Genom-Geniş Karşılıklı Hemizygosity Analizi ile Saccharomyces Maya Türleri Arasındaki Termotolerans Farklarının Genetik Haritalama

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Sıralama (RH-seq) ile karşılıklı hemizygosity türler arasındaki bir özellik farkıgenetik temelharita için güçlü bir yeni yöntemdir. Hemizygot havuzları transposon mutagenezi tarafından oluşturulur ve fitness yüksek sıralama boyunca kullanarak rekabetçi büyüme ile izlenir. Elde edilen verilerin analizi, özelliğin altında yatan genleri saptar.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Modern genetiğin temel amacı, vahşi doğadaki organizmaların fenotipte nasıl ve neden farklılık gösterebildiğini anlamaktır. Bugüne kadar, alan büyük ölçüde bağlantı ve ilişki haritalama yöntemleri, DNA dizi varyantları ve fenotip arasında bir türün bireyler ilerler arasındaki miyetler arasında arasındaki ilişkiyi iz gelişmiştir. Bu yaklaşımlar, güçlü olmasına rağmen, üreme tarafından izole edilmiş türler arasındaki özellik farklılıklarına pek uygun değildir. Burada, uyumsuz türlere kolayca uygulanabilen doğal özellik varyasyonunun genom çapında diseksiyonu için yeni bir yöntem tanımlıyoruz. Stratejimiz RH-seq, karşılıklı hemizygot testinin genom çapında uygulanmasıdır. Biz maya Saccharomyces cerevisiae kardeş türü S. paradoxusgöre çarpıcı yüksek sıcaklık büyüme sorumlu genleri tanımlamak için koşum . RH-seq transposon mutagenez kullanır karşılıklı hemizygotbir havuz oluşturmak için, daha sonra yüksek-throughput sıralama yoluyla yüksek sıcaklık rekabet yoluyla izlenir. Burada ortaya konan RH-seq iş akışımız, genetik haritalama için genomik kapsama alanı sağlamak için kaynak yoğun derin sıralamanın gerekli olduğu ihtarına bağlı olarak, tomurcuklanan maya clade'daki antik ve karmaşık özellikleri incelemek için titiz ve tarafsız bir yol sağlar. Sıralama maliyetleri düştükçe, bu yaklaşım ökaryotlar arasında gelecekteki kullanım için büyük bir umut vaat ediyor.

Introduction

Alanın başlangıcından bu yana, vahşi bireyler arasında varyasyon mekanistik temelini anlamak için genetik bir ana hedef olmuştur. Biz ilgi bir özellik altında yatan loci harita olarak, ortaya çıkan genler tanı ve ilaçlar için hedef olarak hemen kullanılabilir, ve evrim ilkelerine ışık tutabilir. Bu amaçla doğru endüstri standardı bağlantı veya dernek1üzerinden bir popülasyon arasında genotip ve fenotip arasındaki ilişkiyi test etmektir. Bu yaklaşımlar ne kadar güçlü sayılsa da, bir anahtar sınırlaması vardır— interfertile bireyler arasındaki haçlardan gelen büyük rekombinant soyundan gelen panellere güvenirler. Onlar ilk etapta döl oluşturmak için çiftleşemez türlerin çalışmada hiçbir faydası yoktur. Bu nedenle, alan üreme izole türler arasındaki özellik farklılıkları nın tarafsız diseksiyon için çok az kapasiteye sahip olmuştur2.

Bu çalışmada, türler arasındaki özellik değişiminin genetik temelinin genomölçeğinde incelenmesi için yeni bir yöntem olan RH-seq 3'ün teknik temellerini rapor ediyoruz. Bu yaklaşım karşılıklı hemizygot testi bir kitlesel paralel versiyonu4,5, ilk bir iki genetik olarak farklı arka planlar arasındaki allelik farklılıkların henotilik etkilerini değerlendirmek için bir yol olarak tasarlandı özel lokus (Şekil 1A). Bu şemada, iki farklı birey bir melez oluşturmak için ilk çiftleşirler, genomun yarısı ilgili ebeveynlerin her birinden gelir. Bu arka planda, her biri her bir ebeveynin lokus alelinin kesintiye uğramış veya silinmiş bir kopyasını içeren birden çok suş oluşturulur. Bu suşlar, genomun her yerinde diploid olarak kaldıkları için hemizygousdur, haploid olarak kabul edilirler ve her birinin sadece bir ebeveynin alelinden yoksun olduğu için karşılıklı olarak adlandırılırlar. diğer ebeveyn. Bu karşılıklı hemizygot suşlarının fenotiplerini karşılaştırarak, manipüle edilmiş çekirgedeki DNA dizivaryantlarının ilgi özelliğine katkıda bulunup bulunmadığı sonucuna varılabilir, çünkü çekirgedeki varyantlar karşılıklı lık arasındaki tek genetik farktır. hemizygot suşları. Bu şekilde, iyi kontrol edilen deneysel bir kurulumda türler arasındaki genetik farklılıkları, aralarındaki henotipik farka bağlamak mümkündür. Bugüne kadar bu testin uygulamaları bir aday-gen çerçevesinde olmuştur-yani hipotez zaten bir aday locus doğal varyasyon bir özellik etkileyebilecek elinde olduğu durumlarda.

Aşağıdaki ler de, mayayı model sistem olarak kullanarak genom ölçeğinde karşılıklı hemizygosity ekran protokolünü ortaya koyuyoruz. Yöntemimiz, türler arasında canlı, steril F1 melezleri üreterek ve transpozon mutagenezine maruz bırakarak hemizygot mutantlarının genomik bir tamamlayıcısını oluşturur. Hemizygotları bir araya, sıralamaya dayalı tahlillerde fenomenotipleri ölçer ve belirli bir genin iki ebeveyninin alellerini taşıyan havuzun klonları arasındaki frekans farklılıklarını test ediyoruz. Sonuç, türler arasındaki varyantların ilgi çekiciliğini etkilediği loci kataloğudur. Biz iki tomurcuklanan maya türleri arasındaki termotolerans farklılıklarıgenetik temelini açıklamak için RH-seq iş akışı uygulamak, Saccharomyces cerevisiae ve S. paradoksus, hangi ~ 5 milyon yılönce6 farklı .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transformasyon için piggyBac içeren plazmid hazırlanması

  1. Bir LB + carbenicillin agar plaka üzerine plazmid pJR487 barındıran E. coli suşu tek koloniler için çizgi. 37 °C'de veya tek koloniler ortaya çıkana kadar 1 gece kuluçkaya yatırın.
    NOT: Plazmid pJR487'nin nasıl klonlandığının bir açıklaması önceki çalışmamızda bulunabilir3.
  2. 1 L LB + carbenicillin 100 μg/mL'de, 2 L cam şişede pJR487 içeren tek bir E. coli kolonisi ile aşılayın. Doymuş (OD600 ≥ 1.0) kadar 200 rpm sallayarak 37 °C'de bir gecede büyüyün.
  3. Üreticinin yayınlanan protokolünde belirtildiği gibi büyük ölçekli plazmid hazırlık kiti kullanarak kültürden plazmid DNA arındırın (ayrıntılar için Malzeme Tablosu'na bakınız). 5 mL elüsasyon tamponu ile 10 dakikalık bir kuluçkadan sonra DNA'yı 37 °C'ye ısıtın.
  4. Plazmid DNA'sının miktarını ve kalitesini bir spektrofotometre ile ölçün (ayrıntılar için Malzeme Tablosu'na bakın).
  5. Tekrar adımları 1.2 – 1.4 kadar en az 11 mg plazmid DNA toplam bir A260:A280 oranı en az 1.8 izole edilir. Bu, verimliliğe bağlı olarak birkaç hazırlık alabilir.
  6. Tüm plazmid hazırlıklarını tek bir tüpte karıştırın ve toplam hacmi 20 mL'ye kadar elüsasyon tamponu veya su ile getirin. Son miktarı ve kaliteyi tekrar spektrofotometre ile ölçün. Plazmid konsantrasyonu bu son 20 mL hacimde en az 538 ng/μL olmalıdır. Konsantrasyon 538 ng/μL'den yüksekse, plazmidi elüsyon tamponu veya su ile 538 ng/μL'ye seyreltin. Plazmid kullanıma kadar birkaç hafta ya kadar 4 °C'de saklanabilir.

2. Hedeflenmemiş genom çapında karşılıklı hemizygotlardan oluşan bir havuz oluşturma

  1. Dönüşüm için hibrid maya hücrelerinin hazırlanması
    1. -80 °C'lik dondurucu stokundan YPD agar plakalı tek kolonilere JR507'yi çıkarın. 26 °C'de 2 gün veya koloniler ortaya çıkana kadar kuluçkaya yatırın.
      NOT: JR507, S. cerevisiae DBVPG1373 ve S. paradoxus Z1 (tetrad-diseksiyon mikroskobukullanılarak)haploid sporlarının tek hücreli çiftleştiği melez bir suşudur 3 .
    2. 100 mL likit YPD'yi 250 mL'lik cam şişede, tek bir JR507 kolonisi ile incele ve 28 °C,200 rpm'de 24 saat veya sabit faza ulaşıncaya kadar çalkalayın.
    3. Ertesi gün, bir gecede kültürün 600 nm (OD600)optik yoğunluğunu ölçün. Taze sıvı YPD ile bir gecede kültürünün bir kısmını 0,2'lik bir OD600 ve 500 mL'lik bir hacme yeni 1 L cam şişeye dönüştürerek yeni bir kültür oluşturun.
      NOT: Bir gecede kültürde C'nin optik yoğunluk ve V'nin hacim olduğu 5.0'lık OD600 varsa, geri seyreltmenin örnek hesaplanması:
      Equation 1
      Böylece, 0,2 OD 600'de toplam 500 mL kültür yapmak için 480 mL sıvı YPD'ye 20 mL doymuş bir gecede kültür eklenecek.
    4. Dört yeni kültür için aynı gece kültürünü kullanarak, 4 yeni kültür için aynı gece kültürünü kullanarak, bir OD600 0.2 dört 1 L cam şişeleri toplam yapmak için adım 2.1.3 üç kez daha tekrarlayın. 28 °C'de 200 rpm'de 6 saat (2-3 nesil) titreyerek kuluçkaya yat.
    5. 1 L kültürü oluşturmak için 500 mL kültüründen ikisini birleştirin. Kalan iki 500 mL kültürü birleştirerek başka bir 1 L kültürü oluşturun. Bu noktada, iki 1 L kültürleri vardır. Bu 1 L kültürlerin her biri aşağıdaki adımlarda pJR487 ile dönüşüme tabi olacaktır.
  2. PJR487'nin hibrid maya hücrelerine dönüştürülmesi
    1. Toplam 40 tüp için 20 plastik konik tüplerde 1 L kültürlerin her birini 20 50 mL aliquots bölün. 20 tüpler ibir kenara koyun ve bir seferde 20 tüpler üzerinde aşağıdaki adımları gerçekleştirmek.
    2. Maya hücrelerini peletlemek için 1.000 x g 3 dk için yirmi tüplerin her biri santrifüj. Supernatant atın.
    3. Girdap ile sterilH2 O 25 mL ile her pelet resuspend. 1.000 x g3 dakika için santrifüj . Supernatant atın.
    4. Girdap ile 5 mL 1x TE, 0,1 M LiOAc tampon ile her pelet resuspend. 1.000 x g3 dakika için santrifüj . Supernatant atın.
    5. Adımı 2.2.4'e tekrarlayın. Hücreler santrifüj ederken, %39,52 polietilen glikol, 0,12 M LiOAc ve 1,2x Tris-EDTA tamponu (12 mM Tris-HCl ve 1,2 mM EDTA) çözeltisinin en az 120 mL'sini hazırlayın. Buzda saklayın.
    6. Plazmid DNA'sını dönüşüme hazırlamak için ilk olarak 100 °C'de 4 mL somon spermi DNA'sını 5 dk kaynatın ve hemen 5 dk buz üzerinde soğutun. Daha sonra, toplam 24 mL hacim için soğutulmuş somon sperm DNA'sının 4 mL'si ile 538 ng/μL konsantrasyonda 20 mL pJR487 (bölüm 1'de elde edilen) karıştırın. Kullanıma kadar buzda tutun.
    7. Her hücre peletinin üzerine somon spermi DNA'sı ile karıştırılmış 600 μL plazmid DNA'sı ekleyin. Henüz askıya alma.
    8. Her peletiçin adım 2.2.5'te yapılan 3 mL PEG-LiOAc-TE çözeltisini ekleyin. Yukarı ve aşağı boruve girdap tarafından pelet resuspend.
    9. Oda sıcaklığında 10 dakika boyunca her tüp kuluçka.
    10. Isı şoku her tüp için 26 dk bir su banyosu 39 °C ayarlayın.
      NOT: Birkaç dakikada bir, hücrelerin tüpün altına yerleşmesini önlemek için her tüpü ters çevirin.
    11. Santrifüj her tüp için 3 dakika 1.000 x g. Supernatant atın ve girdap tarafından YPD 10 mL her pelet resuspend. Yeni bir cam şişe içine tüm yirmi tüpleri birleştirin. Hücrelerin toplam hacmi ~200 mL olmalıdır.
    12. 66,6 mL'lik hücreyi yeni bir 1 L cam şişeye aktarın ve sıvı YPD ile 500 mL'lik bir hacme getirin. Dönüştürülmüş hücrelerin 200 mL'sinin tamamını kullanmak için iki kez daha tekrarlayın. Her yeni500 mL kültürün OD 600'ü ölçün (~0,35-4'ün OD600'ü bekleyin).
    13. 28 °C'deki üç şişeyi de 2saat boyunca sallayın ve 200 rpm'de (<1 nesil) toparlanın.
    14. Üç şişenin her birine 300 mg/mL G418'in 0,5 mL'sini ekleyin, 300 g/mL G418'lik son konsantrasyona ekleyin ve 28 °C, 200 rpm'de tekrar sallayın.
      NOT: Bu adımdan önce, dönüştürülmüş hibrit hücreler dönüşümden kurtarılıyor. G418'in eklenmesi üzerine plazmid pJR487'nin varlığı seçilir. Dönüşüm sırasında plazmid ihya olmayan hücreler ölmeye başlayacaktır.
    15. 2.2.2 – 2.2.14 adımlarını kalan 20 konik hücre yle tekrarlayın. Bu noktada g418 ile hücrelerin her biri 500 mL ile altı 1 L cam şişeleri olmalıdır.
    16. 28 °C'de altı hücre şişesini de kuluçkaya yatırın, 200 rpm'de sallayarak, yaklaşık 2 gün veya her şişede ~2.3'ün OD600'ü ulaşıncaya kadar. Tek bir kültür oluşturmak için altı şişeyi bir araya getirin.
      NOT: Bu kültürdeki tüm hücreler alt basamaklarda kullanılmasa da, bu kadar büyük hacimleri kullanmanın amacı mümkün olduğunca çok benzersiz dönüşüm olayı oluşturmak ve hepsini birleştirerek tek bir dönüşüm deki önyargıları normalleştirmekolmuştur. Birlikte.
    17. 2.2.16'da oluşturulan kültürü kullanarak 500 mL YPD + G418 (300 g/mL) ile 0,2'lik bir OD600'e sahip iki yeni 1 L şişeyi aşılamak için kullanın. Atılabilir artık kültür olacak.
    18. Her biri 28 °C'de 28 °C'de, her biri ~2.2 (~3.5 nesil) od600'e ulaşana kadar 200 rpm'de titreyerek her iki L şişeyi de kuluçkaya yatırın. Her iki kültürü de tek bir kültürde birleştirin ve birleşik kültürün OD 600'ünü tekrar ölçün.
      NOT: Bu noktada, kültür neredeyse tamamen plazmid pJR487 barındıran hücrelerden oluşmalıdır. Hücre popülasyonunun bir kısmında, PiggyBac transposon plazmidden genoma transpozit edilecektir. Ancak, transposaz sürekli ifade genotip ve fenotip arasındaki ilişkiyi gizlemek istiyorsunuz bir seçim sırasında transpozisyon yol açabilir. Sonraki birkaç adımın amacı, transposazın daha fazla ifade edilememesi için plazmidin varlığına karşı bir karşı seçim yapmaktır. Ortaya çıkan havuz, transpozon genoma entegre edilmiş veya olmayan hücrelerin bir karışımıdır, ancak sonraki haritalama adımları sırasında sadece transposon içeren hücreler tespit edilir. Transpozazın ifade edildiği dönüşümde, plazmid kodlaması kaybolmadan önce, mutagenez den sonra belirli bir klonun birden fazla transpozon ekleme ye sahip olma olasılığını yönetebilir. Bir seferde herhangi bir genin analizinde "ikincil" mutasyonlar olarak ortaya çıkan bunların sıklığı, mutagenez den sonra tanımlanmış sayıda koloninin dizilemesi, dna'larının birleştirilmesi ve bağımsız yerleştirme sayısının dizilimi ile tahmin edilebilir. havuzda pozisyonlar.
    19. Santrifüj bu kültürün 25 mL için 3 dk 1.000 x g. 25 mL'deki toplam OD600 birim hücre sayısını hesaplayın (aşağıdaki örnek hesaplamaya bakın). 1.85 OD600/mL'lik bir hücre süspansiyonu oluşturmak için yeterli H2O'da supernatant'ı atın ve yeniden askıya alın.
      NOT: Kombine kültürün OD600'ü 2.2 ise, sudaki hücrelerin yeniden askıya alınması için örnek hesaplama:
      Equation 2
      Yani, hücre kültürü 25 mL iplik ve supernatant atarak sonra, hücre ve su toplam hacmi getirmek için hücrelere yeterli H2O ekleyin ~ 29.7 mL (hücre pelet de bir hacim olacak beri, Az ekleyin 29.7 mL H2O).
    20. Cam boncuklar kullanarak, 5-FOA ile 12 büyük kare tam sentetik agar plakaları her üzerine suda resuspended hücrelerin plaka 1 mL. Her plakayı 28 °C'de 1-2 gün veya tabakta bir çim oluşturana kadar kuluçkaya yatırın.
    21. Küçük steril squeegees kullanarak, her 6 plaka hücreleri kazıyın ve steril su 35 mL ile bir tüp içine. Hücre ve su iki tüp toplam için diğer 6 plaka ile tekrarlayın. Tüm hücre süspansiyonlarını tek bir tüpte birleştirin. Boş olarak su kullanarak bu süspansiyonun OD600'ü ölçün. Hücrelerin OD600/mL konsantrasyonu 44.4 OD600 adet/mL su ile getirin. Deneyimlerimize göre transpozisyon verimliliği (URA-olan KAN+ hücrelerinin oranı ortalama %50'dir.
    22. Depolamak için hücrelerin -80 °C dondurucu stoklarının sayısını belirleyin. Her aliquot gelecekte tek bir deneme için kullanılabilir.
      NOT: Havuzun neslinin ne kadar zaman aldığı göz önüne alındığında, yanlışlıkla yanlış kullanım veya çoğaltma denemeleri gerçekleştirmek için birden çok şişe depolayın. 20-30 hisse senetleri makul bir sayıdır.
    23. Her dondurucu stoku 1 mL %10 DMSO'da 40 OD600 ünite hücre içerecektir. 100 μL DMSO'ya 900 μL hücre ekleyin. Oluşturulan toplam dondurucu stoku sayısı için tekrarlayın. Her biri -80 °C'de saklayın.

3. Karşılıklı hemizygotların havuzlu formatta seçilmesi

  1. -80 °C'lik dondurucudan oda sıcaklığında bölüm 2'den havuzlu karşılıklı hemizygotların tek bir aliquot'u çözülür.
    NOT: Aliquot'un çözüldükten sonra oda sıcaklığında uzun süre oturmasına izin vermeyin, hemen kullanın.
  2. 250 mL cam şişede 150 mL sıvı YPD aşılamak için 1 mL aliquot'un tamamını kullanın. Bu kültürün OD600'ü ölçün ve 28 °C'de kuluçkaya yatarak 200 rpm'de , ~7 saat veya kültür 2-3 popülasyon iki katına geçene kadar titreyin. Bu noktada, kültür seçim dengelenen kültürleri aşılamak için kullanılmaya hazırdır.
    NOT: Örnek hesaplama: Orijinal şişenin OD600'ü 0,25 ölçülerindeyse, kültürü en az 1,0'lık Bir OD600'e ulaşana kadar kuluçkaya yatırın. Seçimden önce hemizygot popülasyonunun araştırılması için "Time-zero" (T-0) noktasında herhangi bir örnek nokta isteniyorsa, hücre peletleri 3 dk için 1.000 x g'da pelet başına 5-10 mL kültür santrifüj edilerek alınabilir ve -80 °C'de donma.
  3. Hem yüksek sıcaklıkta (39 °C) hem de izin verilen sıcaklıkta (28 °C) uygun bir çoğaltma şemasında kültürleri aşılamak için yetiştirilen hemizygot havuzunu kullanın. En azından, her sıcaklıkta toplam altı seçim kültürü için üç biyolojik çoğaltma seçim kültürü ayarlayın.
    1. Sıvı YPD'li 2 L cam şişede toplam 500 mL ile her seçim kültürünü oluşturun ve 0,02'lik Bir OD600'e inoküle. Her seçim kültürünü 28 °C veya 39 °C'de 6-7 popülasyon iki katına çıkana kadar (~1.28-2.56'nın OD 600'üne karşılık gelen)100 rpm'de sallayın. Tüm seçim kültürlerin son OD600 mümkün olduğunca yakından maç deneyin.
      NOT: 28 °C'deki seçim kültürleri 39 °C'deki seçim kültürlerine göre daha hızlı büyüyecektir. Sonuç olarak, 39 °C'deki seçim kültürleri kuvözde daha uzun bir süre geçirecekler. Kuvözde geçirilen toplam saat sayısına bakılmaksızın, hazır hale gelen her şişeyle aşağıdaki adımları takip edin. Deneyimlerimize göre, 28 °C veya 39 °C'deki kültürlerin sırasıyla ~12 veya ~18 saat , ~2.0'lık bir OD'ye ulaşması gerekiyordu. Uzun seçimler küçük fitness efektleri yükselterek avantajı olabilir, ama aynı zamanda herhangi bir gen / alel transposon mutantlar arasında fitnesses son dağılımı içine gürültü tanıtmak istiyorsunuz ortaya çıkmak için de novo arka plan mutasyonları, izin. Bu nedenle bir RH-seq deneyinde seçim süresini sınırlamak önemlidir.
  4. Her seçim kültüründen hücre peletleri hasat. Kütüphane hazırlama ve sıralama için teknik çoğaltmalar olarak her seçim kültüründen bu birimin en az dört pelet için 1.000 x g 1.000 x g hücre ve santrifüj 7 OD600 birim elde etmek için gerekli hacmi hesaplamak (bölüm 4 ve 5 bakınız , aşağıda). Supernatant atın ve -80 °C'de saklayın.
    NOT: Bir seçim şişesinde 2.0'ın son OD600'ü varsa örnek:
    Equation 3

4. Transposon mutant hemizygotların bolluğunu belirlemek için Tn-seq kütüphane inşaatı ve Illumina sıralama

  1. Bölüm 3'teki her hücre peletinin buzüzerinde çözülmesi.
  2. Üreticinin talimatları doğrultusunda bir maya gDNA saflaştırma kiti kullanarak her hücre peletinden toplam genomik DNA'yı (gDNA) izole edin. 50°L'lik elüsyon tamponu ndaki DNA'yı 65 °C'ye ısıtın.
  3. Bir florimetre kullanarak her pelet gDNA miktarını ölçün. Aşağıdaki yordamı kullanarak Tn-seq için yeni nesil bir sıralama (NGS) kitaplığı oluşturmak için her hücre peleti için gereken minimum toplam gDNA miktarı 1 μg'dir.
    NOT: Bir kütüphane oluşturmak için 1 μg'den az gDNA kullanılabilir, ancak kütüphanenin son miktarı ve kalitesi zarar görecektir.
  4. Tn-seq kitaplıkları oluşturmak için kurulmuş bir protokolü izleyin7. Bu protokole özgü aşağıdaki alakalı bilgilere dikkat edin:
    1. GDNA kesme, son onarım ve adaptör ligasyonundan sonra, transpozon içeren gDNA'yı PCR ile yükseltin. Bu PCR için, PiggyBac transposon ve NGS bağdaştırıcıları için özel olan aşağıdaki ileri ve geri astarı kullanın:
      İleri (N – rastgele nükleotit)
      5' ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
      CTCTTCCGATCTNNNNNaGCAATATTCAAGAATGCATCGTCAAT 3'
      Ters (Ns'nin uzantısı çoklama için kullanılan benzersiz bir 6 bp indeksini temsil eder. Endeksler hakkında daha fazla bilgi için aşağıya bakın)
      5' CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAG
      ACGTGTGCTTCCGATCT 3'
    2. Son kitaplıktaki klonlanmış parçaların eşlenebilir genomik diziyi içermeyecek kadar kısa olmasını en aza indirmek için boyut seçici boncuklarla birlikte dahil edilen temizleme adımlarını kullanın.
      NOT: Seçim kültürleri için bugüne kadar minimum çoğaltma gerekliliklerini takip ettikten sonra, sıralama için 24 ayrı gDNA örneği verilecektir. Sıralama için geçerli maliyet göz önüne alındığında, her bir örneğin kendi başına çalıştırılması olası değildir. Örnekleri aynı şeritte birleştirmek için, her biri benzersiz 6 baz çifti dizini olan birden çok ters astar oluşturun. Farklı indekslere sahip örnekler aynı sıralama şeridinde birleştirilebilir ve daha sonra hesaplamalı olarak ayrılabilir.
  5. Sıra tek uçlu 150 bp sekiz şeritte NGS teknolojilerini kullanarak her kütüphaneden okur.
    NOT: Gerekli sıralama okuma miktarı büyük ölçüde bir önceki adımda hazırlanan kütüphanelerin kalitesine bağlıdır (yani kütüphanedeki DNA'nın gerçekte transpozon DNA içeren oranı, karşılıklı hemizygotlardan gelen DNA'yı temsil eder). Buna katkıda bulunan iki ana faktör vardır. İlk olarak, entegre transpozonsuz hücreler havuz oluşturma sırasında karşı seçilmediğinden, her kültür transposon lu ve transposonsuz hücrelerin bir karışımı olacaktır. İkinci olarak, transpozon içeren karşılıklı hemizygotların genomları içinde bile, genomun çoğu dizi içeren transpozon değildir ve bu gDNA kaçınılmaz olarak kütüphane hazırlığının bir parçası olacaktır. Transposon içeren DNA'nın son PCR amplifikasyonunun amacı, transposon içeren DNA'nın bu iki arka plan gDNA kaynağına oranını artırmaktır. Bu amplifikasyon ne kadar verimli yse, okuma oranı ne kadar yüksekse, akış aşağı analizinde de kullanılabilir. Kitaplıklar ne kadar düşük kalitede yse, okumaların artan bir oranı transpozon DNA içermediğinden ve yararlı olmayacaktır. Yukarıdaki kısıtlamalar göz önüne alındığında, sıralama sekiz şeritli makul bir dereceye kadar karşılıklı hemizygot bolluk izleme yeteneğine sahip idi. Daha fazla sıralama daha derin bir analiz sağlayacaktır.

5. Transposon eklemelerin ve RH-seq analizinin yerlerinin haritalaması

NOT: Aşağıdaki veri çözümlemesi özel Python komut dosyalarıyla (https://github.com/weiss19/rh-seq'de çevrimiçi olarak bulundu) gerçekleştirilmiştir, ancak diğer komut dosyası dilleri kullanılarak yeniden yapılabilir. Aşağıda, işlemdeki önemli adımlar özetlenmiştir. Bunları birleştirmek için belirtilmedikçe her bir çoğaltma okuma dosyası üzerinde aşağıdaki adımları gerçekleştirin.

  1. Adaptör dizilerini okumalardan ayırın ve her çoğaltmanın okumalarını dizine göre ayırın.
  2. Transpozon-genom bağlantıları içeren okumaları bulun. Bunu başarmak için, transposon, CAGACTATCTTTCTAGGGTTAA son 20 baz çiftleri için her okuma içinde arama. Bu sırayı içermeyen tüm okumaları atın.
    NOT: Deneyimlerimize göre, transposon sonuna kadar okuma haritalama oranı% 83-95 olduğunu.
  3. Kalan, transposon içeren okumaları, transposon'un 3' ucunun yalnızca aşağı akışını içerecek şekilde kırpın. Bu diziyi maya genomuna haritalayarak, her okuma için transpozon eklemenin genomik bağlamını belirleyin (aşağıdaki adım 5.4).
  4. Transposon'un dizisini S. cerevisiae DBVPG1373 x S. paradoxus Z1 hibrid genom (Komut dosyası adı: map_and_pool_BLAT.py) ile eşleştirmek için BLAT veya eşdeğer bir haritalama aracı kullanın.
    1. Transpozonun 3' ucunun aşağısında 50'den az baz çifti olan okumaları atın. Kısa dizileri benzersiz bir şekilde haritalamak zordur.
    2. BLAT kullanıyorsanız, aşağıdaki parametreleri kullanın: kimlik = 95, döşeme boyutu = 12.
    3. S. cerevisiae S288c ve S. paradoxus CBS432'nin referans genomlarının en son sürümlerini kullanarak haritalama için kullanılacak temel bir melez genom oluşturun.
      NOT: Melez genom daki genlerin genomik sınırlarını açıklayan temel bir ek açıklama dosyası yukarıda listelenen Github deposunda bulunabilir (Dosya adı: YS2+CBS432+plasmid_clean). Sadece hibrid genomda tek bir konuma hangi haritayı kullanır (yani S. cerevisiae veya S. paradoxus'a özgüdür). Genom boyunca ekleme olaylarının tek bir frekansı beklenmektedir; genomlar arasında ekleme pozisyonlarının dağılımı başka bir yerde bildirilmiştir3.
  5. Her bir transposon ekleme konumuna toplam okuma eşleme sayısını saymak, ki bunların hepsi tek bir transposon ekleme mutant klonunun hücrelerinden kaynaklanıyor. Tek bir kitaplıktaki tüm bu değerlerin toplamı, o kitaplık için eşlenen okumaların toplam sayısı olarak adlandırılır.
  6. Birbirinden 3 baz çifti içinde birden çok ekleme eşleme nin olduğu durumlarda, hepsini tek bir ekleme noktasına birleştirerek tüm okumaları en yüksek okuma sayısına sahip tek bir konuma atayın. Bu değer, neklemek, gDNA sıralı hücre pelet insertion klon bolluğu temsil eder. Bu noktada, neklemeklisteleri olacak , her benzersiz bir eşlenmiş transposon ekleme bolluğu, sıralı her hücre pelet için bir liste.
    NOT: PiggyBac transposon, 4 baz çifti dizisi olan genomdaki TTAA dizilerine yerleştirilir. Bu nedenle, eklemelerin birbirinden 3 baz çifti içinde eşleme aynı TTAA sitesinden gelmiş olması gerektiği ne var.
  7. Sıralı her kitaplıktan gelen toplam okuma sayısı biraz daha farklı olacağından, karşılaştırılmak üzere tüm dosyalardaki nekleme değerlerini normalleştirin. Bunu, her bir kitaplıktan, npeletteneşlenen okumaların toplam sayısını hesaplayarak yapın ve tüm kitaplıklar arasında tüm npeletinin ortalamasını alın, pelet>. Bir eklemeyi hesaplamak için tek bir kitaplığın verilerindeki her neklesini pelet> / npelet oranıyla çarpın, belirli bir transposon ekleme klonunun normalleştirilmiş bolluğu.
    Equation 4
    Alternatif olarak, kitaplık boyutu DESeq28 (Komut dosyası adı: total_reads_and_normalize.py) gibi kullanılabilir araçlar kullanılarak tahmin edilebilir.
  8. Tüm kitaplıklarda eşlenen tüm eklemeler kümesini toflate. Bazı kitaplıklarda bulunan ancak bazılarında bulunmayan eklemeler için, akış aşağı hesaplamaları için birekleme = 1 ayarlayın.
  9. Ek açıklama dosyasına göre genlerin içine giren eklemeleri bulmak için okumaları filtreleyin (Komut dosyası adı: remove_NC_and_plasmid_inserts.py).
  10. Her benzersiz ekleme için, her seçimin teknik kopyaları arasındaki ortalama bolluğu hesaplayın (her kültür 28 °C veya 39 °C'de), insert>teknik (Komut dosyası adı: combine_tech_reps_V2.py).
  11. Her benzersiz ekleme için, her sıcaklıkta biyolojik kopyalar arasında ortalama bolluğu hesaplayın,insert> toplam, her sıcaklıkta tüm insert>teknik ortalamaalarak. Aynı zamanda, her ekleme, CVekleme,toplam insert>teknik (Komut dosyası adı: combine_bio_reps.py) için varyasyon katsayısını hesaplayın.
    NOT: Bu noktada, her sıcaklık için, 28 °C ve 39 °C, benzersiz transpozon eklemeler listesi, bunların ortalama bolluk ve her biri için biyolojik çoğaltmalar arasındaki varyasyon katsayısı vardır. Denememiz için bu veriler başka bir yerde rapor edilir3.
  12. 28 °C veya 39 °C, insert>total > 1.1 ve CVekle,toplam ≤ 1.5 (Komut dosyası adı: filter_inserts.py) bulunanlar için tüm eklemelerin listesini filtreleyin.
  13. Her benzersiz ekleme için günlük2'yi (insert>total,28 °C / insert>total,39 °C)hesaplayın. Bu değer, belirli bir transposon ekleme mutant klon "termotolerans" temsil eder (Script adı: fitness_ratios.py).
  14. Tüm benzersiz eklemeleri gen ve alel(S. cerevisiae veya S. paradoxus)göre sıralayın ve her aleldeki ekleme sayısını ayıklayın. Filtreler genleri, yalnızca her alelde en az 5 ekleme içeren genler analiz edilebilsin (Komut dosyası adı: organize_and_filter_genes.py).
    NOT: Her alel arasında birden fazla benzersiz eklemeler, karşılıklı hemizygotun termotoleransının daha doğru bir ölçüsünü sağlar. Alel başına gerekli ekleme sayısını düşürmek mümkündür, ancak bu ölçünün doğruluğunu tehlikeye atacak ve daha fazla genin test edilmesine izin vererek çoklu test yükünü artıracaktır. Ayrıca, alel başına çok az ekleme ile genlerin filtreleme çok farklı bir fenotip confers ikincil bir site mutasyonu barındıran herhangi bir bireysel hemizygot klon test sonuçları üzerindeki etkisini azaltmaya yardımcı olacaktır.
  15. Yukarıdaki filtrelemeden sonra veri setinde kalan her gen için, S. cerevisiae alelindeki tüm eklemelerin termotoleranslarını (günlük2 oranları) Mann-Whitney U testi kullanarak S. paradoksal aleldekilerle karşılaştırın. Alternatif olarak, DESeq28 'den uyarlanmış bir regresyon modeli uygulanabilir (Komut dosyası adı: mann_whitney_u.py).
  16. Benjamini-Hochberg yöntemini kullanarak birden fazla test için doğru p-değerleri.
  17. Önemli pdeğerine sahip genler (örneğin≤ 0.01) iki tür arasındaki termotolerans farklılıkları için önemli genler için adaydır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

S. cerevisiae ve S. paradoxus'u, transpozon mutagenezine maruz kaldığımız steril bir melez oluşturmak için çiftleştik. Her mutajenize klon bir hemizygot, bir genin bir alel inin bozulduğunu diploid bir melez (Şekil1A, Şekil 2). Hemizygotes'i 39 °C'de ve kontrol olarak ayrı bir deneyde 28 °C'de (Şekil1B)olarak birbirleriyle yarıştık ve her kültürden DNA izole ettik. Her hemizygotun uygunluğunu bildirmek için, DNA'nın parçalandığı ve adaptörlere bağlandığı bir protokol kullanarak, transposon ekleme pozisyonlarının yükseltilmesi (Şekil1C)ile bolluğu toplu sıralama yoluyla ölçtük. Bu amplifikasyon için astarlar farklı ve daha az verimli ise, bu protokolde sağlanan, arka plan okumaları daha az kullanılabilir okuma yol açan ve fitness tahminlerinin doğruluğunu aşındıran, sıralama verileri baskın olacaktır. Benzer kalite sorunları, sıralama kitaplığı hazırlığına düşük DNA girdisinden kaynaklanabilir.

Bizim sıralama elde sonuçları ile, belirli bir gen için biz hemizygot iki sınıf hemizygotlar arasında iki sıcaklıkta hemizygot bollukları karşılaştırıldı: klonlar sadece S. cerevisiae alel vahşi tip ve fonksiyonel, ve klonlar sadece güvenerek S. paradoksus alel (Şekil 1D). Bu aşamada yapılan analizde, protokolün hesaplamalı işlem sonrası stratejisi takip edilmezse ve havuzda nispeten az transpozon mutantı bulunan genler analize dahil edilirse, istatistiksel güç düşecek ve önemli bir gen çağrısı meydana gelmez. Uygulamamızda, sekiz temizlik geninde güçlü sinyaltespit ettik (Şekil 3). Her durumda, yüksek sıcaklıkta hibrit tehlikeye büyüme de S. cerevisiae aleltransposon eklemeler (Şekil 3). Bu loci S. cerevisiae S. paradoxusayıran termotolerans özelliği aday belirleyicileri temsil etti. Başka bir yerde bildirilen ayrı deneylerde, mevcut protokol 3'ün kapsamı dışında standart transgenezyöntemleri ni kullanarak her sitedeki allelik varyasyonun etkisini doğruladık.

Figure 1
Şekil 1. RH-seq iş akışının şeması.
A. S. cerevisiae ve S. paradoxus (sırasıyla mavi ve sarı), ebeveynlerin genomlarının her birinin tek bir kopyasını içeren bir melez (yeşil) oluşturmak üzere çiftleştirilmiştir. Melez belirli bir lokus olarak, bir transposon ekleme (kara kutu) sırayla her türün alel bir hemizygot oluşturur, hangi ilgi çekirge dışında genomun geri kalanında diploid olan. Hemizygotlar arasında fenotiplerin karşılaştırılması, manipüle edilmiş lokustaki allelik varyasyonun fenotipik etkilerini ortaya koymaktadır. B. Belirli bir gen de birçok klonlar hemizygous arasında(YFG),bazı sıralama ile ölçülen olarak, rekabetçi kültürde diğerlerinden daha yüksek bolluk ulaşmak. C. Hemizygot havuzundan DNA kırpılır ve adaptörlere (kırmızı) bağlanır. Belirli bir klon için transpozon (tn, siyah) ve genom (mavi) arasındaki bağlantı transposon'a özgü astar (siyah ok ucu) ve adaptöre özgü astar (kırmızı ok ucu) ile güçlenir. Amplicon raporundan okuma sayıları sıralamak, popülasyondaki klonun uygunluğunu bildirir. D. Bir RH-seq geni vurmak için, hemizygotklonlarınoranı tabulating (y -eksen) yüksek sıcaklıkta rekabet sonrası belirli bir fitness sergileyen (x -eksen) iki genotyon sınıfları arasında çarpıcı bir fark ortaya koymaktadır: olanlar ile S. cerevisiae alelinde bir transposon ekleme (S. paradoksus alel kalan; sarı) ve S. paradoksus alel olanlar bozuldu (ve S. cerevisiae alel kalan; mavi). Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2. PiggyBac plasmid kaynaklı transposon ile genom çapında karşılıklı hemizygotlar bir havuz oluşturmak için seçim şeması.
PiggyBac plazmidi (pJR487), diploid hibrid S. cerevisiae DBVPG1373 x S. paradoxus Z1 (JR507) bir URA3-/- klonuna dönüştürülür. Plazmid veya transpozonun varlığı, KanMX kasetinin varlığını seçen G418'de büyüme yoluyla seçilir; hayatta kalanlar PiggyBac plazmidini almış ve/veya entegre bir transpozon barındıran hücrelerdir. Ikincisi olmayan hücreler URA3 kaseti varlığında toksik olan 5-FOA'da büyüme yoluyla seçilir. Dönüştürülmemiş melez URA3olduğundan -/-, Bu adımda ölecek tek hücreler hala bir URA3 kaset içeren PiggyBac plazmid, içeren olanlardır. Geriye genoma entegre edilmiş transpozon içeren melez mutant hücrelerden oluşan bir havuz kaldı. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3. Rh-seq tarafından haritalanan en iyi vuruşlar.
Her panel, RH-seq'dan belirtilen gen için RH-seq verilerini bildirir. Xekseni, 28 °C'deki benzer miktara göre 39 °C'de bir transpozon mutant klonunun bolluğunu raporlar. yekseni, çekirdekyoğunluğu tahmini olarak x'te bolluk oranını gösteren belirtilen aleldeki eklemeleri taşıyan tüm klonların oranını bildirir. Eklemeler için altta yatan okuma ve sayım verileri başka bir yerde rapor edilir3. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

RH-seq'nin önceki istatistiksel-genetik yöntemlere göre avantajları birkaç kat daha fazladır. Bağlantı ve ilişkilendirme analizinin aksine, RH-seq tek gen haritalama çözünürlüğü sağlar; bu nedenle, belirli bir türün bireyler iã§inde özellik deÄ iÅ imi ã§alıŠmalarının yanı sıra ara sırada farklı olma olasılÄ±Ä Ä±nın artırılmıŠolması bÃ1/4yÃ1/4k olasılıkla çne sÃ1/4r Ayrıca, genom çapında karşılıklı hemizygosity analizi önceki girişimleri gen deletion mutantların koleksiyonları kullanılan, bazıları yanlış pozitif sonuçlara yol açabilir ikincil mutasyonlar liman9,10. RH-seq stratejisi, her gende birçok hemizygot mutant üreterek ve fenotipleyerek bu sorunu bir kenara iter, böylece herhangi bir mutant klonunun arka planı nihai sonuca sadece marjinal olarak katkıda bulunur. Prensip olarak, RH-seq de kodlamayan loci çalışma göze, mevcut çalışmada biz genler üzerinde duruldu rağmen.

RH-seq için birkaç tuhaflıklar vardır, bazı biyolojik ve bazı teknik, başarılı bir uygulayıcısı yaklaşımın yarar maksimize etmek ve en iyi sonuçlara giden yolu hızlandırmak için ön ele alacak. Biyolojik olarak, RH-seq sadece iki hedef tür genetik olarak manipüle edilebilir istikrarlı, canlı bir melez oluşturmak için çiftleştirilebilir eğer bir teknik olarak mantıklı. Bu nedenle, rh-seq'nin türlere uygulanmasını o kadar farklı ki karyotipik olarak stabil bir diploide dönüşemeyecek kadar farklı bir şekilde uygulayamayız. Öte yandan, diploid meleziki ebeveyn DNA düzeyinde çok benzer ise, transposon ekleme sıralama en okur alel-özellikle iki ana genomsadece birine eşlenen olamaz ve kullanılamaz olacak; böylece, belirli bir RH-seq deneyi en başarılı zaman anne yüksek kaliteli referans genomlar mevcut ve dizi sapma bir "tatlı nokta" isabet olacaktır. Ayrı bir bakış açısı olarak, ana türler arasındaki bir özellik farkının genetik temelini incelemek için formüle edilmiş bir RH-seq projesi göz önüne alındığında, sonuçlar, ilgi özelliği için, melezin biyolojisi ebeveynlerin makul bir temsilcisi. Melez (heterozis) benzersiz aşırı fenotipler etkilemek veya ebeveynler arasında farklılık olarak fenotip altında yatan ilgi genlerinin etkilerini gizlemek olabilir. Karşılıklı hemizygosity analizi ile eşlenen genler safkan ana türlerin genetik arka planlarında bağımsız alel takas deneyleri ile doğrulanmalıdır.

Rh-seq deneyindeki teknik sorunlara gelince, deneyimlerimiz çeşitli potansiyel gürültü kaynaklarını vurgulamış ve uygulanabilir çözümler sağlamıştır. Gürültü, belirli bir genin belirli bir alelinde transpozon eklemeleri barındıran hemizygotların sıralamaya dayalı uygunluk tahminleri arasında anlaşmazlık olarak tezahür eder. Bu transpozon mutantların arka planlarında farklı ikincil mutasyonlar türetilmiştir (aşağıya bakın); farklı ekleme sitelerini yükselten PCR'nin verimliliğindeki değişkenlik; belirli bir mutantın toplu havuzda düşük temsili, hassasiyeti zayıflatan düşük sıralama kapsamına yol açan; ve gen içinde transpozon ekleme pozisyonundaki farklılıklar (örneğin, transpozonlar 3' gen ucunda ekleme minimal henotik etkiye sahip olabilir). Tüm bu nedenlerden dolayı, çok büyük transpozon mutant havuzları oluşturmayı ve son tahlilde, iki alelin her birinde makul sayıda mutant olmadan herhangi bir geni test etmeyi hariç tutmanın kritik olduğunu düşünüyoruz. Biz, biz burada uygulanan olmasa da, bir barkodlu transposon sistemi7 daha PCR önyargı sorunları çözmeye yardımcı olabilir ve maliyet ve bir RH-seq deney emek azaltmak unutmayın.

Sonuç olarak, RH-seq için basit bir iş akışı oluşturduk ve yaklaşımın uyarılarını belirledik. Biz ikinci önemli ölçüde RH-seq yarar ödün vermez bulmak; genetik varyasyonun yüksek çözünürlüklü, genom ölçekli diseksiyonu için büyük bir umut vaat ettiğini düşünüyoruz, milyonlarca yıldır üreme yle izole edilmiş türler arasındaki farklılıklar da dahil olmak üzere.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

J. Roop, R. Hackley, I. Grigoriev, A. Arkin ve J. Skerker'e orijinal çalışmaya katkılarından dolayı teşekkür ederiz, F. AlZaben, A. Flury, G. Geiselman, J. Hong, J. Kim, M. Maurer ve L. Oltrogge teknik yardım için, D. Savage mikroskoposkopi ile cömertliği için kaynaklar ve B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson ve A. Sasikumar; Biz de J. Dueber (Biyomühendislik Bölümü, UC Berkeley) PiggyBac plazmid için teşekkür ederiz. Bu çalışma R01 GM120430-A1 ve Abd Enerji Bölümü Ortak Genom Enstitüsü, Bir DOE Ofis Bilim Kullanıcı Tesisi RBB Için Toplum Sıralama Projesi 1460 tarafından desteklenmiştir. Sonuncusu tarafından yürütülen çalışma Sözleşme No altında ABD Enerji Bakanlığı Bilim Ofisi tarafından desteklenmiştir. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics