller med 250-μM natriumoleat i 5 dage. cDNAs blev analyseret af qPCR med primere specifikt for de angivne gener, og resultaterne blev normaliseret til middelværdien af GAPDH, actinB og ribosomale 18s husholdning gener; primere er givet i tabellen over materialer. Histogrammet viser udtryk niveauer af indikerede gener som fold induktioner af behandlede celler over kontrol (søjler indikerer S.D.; p-værdier blev beregnet af elevens t-test). Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5 : Karakterisering af lipid dråbe ophobning efter natriumoleat behandling af biler mikroskopi. Differentierede HepaRG (dHepaRG) celler blev behandlet med køretøj (kontrol) eller med 250 μM natriumoleat i 5 dage og blev analyseret af biler mikroskopi. (A) repræsentative billeder, der viser LIPID dråbe biler kontrast i rødt. (B) histogram viser antallet af lipid dråber pr celle. C) histogrammer, der viser det samlede billedområde, der dækkes af dråber pr. celle. (D) histogram, der viser% dråbe område dækket af dråber pr. celle. Alle resultater udtrykkes ved hjælp af tre uafhængige eksperimenter (stænger indikerer S.E.; p-værdier blev bestemt af elevens t-test: * 0,01 ≤ p < 0,05; * * 0,001 ≤ p < 0,01; * * * p < 0,001). Venligst klik her for at se en større version af dette tal.

Reagenser Volumen (μL) for en enkelt reaktion
2x SYBR grøn fluorescerende farvestof 10
PCR grade H2O 6
Fremad primer (μM) 1
Omvendt primer (μM) 1

Tabel 1: qPCR Master mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne protokol beskriver, hvordan heparg-celler differentieres, og hvordan man fremkalder vesikulær steatose ved behandling med natriumoleat (figur 1A). Sammenlignet med andre humane hepatocellulære karcinom (HCC) cellelinjer udstiller heparg celle linjen funktioner af voksne humane hepatocytter, der repræsenterer et værdifuldt alternativ til ex vivo-dyrkede primære humane hepatocytter13,14 ,15. Den heparg cellelinje har været meget anvendt til lever cytotoksicitet undersøgelser, Drug metabolisme, og virologi undersøgelser15,16,22.

I sammenligning med heparg celler, andre HCC cellelinjer såsom HepG2, HUH7, HUH6 og Hep3B udviser lavere metaboliske kapaciteter, mangler et betydeligt sæt af lever-specifikke funktioner23,24, og udviser en højere basal niveau af akkumulering af cytosolisk fedt lagret i lipid dråber. Således er disse HCC cellelinjer mindre nyttige som modeller for induktion af vesikulær steatose efter lipid overbelastning end heparg cellelinje.

Kritiske trin i protokollen
Når seedede ved lav densitet (2,5 x 104 celler/cm2), heparg celler erhverve en aflang udifferentieret morfologi, aktivt dividere; efter at have nået 100% konfluency, de er i stand til at differentiere ved udsættelse for 2% DMSO og de danner typiske hepatocyte-lignende kolonier omgivet af galde epitelial-lignende celler (figur 1D). Denne blandede biliær/hepatocyte cellekultur rekapitulerer funktioner i leveren væv, ligner en fysiologisk tilstand, trods mangler andre lever celletyper (Sinusoidal eller Kupffer).

Et kritisk skridt i differentierings processen er cellernes sammenhæng. Cellerne skal være sået ved lav densitet (2,5 x 104 celler/cm2) (figur 1B) og have lov til at vokse aktivt i sprednings mediet i mindst 1 uge (dag 0-7). På dag 7, før du tilføjer 2% DMSO for at starte differentierings processen, skal cellerne være på 100% sammenløbet (figur 1C). Hvis der på dag 7 (trin 2,2) komplet konfluency ikke er nået, anbefales det kraftigt, at cellerne får lov til at fortsætte med at vokse i sprednings mediet i nogle ekstra dage, indtil 100% sammenløbet er opnået.

Protokollens begrænsninger
Det er blevet observeret, at efter tilsætning af differentierings medium, nogle celler lider, og typisk 10% af cellerne dør i løbet af de efterfølgende 2-3 dage. På dette stadium, daglig vask og medium skiftende (trin 2,4) skal fortsættes for at kassere flydende døde celler. Brugen af en specifik FBS (tabel over materialer) for at supplere både differentiering og spredning medier, bør øge differentiering effektivitet og lavere celledød i dagene 7-21 (trin 2,4). Det anbefales stærkt at vedligeholde celler op til passage 20, og at vælge lavere passager (< 20) til differentiering af celler: færre celler døden opstår for de yngste HepaRG celler. Desuden, HepaRG differentiering synes at være mere effektiv i 35 mm og 60 mm retter, mens cellerne har tendens til at lide mere, når seedet i 100 mm og 150 mm retter.

Ændringer og fejlfinding
Udsættelse for forskellige nøgletal for både palmitinsyre og olie fedtsyrer har vist sig at resultere i dannelsen af intracytoplasmatiske lipid dråber25,26. Vi bemærkede imidlertid, at natriumoleat behandling af differentierede HepaRG-celler udviste bedre resultater end palissyreeksponeringen, hvad angår effektiv induktion af lipid-akkumulering og cellernes levedygtighed (figur 2D). Palmiinsyre-behandling viste sig at være giftig for differentierede HepaRG-celler (figur 2D), efter aftale med litteraturdata om hepatoma-cellelinjer og på humane og rotte hepatocytter primære kulturer, der beskriver palisinsyre som en betydeligt cytotoksisk middel25,26,27,28,29. Desuden er udnyttelsen af palmitat i cellebaserede assays udfordrende på grund af dens lave opløselighed. På grund af celle linierne iboende variabilitet anbefales det dog at verificere natrium oleatkoncentrationen og behandlingstiden, idet der testes forskellige koncentrationer i et tidsforløb med en analyse af cellernes levedygtighed.

Betydning og sammenligning af lipid detekterings teknikker
Nøjagtig bestemmelse af lipid mængder i celler blev etableret via en række forskellige tilgange i denne undersøgelse. Kvalitative og også omtrent kvantitative aftale blev observeret mellem de resultater, opnået via olie rød O farvning, Bodipy farvning, og biler billeddannelse. For en hurtig vurdering af lipid mængder i cellepopulationer, brug af bodipy-flow flowcytometri eller en plet som olie rød O er ideel. For en mere detaljeret undersøgelse af lipid dråbe indhold af celler, en Imaging modalitet foretrækkes. Endvidere, specificitet problemer er blevet rapporteret for lipid pletter såsom olie rød O20,30, og vi har observeret, at i nogle tilfælde, den bodipy plet har en lavere kapacitet end biler til udelukkende etiketten lipid dråber blandt andre celle organeller (data ikke vist). Derfor, brugen af en label-fri mikroskopisk billeddannelse teknik såsom biler giver betydelige fordele for steatose kvantificering og karakterisering. Undgåelse af brugen af et stort fluorescerende mærke gør biler billeddannelse gunstige på grund af den lille størrelse af lipid molekyler sammenlignet med typiske fluorophorer; Derfor, til påvisning af lipider, Label-fri metoder er ønskelig, endnu mere end for at observere store protein molekyler. Lipid CARS-signalet er en optisk emission, der kun genereres, når der opstår en ikke-lineær interaktion i prøven. Denne interaktion kan kun påvises, når forskellen mellem hyppigheden af de to excitation lasere fokuseret på prøven matcher methylen (CH2) strækker vibrationfrekvens. Den overflod af methylen grupper i lipider resulterer i en meget intens signaler med høj signal-til-støj nøgletal, og linearitet af den optiske interaktion betyder også, at høj rumlig opløsning er muligt i biler mikroskopi. Den fremragende kvalitet af biler billeder i almindelighed giver mulighed for indsamling af statistikker om størrelser og antallet af lipid dråber, som påvist i denne undersøgelse. Derudover har andre undersøgelser vist brugen af biler mikroskopi til at korrelere forskellige subcellulære lokaliseringer og størrelser af lipid dråber med forskellige behandlinger18, og ved hjælp af supplerende biler målinger ved forskellige bølgelængder, eller en bredbånds-biler eller lignende stimuleret Raman tilgang, forskere har vist, at det er muligt at karakterisere forskellige typer af fedtsyrer i lipid dråber31,32. Desuden har den hurtighed af biler billedindsamling aktiveret in-situ billeddannelse af levende celler til at undersøge den tidsmæssige udvikling af lipid dråbe vækst og sammenlægning33.

Fremtidige ansøgninger
I de seneste årtier, har synspunkter om roller og funktioner af lipid dråber i cellebiologi udviklet sig. Tidligere menes at være dybest set inert opbevaring vesikler, de er nu forstået at være meget dynamiske cellulære organelles, og deres rolle i sygdom er i stigende grad anerkendt34,35,36. Selv i tilfælde af leversygdom, lipid ophobning (steatosis) har længe været kendt for at være et kritisk aspekt, den præcise mekanisme af involvering af lipid dråber i sygdomsprogression er ikke helt klart. Derfor metoder såsom biler, der kan karakterisere den dynamiske opførsel af lipid dråber er af afgørende betydning for udviklingen af en molekylær forståelse af sygdomme, herunder NAFLD. Metabolisk genekspression analyse af qPCR er meget komplementær til molekylær billeddannelse af lipider via biler, som påvist i tidligere undersøgelser17,18, så dybere indsigt i sygdomsmekanismer. I denne undersøgelse, vi observere fedtsyre ophobning med deregulering af lipid metabolisme og inflammatoriske Gen ekspression, som kan bidrage til opførelsen af et panel af bio-markører for tidlig sygdoms diagnose.

Den natriumoleat-behandlede dHepaRG celle-baserede model kan øge kendskabet til de molekylære mekanismer, der er involveret ikke kun i starten, men også i progression af NAFLD, der giver et grundlag for udvikling af bedre terapeutiske tilgange til sygdommen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de ikke har konkurrerende finansielle interesser.

Acknowledgments

Vi takker Prof. Christian Trepo (INSERM U871, Lyon, Frankrig), som venligt leverede HepaRG celler. Vi er taknemmelige for Rita Appodia for administrativ hjælp. Dette arbejde blev støttet af MIUR-Ministero dell'Istruzione, dell'università e della Ricerca (FIRB 2011 – 2016 RBAP10XKNC) og Sapienza University of Rome (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

Materials

Name Company Catalog Number Comments
Hyclone HyClone Fetal Clone II  GE Healthcare SH30066
William’s E medium with GlutaMAX  Thermofisher 32551087
Penicillin/streptomycin  SIGMA P4333
Insulin  SIGMA I9278
Hydrocortisone hemisuccinate SIGMA H2270
DMSO, dimethyl sulfoxide SIGMA D2438   
Sodium Oleate SIGMA O7501 
Methanol SIGMA 179337
Isopropanol SIGMA 278475
BODIPY 505/515 Thermofisher D3921
PBS Thermofisher 14190-250
Formaldehyde solution SIGMA 252549
RNAse free DNAseI Promega M198A 
Glass-bottomed dishes Willco Wells GWST-5040
Oil Red solution SIGMA O625
CellTiter 96 AQueous One Solution Promega  G3582
q-PCR oligo name Sequence
ACACB FOR CAAGCCGATCACCAAGAGTAAA
ACACB REV CCCTGAGTTATCAGAGGCTGG
β-actin FOR GCACTCTTCCAGCCTTCCT
β-actin REV AGGTCTTTGCGGATGTCCAC
ALBUMIN FOR TGCTTGAATGTGCTGATGACAGG
ALBUMIN REV AAGGCAAGTCAGCAGGCATCTCATC
ALDOB FOR GCATCTGTCAGCAGAATGGA 
ALDOB REV TAGACAGCAGCCAGGACCTT
APOB FOR CCTCCGTTTTGGTGGTAGAG
APOB REV  CCTAAAAGCTGGGAAGCTGA
APOC3 FOR CTCAGCTTCATGCAGGGTTA
APOC3 REV GGTGCTCCAGTAGTCTTTCAG
CPT1A FOR TCATCAAGAAATGTCGCACG
CPT1A REV GCCTCGTATGTGAGGCAAAA
CYP2E1 FOR TTGAAGCCTCTCGTTGACCC
CYP2E1 REV CGTGGTGGGATACAGCCAA
CYP3A4 FOR CTTCATCCAATGGACTGCATAAAT
CYP3A4 REV TCCCAAGTATAACACTCTACACAGACAA
GAPDH FOR TGACAACTTTGGTATCGTGGAAGG
GAPDH REV AGGGATGATGTTCTGGAGAGCC
GPAM FOR TCTTTGGGTTTGCGGAATGTT
GPAM REV ATGCACATCTCGCTCTTGAATAA
IL6 FOR CCTGAACCTTCCAAAGATGGC
IL6 REV ACCTCAAACTCCAAAAGACCAGTG
PDK4 FOR ACAGACAGGAAACCCAAGCCAC
PDK4 REV TGGAGGTGAGAAGGAACATACACG
PLIN2 FOR TTGCAGTTGCCAATACCTATGC
PLIN2 REV CCAGTCACAGTAGTCGTCACA
PLIN4 FOR AATGAGTTGGAGGGGCTGGGGGACATC
PLIN4 REV GGTCACCTAAACGAACGAAGTAGC
SCD FOR TCTAGCTCCTATACCACCACCA
SCD REV TCGTCTCCAACTTATCTCCTCC
SLC2A1 FOR TGCTCATCAACCGCAACGAG
SLC2A1 REV CCGACTCTCTTCCTTCATCTCCTG
18S FOR CGCCGCTAGAGGTGAAATTC
18S REV TTGGCAAATGCTTTCGCTC

DOWNLOAD MATERIALS LIST

References

  1. Starley, B. Q., Calcagno, C. J., Harrison, S. A. Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection. Hepatology. 51, (5), 1820-1832 (2010).
  2. Byrne, C. D., Targher, G. NAFLD: a multisystem disease. Journal of Hepatology. 62, (1), Suppl 47-64 (2015).
  3. Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis. Trends in Molecular Medicine. 14, 72-81 (2008).
  4. Chalasani, N., et al. The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases. Hepatology. 67, (1), 328-357 (2018).
  5. Banini, B. A., Sanyal, A. J. Current and future pharmacologic treatment of nonalcoholic steatohepatitis. Current Opinion in Gastroenterology. 33, (3), 134-141 (2017).
  6. Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World Journal of Gastroenterology. 21, (13), 3777-3785 (2015).
  7. Younossi, Z., et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nature Reviews Gastroenterology & Hepatology. 15, (1), 11-20 (2018).
  8. Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. Preclinical models of non-alcoholic fatty liver disease. Journal of Hepatology. 68, (2), 230-237 (2018).
  9. Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. Genetically modified mouse models for the study of nonalcoholic fatty liver disease. World Journal of. Gastroenterology. 18, (11), 1141-1153 (2012).
  10. Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis. Hepatology International. 12, (1), 6-16 (2018).
  11. Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. Immortalized human hepatic cell lines for in vitro testing and research purposes. Methods in Molecular Biology. 1250, 53-76 (2015).
  12. Gómez-Lechón, M. J., Donato, M. T., Castell, J. V., Jover, R. Human hepatocytes in primary culture: the choice to investigate drug metabolism in man. Current Drug Metabolism. 5, (5), 443-462 (2004).
  13. Marion, M. J., Hantz, O., Durantel, D. The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies. Methods in Molecular Biology. 640, 261-272 (2010).
  14. Gripon, P., et al. Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences. 99, (24), 15655-15660 (2002).
  15. Anthérieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells. Hepatology. 53, (6), 1895-1905 (2011).
  16. Rouge, A., et al. PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells. Toxicology and Applied Pharmacology. 276, (1), 73-81 (2014).
  17. Belloni, L., et al. Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model. Scientific Reports. 8, 13638 (2018).
  18. Nunn, A. D. G., et al. The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells. Scientific Reports. 6, 28025 (2016).
  19. Donato, M. T., et al. Cytometric analysis for drug-induced steatosis in HepG2 cells. Chemico-Biological Interactions. 181, (3), 417-423 (2009).
  20. Hellerer, T., Axäng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy. Proceedings of the National Academy of Sciences. 104, (37), 14658-14663 (2007).
  21. Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy. PLoS One. 7, (11), 51092 (2012).
  22. Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics. Chemico-Biological Interactions. 168, (1), 66-73 (2007).
  23. Nelson, L. J., et al. Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications. Basic & Clinical Pharmacology & Toxicology. 120, (1), 30-37 (2017).
  24. Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biology and Toxicology. 28, (2), 69-87 (2012).
  25. Pusl, T., et al. Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis. Biochemical and Biophysical Research Communications. 371, (3), 441-445 (2008).
  26. Gentile, C. L., Pagliassotti, M. J. The role of fatty acids in the development and progression of nonalcoholic fatty liver disease. The Journal of Nutritional Biochemistry. 19, (9), 567-576 (2008).
  27. Mei, S., et al. Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes. Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).
  28. Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. Journal of Biological Chemistry. 281, 12093-12101 (2006).
  29. Moravcová, A., Červinková, Z., Kučera, O., Mezera, V., Rychtrmoc, D., Lotková, H. The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture. Physiological Research. 64, Suppl 5 627-636 (2015).
  30. Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy. Histochemistry and Cell Biology. 133, (4), 477-480 (2010).
  31. Rinia, H. A., Burger, K. N., Bonn, M., Müller, M. Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy. Biophysical Journal. 95, (10), 4908-4914 (2008).
  32. Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. Label-free in situ imaging of oil body dynamics and chemistry in germination. Journal of The Royal Society Interface. 13, (123), (2016).
  33. Jüngst, C., Winterhalder, M. J., Zumbusch, A. Fast and long term lipid droplet tracking with CARS microscopy. Journal of Biophotonics. 4, (6), 435-441 (2011).
  34. Welte, M. A., Gould, A. P. Lipid droplet functions beyond energy storage. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862, (10), Pt B 1260-1272 (2017).
  35. Cohen, S. Lipid droplets as organelles. International Review of Cell and Molecular Biology. 337, 83-110 (2018).
  36. Farese, R. V., Walther, T. C. Lipid droplets finally get a little R-E-S-P-E-C-T. Cell. 139, (5), 855-860 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics