Генетическое картирование различий термотерпимости между видами дрожжей Сахаромицес с помощью геномно-широкого взаимного анализа гемизигоси

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Взаимная гемизигоity через секвенирование (RH-seq) является мощным новым методом для картирования генетической основы черта разница между видами. Бассейны гемизиготов генерируются транспозонным мутагенезом, и их пригодность отслеживается за счет конкурентного роста с использованием высокой последовательности. Анализ полученных данных выявляет гены, лежащие в основе этой черты.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Главная цель современной генетики – понять, как и почему организмы в дикой природе отличаются фенотипом. На сегодняшний день, поле продвинулось в основном на прочность связи и ассоциации картирования методов, которые прослеживают связь между вариантами последовательности ДНК и фенотипа через рекомбинантные потомство от спаривания между отдельными лицами вида. Эти подходы, хотя и мощные, не очень хорошо подходят для различия между репродуктивно изолированных видов. Здесь мы описываем новый метод для рассеивания генома в ширину естественной вариации черт, которые могут быть легко применены к несовместимым видам. Наша стратегия, RH-seq, является реализацией взаимного теста гемизигот. Мы использовали его для выявления генов, ответственных за поразительный высокий рост температуры дрожжей Saccharomyces cerevisiae по отношению к его сестра видов S. paradoxus. RH-seq использует транспозонный мутагенез для создания пула взаимных гемизиготов, которые затем отслеживаются через высокотемпературную конкуренцию с помощью высокой пропускной способности секвенирования. Наш RH-seq рабочий процесс, как изложены здесь обеспечивает строгий, беспристрастный способ вскрыть древние, сложные черты в подающий надежды дрожжевой кладе, с оговоркой, что ресурсоемкие глубокого секвенирования необходимо для обеспечения геномного покрытия для генетического картирования. По мере снижения затрат на секвенирование этот подход открывает большие перспективы для использования в будущем в эукариотах.

Introduction

С самого начала поля, она была главной целью в генетике, чтобы понять механистическую основу вариации между дикими особями. По мере того как мы сопозываем локусы, лежащие в основе интересующей черты, возникающие гены могут быть немедленно использоваться в качестве мишеней для диагностики и лекарств, и могут пролить свет на принципы эволюции. Отраслевой стандарт в этом направлении заключается в том, чтобы проверить связь между генотипом и фенотипом среди населения через связь или ассоциации1. Мощные, как эти подходы, они имеют одно ключевое ограничение- они полагаются на большие панели рекомбинантных потомство от крестов между межплодными лицами. Они не имеют смысла в изучении видов, которые не могут спариваться, чтобы сформировать потомство в первую очередь. Таким образом, поле было мало возможностей для беспристрастного вскрытия черт различия между репродуктивно изолированных видов2.

В этой работе мы сообщаем о технических основах нового метода, RH-seq3, для генома масштаба обследований генетической основы вариации черты между видами. Этот подход является массово параллельной версией взаимного теста гемизиготе4,5, который был впервые задуман как способ оценки фенотипических эффектов аллельных различий между двумя генетически различными фонами на частности, локус(рисунок 1A). В этой схеме, два расходящихся лиц сначала спариваются, чтобы сформировать гибрид, половина которого генома исходит от каждого из соответствующих родителей. На этом фоне генерируются несколько штаммов, каждый из которых содержит прерванную или удаленную копию аллеля локуса каждого родителя. Эти штаммы являются hemizygous, поскольку они остаются diploid везде в геноме, за исключением локуса интересов, где они считаются гаплоидными, и называются взаимными, поскольку каждый не хватает только аллеля одного родителя, с его оставшимся аллелем, полученным из другого родителя. Сравнивая фенотипы этих взаимных штаммов гемизигот, можно сделать вывод, способствуют ли варианты последовательности ДНК в манипулируемом локусе черту интереса, так как варианты в локусе являются единственной генетической разницей между взаимными гемизигот штаммов. Таким образом, можно связать генетические различия между видами с фенотипической разницы между ними в хорошо контролируемой экспериментальной установки. На сегодняшний день применение этого теста было в рамках кандидата-гена, то есть, случаи, в которых гипотеза уже в руках, что естественные изменения в кандидат локус может повлиять на черту.

В следующем, мы выкладываем протокол для генома масштаба взаимной гемизигосности экрана, используя дрожжи в качестве модели системы. Наш метод создает геномное дополнение мутантов гемизигота, генерируя жизнеспособные, стерильные гибриды F1 между видами и подвергая их транспозонному мутагенезу. Мы объединяем гемизиготы, измеряем их фенотипы в анализах на основе секвенирования и проверяем различия в частоте между клонами бассейна, несущими аллели двух родителей данного гена. Результатом является каталог локусов, на которых варианты между видами влияют на черту интереса. Мы реализуем rh-seq рабочий процесс, чтобы выяснить генетическую основу термопереносимости различия между двумя начинающими видами дрожжей, Saccharomyces cerevisiae и S. paradoxus, которые разошлись 5 миллионов лет назад6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Подготовка копилк-содержащей плазмиды для преобразования

  1. Полоса из одной колонии Штамм кишечной палочки укрывательство плазмид pJR487 на LB и carbenicillin агар пластины. Инкубировать в течение 1 ночи при 37 градусах Цельсия или до появления отдельных колоний.
    ПРИМЕЧАНИЕ: Описание того, как плазмид pJR487 был клонирован можно найти в нашей предыдущей работе3.
  2. Прививать 1 л lb и карбенициллин на 100 мкг/мл с одной колонией кишечной палочки, содержащей pJR487 в 2 L стеклянной колбе. Расти на ночь при 37 градусах Цельсия при встряхивании при 200 об/мин до насыщения (OD600 и 1,0).
  3. Очистите плазмидную ДНК от культуры с помощью крупномасштабного плазмидного подготовительного комплекта в соответствии с опубликованным протоколом производителя (см. Таблицу Материалов для деталей). Выясните ДНК после 10-минутной инкубации с 5 мл элюционного буфера, прогретого до 37 градусов по Цельсию.
  4. Измерьте количество и качество плазмидной ДНК с помощью спектрофотометра (подробнее см. Таблицу Материалов).
  5. Повторите шаги 1.2 - 1.4 до того, как в общей сложности не будет не менее 11 мг плазмидной ДНК при коэффициенте A260:A280, по крайней мере 1,8, изолированы. Это может занять несколько подготовители, в зависимости от эффективности.
  6. Смешайте все плазмиды preps вместе в одну трубку и довести общий объем до 20 мл с elution буфера или воды. Измерьте окончательное количество и качество снова с спектрофотометром. Концентрация плазмиды должна быть не менее 538 нг/Л в этом окончательном объеме 20 мл. Если концентрация выше 538 нг/Л, разбавьте плазмид буфером elution или водой до 538 нг/Л. Плазмид может храниться при 4 градусах Цельсия до нескольких недель до использования.

2. Создание пула нецелевых генома всей взаимной гемизиготы

  1. Подготовка гибридных дрожжевых клеток для трансформации
    1. Полоса из JR507 от -80 градусов морозильной камеры склада деформации в отдельных колоний на YPD агар пластины. Инкубировать при 26 градусах Цельсия в течение 2 дней или до появления колоний.
      ПРИМЕЧАНИЕ: JR507 является гибридным штаммом, сделанным через одноклеточный спаривание гаплоидных спор S. cerevisiae DBVPG1373 и S. paradoxus No1 (с помощью тетрад-рассечения микроскопа)3.
    2. Прививать 100 мл жидкой YPD в стеклянной колбе 250 мл с одной колонией JR507 и встряхнуть при 28 градусах Цельсия, 200 об/мин в течение 24 часов, или до тех пор, пока не будет достигнута стационарная фаза.
    3. На следующий день измерьте оптическую плотность на уровне 600 нм (OD600) ночной культуры. Создайте новую культуру, разбавляя некоторых ночных культур свежей жидкой YPD в новую стеклянную колбу объемом 1 л доOD 600 от 0,2 и объемом 500 мл.
      ПРИМЕЧАНИЕ: Пример расчета обратного разбавления, если ночная культура имеет OD600 из 5.0, где C является оптической плотностью, а V объемом:
      Equation 1
      Таким образом, 20 мл насыщенной ночной культуры будет добавлено к 480 мл жидкой YPD, чтобы сделать в общей сложности 500 мл культуры на OD600 из 0,2.
    4. Повторите шаг 2.1.3 еще три раза, чтобы сделать в общей сложности четыре 500 мл культур на OD600 из 0,2 в четырех 1 l стеклянные колбы, используя ту же ночь культуры для всех четырех новых культур. Инкубировать их все при 28 градусах по Цельсию в течение 6 часов (2-3 поколения) встряхивая при 200 об/мин.
    5. Объедините две из 500 мл культур для создания культуры 1 l. Объедините оставшиеся две культуры 500 мл, чтобы создать еще 1 l культуры. На данный момент, Есть две 1 L культур. Каждая из этих культур 1 L будет подвергаться преобразованию с pJR487 в следующих шагах.
  2. Преобразование pJR487 в гибридные дрожжевые клетки
    1. Разделите каждую из культур 1 L на двадцать 50 мл aliquots в 20 пластиковых конических труб в общей сложности 40 труб. Отложите 20 трубок и выполните следующие шаги на 20 трубах за один раз.
    2. Центрифуга каждая из двадцати труб в течение 3 мин на 1000 х г, чтобы гранулы дрожжевых клеток. Отбросьте супернатант.
    3. Приготовь каждый гранулы с 25 мл стерильных H2O путем вихря. Центрифуга в течение 3 мин при 1000 х г. Отбросьте супернатант.
    4. Отрежь каждый гранулы с 5 мл 1x TE, 0,1 М LiOAc буфера вихрем. Центрифуга в течение 3 мин при 1000 х г. Отбросьте супернатант.
    5. Повторите шаг 2.2.4. В то время как клетки центрифугирования, подготовить по крайней мере 120 мл раствора 39,52% полиэтиленгликоль, 0,12 М ЛиОАк и 1,2x Tris-EDTA буфер (12 мм Tris-HCl и 1,2 мМ EDTA). Хранить на льду.
    6. Чтобы подготовить плазмид ДНК для преобразования, сначала кипятить 4 мл ДНК спермы лосося при 100 градусах по Цельсию в течение 5 мин и немедленно охладить его на льду в течение 5 мин. Затем смешайте 20 мл pJR487 (получено в разделе 1) в концентрации 538 нг/Л с 4 мл охлажденных ДНК спермы лосося для общего объема 24 мл. Держите на льду до использования.
    7. Добавьте 600 л плазмидной ДНК, смешанной с ДНК спермы лосося, поверх каждой клеточной гранулы. Не resuspend еще.
    8. Добавьте 3 мл раствора PEG-LiOAc-TE, сделанного в шаге 2.2.5 к каждой грануле. Resuspend гранулы путем pipetting вверх и вниз и вихря.
    9. Инкубировать каждую трубку в течение 10 минут при комнатной температуре.
    10. Тепловой шок каждой трубки в течение 26 минут в водяной бане установлен до 39 градусов по Цельсию.
      ПРИМЕЧАНИЕ: Каждые несколько минут, инвертировать каждую трубку, чтобы предотвратить клетки от урегулирования на нижней части трубки.
    11. Центрифуга каждая трубка в течение 3 мин при 1000 х г. Отбросьте супернатант и отдохните каждую гранулу в 10 мл YPD путем вихря. Объедините все двадцать трубок в новую стеклянную колбу. Общий объем ячеек должен сосчитываться 200 мл.
    12. Перенесите 66,6 мл ячеек в новую стеклянную колбу объемом 1 л и доведите до объема 500 мл с жидким YPD. Повторите еще два раза, чтобы использовать все 200 мл преобразованных клеток. Измерьте OD600 каждой новой культуры 500 мл (ожидайтеOD 600 от 0,35-4).
    13. Встряхните все три фляги при 28 градусах по Цельсию в течение 2 часов, чтобы восстановиться (1 поколение) при 200 об/мин.
    14. Добавьте 0,5 мл 300 мг/мл G418 к каждой из трех колб, к конечной концентрации 300 мкг/мл G418 и положить обратно, чтобы встряхнуть при 28 градусах По Цельсия, 200 об/мин.
      ПРИМЕЧАНИЕ: До этого шага преобразованные гибридные клетки восстанавливались после трансформации. После добавления G418, присутсвие plasmid pJR487 выбрано для. Любые клетки, которые не занимались плазмидом во время трансформации, начнут умирать.
    15. Повторите шаги 2.2.2 - 2.2.14 с остальными 20 коническими трубками клеток. На данный момент должно быть шесть 1 l стеклянные колбы, каждый с 500 мл клеток с G418 добавил.
    16. Инкубировать все шесть колб клеток при 28 градусах Цельсия, встряхивая при 200 об/мин, в течение примерно 2 дней или до тех пор, пока в каждой колбе не будет достигнут OD600 из 2,3 евро. Объедините все шесть колб вместе, чтобы создать единую культуру.
      ПРИМЕЧАНИЕ: Хотя все ячейки в этой культуре не будут использоваться в ступенях вниз по течению, цель использования таких больших объемов заключается в том, чтобы создать как можно больше уникальных событий преобразования, как это возможно и нормализовать любые предубеждения через одну трансформацию, объединяя их все Вместе.
    17. Используйте культуру, созданную в 2.2.16, чтобы привить две новые колбы 1 l с 500 мл YPD и G418 (300 мкг/мл) к OD600 из 0,2. Там будет оставшихся культуры, которые могут быть отброшены.
    18. Инкубировать обе колбы 1 л при 28 градусах Цельсия в одночасье, с тряской при 200 об/мин, пока каждый не достигнетOD 600 из 2,2 евро (3,5 поколения). Объедините обе культуры в единую культуру и снова измерьте OD600 объединенной культуры.
      ПРИМЕЧАНИЕ: На данный момент, культура должна быть почти полностью состоит из клеток укрывательство плазмид pJR487. В части популяции клеток транспон PiggyBac будет перенесен из плазмиды в геном транспозасом, выраженным плазмидом. Однако продолжающееся выражение транспозазии может привести к транспозиции в ходе отбора, что затмит связь между генотипом и фенотипом. Цель следующих нескольких шагов состоит в том, чтобы выполнить контротбор против присутствия плазмиды, чтобы убедиться, что больше нет выражения транспозасии. Полученный пул представляет собой смесь клеток с транспозоном или без нее, интегрированных в геном, но только клетки, содержащие транспозон, обнаруживаются на последующих этапах картирования. Время в преобразовании, во время которого транспозаза выражается, прежде чем плазмид кодирования теряется, может регулировать вероятность того, что данный клон после мутагенеза гавани более одного транспозона вставки. Частота этих, которые проявляются как "вторичные" мутации в анализе любого одного гена за один раз, может быть оценена путем массивирования определенного числа колоний после мутагенеза, а затем объединения их ДНК и последовательности,подтверждающей количество независимой вставки позиции в бассейне.
    19. Центрифуга 25 мл этой культуры в течение 3 мин при 1000 х г. Рассчитайте количество общих OD600 единиц ячеек, которые находятся в 25 мл (см. пример расчета ниже). Отбросьте супернатант и отразите достаточно H2O, чтобы создать клеточную подвеску 1,85 OD600/mLпутем вихря.
      ПРИМЕЧАНИЕ: Пример расчета для повторного подвески клеток в воде, если OD600 комбинированной культуры было 2.2:
      Equation 2
      Таким образом, после вращения 25 мл клеточной культуры и отбрасывания супернатанта, добавьте достаточно H2O в клетки, чтобы довести общий объем клеток и воды до 29,7 мл (так как клеточные гранулы также будут иметь объем, добавьте менее 29,7 мл H2O).
    20. Используя стеклянные бусинки, пластина 1 мл перекрываемых клеток в воде на каждом из 12 больших квадратных полных синтетических агарных пластин с 5-FOA. Инкубировать каждую тарелку при 28 градусах По Цельсию в течение 1-2 дней или до тех пор, пока газон не образуется на тарелке.
    21. Используя небольшие стерильные squeegees, соскребать клетки от каждой из 6 пластин и в трубку с 35 мл стерильной воды. Повторите с другими 6 пластин в общей сложности две трубки клеток и воды. Объедините все клеточные суспензии в одной трубке. Измерьте OD600 этой подвески, используя воду в качестве пробела. Доведитеконцентрацию од. 600/мл клеток до 44,4 OD600 единиц/мл с водой. По нашему опыту, эффективность транспозиционирования (доля клеток КАНЗ, которые являются URA-) составляет в среднем 50%.
    22. Определите количество -80 градусов по Цельсию запасы ячеек для хранения. Каждый aliquot может быть использован в будущем для одного эксперимента.
      ПРИМЕЧАНИЕ: Учитывая, как много времени генерации пула, хранить несколько флаконов в случае случайного неправильного использования или для выполнения повторных экспериментов. 20-30 акций являются разумным числом.
    23. Каждый морозильной камеры будет содержать 40 OD600 единиц клеток в 1 мл 10% DMSO. Добавьте 900 кл клеток к 100 Л DMSO. Повторите для общего числа созданных запасов морозильной камеры. Храните каждый на -80 градусов по Цельсию для будущего использования.

3. Выбор взаимных гемизиготов в объединенном формате

  1. Оттепель из морозильной камеры -80 градусов по Цельсию один аликот объединенных взаимных гемизиготей из раздела 2 при комнатной температуре.
    ПРИМЕЧАНИЕ: Не позволяйте aliquot сидеть долго при комнатной температуре, как только он оттаивает, использовать его немедленно.
  2. Используйте весь 1 мл aliquot, чтобы привить 150 мл жидкости YPD в стеклянной колбе 250 мл. Измерьте OD600 этой культуры, а затем инкубировать при 28 градусах Цельсия, встряхивая при 200 об/мин, в течение 7 часов, или до тех пор, пока культура не проиграет 2-3 удвоения численности населения. На данный момент культура готова к использованию для прививок культур, проходящих отбор.
    ПРИМЕЧАНИЕ: Пример расчета: Если OD600 из первоначальной колбы меры 0,25, инкубировать культуру, пока она не достигнет OD600, по крайней мере 1.0. Если какие-либо точки выборки желательно на "Время-ноль" (T-0), как способ исследовать популяцию гемизигот до выбора, клеточные гранулы могут быть приняты в настоящее время центрифугирование 5-10 мл культуры на гранулы на 1000 х г в течение 3 мин, отбрасывая супернатант и замораживание при -80 градусах По Цельсию.
  3. Используйте выращенный бассейн гемизиготе для привить культуры для выбора в подходящей схеме репликации, как при высокой температуре (39 градусов по Цельсию), так и при разрешительной температуре (28 градусов по Цельсию). Как минимум, создать три биологические культуры отбора репликации при каждой температуре, в общей сложности шесть культур отбора.
    1. Создайте каждую культуру выбора с общим объемом 500 мл в стеклянной колбе объемом 2 л с жидким YPD и привить к OD600 0.02. Встряхните каждую культуру выбора при 100 об/мин при 28 градусах или 39 градусах по Цельсию до 6-7 удвоений популяции (соответствующие OD600 из 1,28-2,56 евро). Постарайтесь как можно ближе сопоставить окончательный OD600 всех культур отбора.
      ПРИМЕЧАНИЕ: Культура выбора при 28 градусах Цельсия будет расти быстрее, чем культуры отбора при 39 градусах Цельсия. Следовательно, культуры отбора при 39 градусах Цельсия будут проводить в инкубаторе более длительный период времени. Продолжайте следующие шаги с каждой колбы, как она становится готовой, независимо от общего количества часов, проведенных в инкубаторе. По нашему опыту, культурам при 28 градусах или 39 градусах по Цельсию потребовалось 12 или 18 часов, соответственно, чтобы достичь ОД в 2,0 евро. Длинные выборы могут иметь преимущество усиления небольших фитнес-эффектов, но также позволяют de novo фоновые мутации возникать, что приведет к шуму в окончательное распределение фитнесов через транспозонных мутантов в любом одном гене / аллеле. Таким образом, важно ограничить время отбора в эксперименте RH-seq.
  4. Урожай клеточных гранул из каждой культуры отбора. Рассчитайте объем, необходимый для получения 7 OD600 единиц клеток и центрифугна на 1000 х г в течение 3 мин по крайней мере четыре гранулы этого объема от каждой культуры отбора в качестве технических репликаторов для подготовки и секвенирования библиотеки (см. разделы 4 и 5 , ниже). Откажитесь от супернатанта и храните при -80 градусах Цельсия.
    ПРИМЕЧАНИЕ: Пример, если колба выбора имеет окончательный OD600 из 2.0:
    Equation 3

4. Строительство библиотеки Tn-seq и секвенирование Illumina для определения обилия транспозонных мутантов гемизиготы

  1. Оттепель на льду каждая клетка гранулы из раздела 3, который будет секвенирован.
  2. Изолировать полную геномную ДНК (gDNA) из каждой клетки гранулы с помощью дрожжевого комплекта очистки gDNA в соответствии с инструкциями производителя. Повторное увеличение ДНК в 50 ql элуционного буфера нагревается до 65 градусов по Цельсию.
  3. Количественное количество гДНК от каждой гранулы с помощью фторметра. Минимальное общее количество гДНК, необходимое для каждой клеточной гранулы для создания библиотеки секвенирования следующего поколения (NGS) для Tn-seq с использованием следующей процедуры составляет 1 мкг.
    ПРИМЕЧАНИЕ: Менее 1 мкг гДНК может быть использовано для создания библиотеки, но окончательное количество и качество библиотеки будет страдать.
  4. Следуйте установленному протоколу для создания библиотек Tn-seq7. Обратите внимание на следующую соответствующую информацию, которая является уникальной для этого протокола:
    1. После стрижки gDNA, конечный ремонт и перевязка адаптера, усиливают gDNA, содержащий транспосон через ПЦР. Для этого ПЦР используйте следующий передний и обратный грунтовку, которые специфичны для транспозонных транспозонов PiggyBac и NGS, соответственно:
      Вперед (N - случайный нуклеотид)
      5' ATGATACGGCGACCGAGATTACACTACTTCTTCCCTACACGACGCG
      CTCTTGATCTNNNNNНАГЦААТАТТТЦААГААТГКГГГГЦЦААТ 3'
      Обратный (участок Ns представляет собой уникальный 6-б. индекс, используемый для мультиплексирования. Ниже приведена информация об индексах)
      5' CAAGCAAGACGGCATACGAGATNNNNNNGTGACTGGAGTCAG
      ACGTGTGTCTCTCTCTGATCT 3'
    2. Используйте включенные шаги очистки с размером селективного бисера, чтобы свести к минимуму долю клонированных фрагментов в окончательной библиотеке, которая была бы слишком коротка, чтобы включить mappable геномную последовательность.
      ПРИМЕЧАНИЕ: После того, как минимальные требования репликации до сих пор для культур ы отбора, будет 24 отдельных образцов gDNA для секвенирования. Учитывая текущие затраты на секвенирование, маловероятно, что каждый образец будет работать сам по себе. Чтобы объединить образцы на одной полосе, создайте несколько обратных грунтов, каждый из которых имеет уникальный 6-базовый индекс пары. Образцы с различными индексами могут быть объединены в одну и ту же полосу секвенирования и разделены вычислительно после этого.
  5. Последовательность одного конца 150 bp читается из каждой библиотеки с использованием технологий NGS через восемь полос.
    ПРИМЕЧАНИЕ: Количество требуемых секвенирования в значительной степени зависит от качества библиотек, подготовленных на предыдущем этапе (т.е. доля ДНК в библиотеке, фактически содержащей транспозовую ДНК, представляющую ДНК, поступающую от взаимных гемизиготов). Этому способствуют два основных фактора. Во-первых, поскольку ячейки без интегрированного транспосона не противопоставить во время создания пула, каждая культура будет смесью ячеек с транспозоном и без нее. Во-вторых, даже в геномах транспососодержащих взаимных гемизиготов большая часть генома не является транспозоном, содержащей последовательность, и эта гДНК неизбежно будет частью подготовки библиотеки. Целью окончательного усиления ПЦР транспозонно-содержащей ДНК является увеличение соотношения транспозонно-содержащей ДНК к этим двум источникам фоновой гДНК. Чем эффективнее это усиление, тем выше доля считывателей будет использоваться в анализе ниже по течению. Чем ниже качество библиотек, тем больше последовательности потребуется сделать, так как все большая доля считывания не будет содержать транспосон ДНК и не будет полезна. С учетом вышеуказанных ограничений восемь полос последовательности были способны отслеживать взаимное изобилие гемизигот в разумной степени. Более последовательное ирование позволит проделать более глубокий анализ.

5. Сопоставление местоположения вставок транспосонов и анализ RH-seq

ПРИМЕЧАНИЕ: Следующий анализ данных был выполнен с помощью пользовательских скриптов Python (найденных в Интернете в https://github.com/weiss19/rh-seq), но может быть переделан с помощью других языков сценариев. Ниже изложены основные шаги в этом процессе. Выполните следующие шаги на каждом отдельном файле репликации, если не указано, что они объединены.

  1. Обрезка адаптера последовательности от считывает и отделить каждого репликации читает в соответствии с индексом.
  2. Найти считывания, содержащие транспозонно-геномные соединения. Для достижения этой цели, поиск в каждом чтении за последние 20 базовых пар транспозона, CAGACTATCTTTTTAGGTAAA. Отбросьте все считывания, не содержащие эту последовательность.
    ПРИМЕЧАНИЕ: По нашему опыту, доля считывает отображение до конца транспосона составляет 83-95%.
  3. Обрезка остальных, транспозонсодержащих читает содержать только последовательность вниз по течению 3 'конец транспосона. Отображая эту последовательность в геном дрожжей, определить геномный контекст вставки транспосона для каждого чтения (шаг 5.4 ниже).
  4. Используйте BLAT или эквивалентный инструмент отображения для картирования последовательности вниз по течению транспозона к S. cerevisiae DBVPG1373 x S. paradoxus No1 гибридный геном (имя скрипта: map'и'pool-BLAT.py).
    1. Отбросьте любые считывания, для которых существует менее 50 базовых пар пригодной для упокоительности последовательности ниже 3' конца транспосона. Короткие последовательности трудно сопоставить однозначно.
    2. При использовании BLAT используйте следующие параметры: идентификация No 95, размер плитки - 12.
    3. Создайте базовый гибридный геном для картирования путем сопоставления последних версий эталонных геномов S. cerevisiae S288c и S. paradoxus CBS432.
      ПРИМЕЧАНИЕ: Базовый аннотационный файл, описывающий геномные границы отдельных генов в гибридном геноме, можно найти в репозитории Github, перечисленных выше (Filename: YS2-CBS432-плазмид-чистый). Только использование читает, какая карта в одном месте в гибридном геноме (т.е. уникальны либо для S. cerevisiae или S. paradoxus). Ожидается единая частота событий вставки в геноме; распределение вставок позиций по геномам сообщается в другом месте3.
  5. Подсчет общее количество считывает отображение каждого уникального места вставки транспозона, который мы выводим все возникли из клеток одного клона-мутанта вставки транспозона. Сумма всех таких значений из одной библиотеки называется общим количеством отображеных считываемых для этой библиотеки.
  6. В тех случаях, когда существует несколько вставок, отображающих в пределах 3 базовых пар друг от друга, объедините их все в одну точку вставки, назначив все считывания в одном месте с самым высоким количеством прочитано. Это значение, nвставить, представляет обилие, что вставка клона в клетке гранулы, из которых gDNA была секвенирована. На данный момент, будут списки nвставки, каждый обилие уникальной отображечной вставки транспозона, один список для каждой клетки гранулы секвенированных.
    ПРИМЕЧАНИЕ: Транспозон PiggyBac вставляет в последовательности TTAA в геноме, последовательность 4 базовых пар. Таким образом, мы делаем вывод, что вставки отображения в пределах 3 базовых пар друг от друга должны были возникнуть из того же сайта TTAA.
  7. Так как будет немного различное количество общего количества считываемых, поступающих из каждой последовательной библиотеки, нормализовать значения nвставки во всех файлах, если они должны быть сравнены. Сделайте это путем табуляции общее количество отображеных считываний из каждой отдельной библиотеки, nгранулы, и принять в среднем все nгранулы во всех библиотеках, lt;nгранулы Умножьте каждуюn вставку в данных отдельной библиотеки по соотношениюгранулы lt;n,чтобы вычислитьвставку,нормализованное изобилие данного клона вставки транспозона.
    Equation 4
    Кроме того, размер библиотеки можно оценить с помощью доступных инструментов, таких как DESeq28 (имя скрипта: total'reads и-normalize.py).
  8. Табулировать набор всех вставок, отображаемых во всех библиотеках. Для вставок, найденных в некоторых библиотеках, но не в других, установитевставку No 1 для расчетов ниже по течению.
  9. Фильтр считывания, чтобы найти те вставки, которые попадают в гены в соответствии с аннотационным файлом (имя скрипта: удалить-NC и plasmid-inserts.py).
  10. Для каждой уникальной вставки, рассчитать среднее изобилие через технические репликации каждого выбора (каждая культура либо на 28 градусов по Цельсию или 39 градусов по Цельсию), lt;ainsertsgt;технические (имя сценария: combine'tech'reps'V2.py).
  11. Для каждой уникальной вставки, рассчитать среднее изобилие через биологические репликации каждой температуры, lt;aвставки,итог , взяв среднее всех lt;aвставкипри каждой температуре. В то же время, рассчитать коэффициент вариации для каждой вставки, CVвставки, всего через lt;aвставки(название сценария: combine'bio'reps.py).
    ПРИМЕЧАНИЕ: На данный момент, для каждой температуры, 28 градусов по Цельсию и 39 градусов по Цельсию, есть список уникальных вставок транспосонов, их среднее изобилие и коэффициент вариации между биологическими репликациями для каждого. Эти данные для нашего эксперимента сообщается в другом месте3.
  12. Фильтр улистивай список всех вставок для тех, которые имеют, либо на 28 кВ или 39 градусов по Цельсию, lt;ainsertsgt;всего 1,1, и CVвставки,всего 1,5 (имя сценария: filter'inserts.py).
  13. Для каждой уникальной вставки, вычислить журнал2(злт;вставкайgt;всего,28 КК / lt;ainsert'gt;всего,39 КК). Это значение представляет собой "термопереносимость" данного клона-мутанта-вставки транспозона (название сценария: fitness'ratios.py).
  14. Сортировать все уникальные вставки по гену и аллель (S. cerevisiae или S. paradoxus), и табулировать количество вставок в каждом аллеле. Фильтр генов так, что только гены, которые имеют по крайней мере 5 вставок в каждом аллеле анализируются (Название сценария: организовать и-фильтра генов.py).
    ПРИМЕЧАНИЕ: Несколько уникальных вставок через каждый аллель позволяют более точное измерение термотерпимости, что взаимные гемизигота. Снижение количества вставок, необходимых для аллеля возможно, но поставит под угрозу точность этой меры и увеличит многократное бремя тестирования, позволяя больше генов, которые будут проверены. Кроме того, отфильтровывание генов с слишком небольшим количеством вставок на аллель поможет уменьшить влияние на результаты испытаний любого отдельного клона гемизигота, укрывающего вторичную мутацию сайта, которая дает очень разрозненный фенотип.
  15. Для каждого гена, оставшегося в наборе данных после вышеуказанной фильтрации, сравните термопереносимости (коэффициентыжурнала 2) всех вставок в Аллеле S. cerevisiae с теми, которые есть в аллеле S. paradoxus с помощью теста Mann-Whitney U. Кроме того, можно было бы внедрить регрессионную модель, адаптированную из DESeq28 (имя скрипта: mann'whitney-u.py).
  16. Правильные значения pдля нескольких испытаний с использованием метода Бенджамини-Хохберга.
  17. Гены со значительными значениями p(скажем, 0,01) являются кандидатами на гены, важные для различий в термопереносимости между двумя видами.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Мы спаривали S. cerevisiae и S. paradoxus, чтобы сформировать стерильный гибрид, который мы подвергли транспозозому мутагенезу. Каждый мутагенизированный клон был гемизиготом, диплоидным гибридом, в котором нарушается один аллель одного гена(рисунок 1A, Рисунок 2). Мы соревновались гемизиготы друг против друга по росту на 39 градусов по Цельсию и, в отдельном эксперименте в качестве контроля, на 28 градусов по Цельсию(рисунок 1B), и мы выделили ДНК из каждой культуры. Чтобы сообщить о пригодности каждого hemizygote мы количественно изобилие с помощью объемного секвенирования, используя протокол, в котором ДНК была фрагментирована и ligated для адаптеров, а затем усиление транспосона вставки позиции(Рисунок 1C). Если праймеры для этого усиления отличаются от, и менее эффективным, чем в протоколе, фон читает будет преобладать в последовательности данных, что приводит к меньшему количеству годных считывателей и подрывает точность оценки пригодности. Аналогичные проблемы качества могут возникнуть в результате низкого ввода ДНК в подготовку библиотеки секвенирования.

С результатами в руке от нашего секвенирования, для данного гена мы сравнили изобилие гемизиготей при двух температурах между двумя классами гемизиготов: клоны, где только Аллель S. cerevisiae был диким типом и функциональным, и клоны, полагаясь только на S. paradoxus allele(Рисунок 1D). При анализе на данном этапе, если вычислительная стратегия после обработки протокола не будет соблюдена и гены с относительно небольшим числом транспозонных мутантов в пуле будут включены в анализ, статистическая мощность упадет, и никаких значительных вызовов генов не приведет. В нашей реализации, мы обнаружили сильный сигнал на восемь генов домашнего хозяйства(рисунок 3). В каждом случае, транспозонные вставки в S. cerevisiae аллель в гибридных скомпрометированного роста при высокой температуре (рисунок3). Эти локусы представляли кандидата детерминанты термотерпимости черта, которая отличает S. cerevisiae от S. paradoxus. В отдельных экспериментах, о которых сообщалось в других местах, мы проверили влияние аллельныхвариаций на каждом участке, используя стандартные методы трансгенеза, выходящие за рамки текущего протокола 3.

Figure 1
Рисунок 1. Схема рабочего процесса RH-seq.
A. S. cerevisiae и S. paradoxus (синий и желтый соответственно) спариваются, образуя гибрид (зеленый), содержащий одну копию генома каждого из родителей. При данном локусе в гибриде, транспосона вставка (черный ящик) в аллеле каждого вида в свою очередь создает гемизигот, который диплоид на остальной части генома, за исключением локуса интереса. Сравнение фенотипов через гемизиготы показывает фенотипические эффекты аллелики вариации на манипулируемых локуса. B. Через много клонов hemizygous на, котор дали гене (YFG), некоторые достигают более высокого изобилия чем другие в конкурсной культуре, как количественно посекречиванию. C. ДНК из гемизиготского бассейна стрижена и перелита адаптерам (красный). Для данного клона соединение между транспозоном (тн, черным) и геномом (синий) усиливается транспозонной грунтовкой (черная наконечник стрелы) и адаптер-специфической грунтовкой (красная стрелка). Секвенирование читать рассчитывает из amplicon доклад пригодности клона в популяции. D. Для RH-seq гена хит, табуляции доля клоновгемизигот ( у-оси) экспонирование данной пригодности после конкуренции при высокой температуре (x-оси) показывает поразительную разницу между двумя генотипическими классов: те, с транспосона вставка в аллеле S. cerevisiae (с оставшимся аллелем S. paradoxus; желтым) и теми с аллелем S. paradoxus нарушена (и S. cerevisiae allele оставшийся; синий). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2. Схема отбора для создания пула генома всей взаимной гемизиготы с PiggyBac плазмидных транспонов.
Плазмида PiggyBac (pJR487) превращается в URA3-/- клон диплоидного гибрида S. cerevisiae DBVPG1373 x S. paradoxus No1 (JR507). Присутствие плазмиды или транспосона выбрано для через рост в G418, который выбирает для присутсвия кассеты KanMX; выжившие клетки, которые заняли PiggyBac плазмид и / или гавани интегрированного транспосона. Клетки без последних выбираются против через рост в 5-FOA, который является токсичным в присутствии кассеты URA3. Так как непреобразованный гибрид URA3-/-, - только клетки, которые умрут в этом шаге являются те, которые все еще содержат PiggyBac плазмид, который содержит кассету URA3. Остается пул гибридных мутантных клеток, содержащих транспозон, интегрированный в геном. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3. Лучшие хиты, отображаемые RH-seq.
Каждая панель сообщает данные RH-seq для указанного гена от RH-seq. X-оси сообщает журнал2 обилия транспозонного клона-мутанта после выбора при 39 градусах Цельсия, относительно аналогичного количества в 28 градусов по Цельсию. Y-оси сообщает о пропорции всех клонов подшипников вставки в указанном аллеле, которые выставлены соотношение изобилия на х, как оценка плотности ядра. Базовые данные чтения и подсчета для вставок сообщаются в другом месте3. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Преимущества RH-seq по сравнению с предыдущими статистически-генетическими методами в несколько раз. В отличие от анализа связей и ассоциаций RH-seq обеспечивает разрешение картирования с одним геном; как таковой, он, вероятно, будет значительным полезным даже в исследованиях изменения черта между отдельными лицами того или иного вида, а также межспецифических различий. Кроме того, в предыдущих попытках анализа взаимной гемизигосности генома использовались коллекции мутантов удаления генов, некоторые из которых приводят к вторичным мутациям, которые могут привести к ложноположительным результатам9,10. Стратегия RH-seq обходит эту проблему, генерируя и фенотипируя многих мутантов гемизигота в каждом гене в свою очередь, таким образом, что фон любого отдельного клона-мутанта вносит лишь незначительной вклад в конечный результат. В принципе, RH-seq также позволяет изучать некодирующие локусы, хотя в текущей работе мы сосредоточились исключительно на генах.

Есть несколько причуд RH-seq, некоторые биологические и некоторые технические, что успешный практикующий будет иметь дело с авансом, чтобы максимизировать полезность подхода и ускорить путь к лучшим результатам. Биологически, RH-seq только имеет смысл как метод, если два вида целевых можно спариваться, чтобы сформировать стабильный, жизнеспособный гибрид, который может быть генетически манипулировать. Таким образом, мы не можем представить себе применение RH-seq к видам настолько расходятся, что они не в состоянии слиться в кариотипично стабильной диплоид. С другой стороны, если два родителя диплоидного гибрида слишком похожи на уровне ДНК, большинство читает от секвенирования транспозона не может быть отображено аллель-специфически только к одному из двух геномов родителей и будет непригодным для угощей; таким образом, данный эксперимент RH-seq будет наиболее успешным, когда родители имеют высококачественные эталонные геномы и попали в "сладкое пятно" последовательности расхождения. В качестве отдельного пункта рассмотрения, учитывая RH-seq проект, разработанный для вскрытия генетической основы черты разница между родительскими видами, результаты, вероятно, будет гораздо более интерпретируемым, когда, по черте интереса, биология гибрида служит разумный представитель родителей. Экстремальные фенотипы, уникальные для гибрида (гетероз), могут влиять или скрывать эффекты генов интереса, лежащих в основе фенотипа, поскольку он отличается между родителями. Любые гены, отображаемые с помощью взаимного анализа гемизигосности, должны быть проверены независимыми экспериментами аллель-своп в генетическом фоне чистокровных родительских видов.

Что касается технических проблем в эксперименте RH-seq, наш опыт выявил несколько потенциальных источников шума и предоставил работоспособные решения. Шум проявляется как несогласие между последовательности основе оценок пригодности гемизиготов укрывательство транспосона вставки в данном аллель данного гена. Это может быть результатом различных вторичных мутаций в фоновом режиме транспозонных мутантов (см. ниже); вариативность эффективности ПЦР, усиливающих различные участки вставки; низкая представленность данного мутанта в массовом пуле, что приводит к низкому охвату секвенирования, что ослабляет точность; и различия в положении вставки транспозона в гене (например, транспозоны, вставляемые на конце гена 3' могут иметь минимальный фенотипический эффект). По всем этим причинам мы считаем крайне важным создавать очень большие пулы транспозонных мутантов и, в конечном счете, исключить из тестирования любой ген без разумного количества мутантов в каждом из двух аллелей. Мы отмечаем, что, хотя мы не внедрили его здесь, штрихкодированная транспозовая система7 может способствовать дальнейшему решению проблем предвзятости ПЦР и сокращению затрат и труда эксперимента RH-seq.

В заключение мы создали простой рабочий процесс для RH-seq и определили предостережения этого подхода. Мы считаем, что последнее не ставит под существенный под угрозу полезность RH-seq; мы считаем, что он имеет большие перспективы для высокого разрешения, генома масштаба вскрытия фенотипических последствий генетических изменений, в том числе различия между видами, которые были репродуктивно изолированы в течение миллионов лет.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Мы благодарим Д. Роопа, Р. Хэкли, И. Григорьева, А. Аркина и Д. Скеркера за их вклад в первоначальное исследование, Ф. Альшабена, А. Флюри, Г. Гайзельмана, Д. Хонга, Д. Кима, М. Маурера и Л. Олтрогге за техническую помощь, Д. Сэвиджа за его щедрость с микроскопией ресурсов, а Б. Блэкман, С. Корадетти, А. Фламхольц, В. Гуаччи, Д. Кошланд, К. Нельсон и А. Сасикумар для обсуждения; мы также благодарим J. Dueber (Департамент биоинженерии, Калифорнийский университет в Беркли) за космид PiggyBac. Эта работа была поддержана R01 GM120430-A1 и сообществом секвенирования проекта 1460 в RBB в Министерстве энергетики США Совместный институт генома, Министерство энергетики США Управления науки пользователей фонда. Работа, проведенная последним, была поддержана Управлением по науке Министерства энергетики США по контракту No. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics