Mapeamento genético de diferenças de termotolerância entre espécies de levedura Saccharomyces via análise de Hemizygosidade recíproca em todo o genoma

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

O hemizygosity recíproco através de arranjar em seqüência (RH-Seq) é um método novo poderoso para mapear a base genética de uma diferença do traço entre a espécie. As associações de hemizygotes são geradas pela mutagenese do transposon e sua aptidão é controlada com o crescimento competitivo usando o sequenciamento elevado-ao longo. A análise dos dados resultantes identifica genes subjacentes à característica.

Cite this Article

Copy Citation | Download Citations

Weiss, C. V., Chuong, J. N., Brem, R. B. Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis. J. Vis. Exp. (150), e59972, doi:10.3791/59972 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Um objetivo central da genética moderna é entender como e por que os organismos no selvagem diferem no fenótipo. Até agora, o campo avançou pela maior parte na força de métodos do enlace e da Associação de mapeamento, que traçam a relação entre variações da seqüência do ADN e phenotype através da progêia de recombinação dos acasalamentos entre indivíduos de uma espécie. Essas abordagens, embora poderosas, não são bem adaptadas às diferenças de traço entre espécies reproductivamente isoladas. Aqui nós descrevemos um método novo para a dissecção genoma-larga da variação natural do traço que pode prontamente ser aplicada às espécies incompatíveis. Nossa estratégia, RH-Seq, é uma implementação de todo o genoma do teste de hemizygote recíproco. Nós aproveitamos-lo para identificar os genes responsáveis para o crescimento de alta temperatura impressionante da levedura Saccharomyces cerevisiae em relação à sua espécie irmã S. paradoxus. RH-Seq utiliza a mutagenese do transposon para criar um pool de hemizygotes recíprocos, que são seguidos então através de uma competição de alta temperatura através de arranjar em seqüência da elevado-taxa de transferência. Nosso fluxo de trabalho RH-Seq, conforme estabelecido aqui, fornece uma maneira rigorosa e imparcial de dissecar traços antigos e complexos no clado de levedura em brotamento, com a advertência de que o sequenciamento profundo intensivo em recursos é necessário para garantir a cobertura genômica para o mapeamento genético. À medida que os custos de sequenciamento caem, essa abordagem tem grande promessa para uso futuro em eucariontes.

Introduction

Desde o alvorecer do campo, tem sido um objetivo primordial na genética para entender a base mecanicista da variação entre os indivíduos selvagens. À medida que mapeamos o locus subjacente a uma característica de interesse, os genes emergentes podem ser de uso imediato como alvos para diagnósticos e drogas, e podem esclarecer os princípios da evolução. O padrão da indústria para este fim é testar para uma relação entre o genótipo e o phenotype através de uma população através do enlace ou da Associação1. Poderosos como essas abordagens são, eles têm uma limitação-chave-eles dependem de grandes painéis de descendência recombinante de cruzamentos entre indivíduos cruzar. Eles não são de uso no estudo de espécies que não podem acasalar para formar progên em primeiro lugar. Como tal, o campo teve pouca capacidade para dissecção imparcial de diferenças de traço entre espécies reproductivamente isoladas2.

Neste trabalho, relatamos os fundamentos técnicos de um novo método, RH-Seq3, para levantamentos em escala de genoma da base genética da variação de traço entre espécies. Esta aproximação é uma versão maciçamente paralela do teste recíproco do hemizygote4,5, que foi concebida primeiramente como uma maneira de avaliar os efeitos fenotípicos de diferenças alélicas entre dois fundos genetically distintos em um locus específico (Figura 1a). Neste esquema, os dois indivíduos divergentes são primeiro acasalados para formar um híbrido, metade de cujo genoma vem de cada um dos respectivos pais. Neste contexto, múltiplas cepas são geradas, cada uma contendo uma cópia interrompida ou excluída do alelo de cada pai do locus. Estas tensões são hemizygous desde que permanecem Diploid em toda parte no genoma exceto no locus do interesse, onde são considerados Haploid, e são referidos como recíproco desde que cada um não falta somente o alelo de um pai, com seu alelo restante derivado do outros pais. Comparando os fenótipos destas tensões recíprocas do hemizygote, uma pode concluir se as variações da seqüência do ADN no locus manipulado contribuem ao traço do interesse, desde que as variações no locus são a única diferença genética entre o recíproco cepas de hemizygote. Dessa forma, é possível vincular diferenças genéticas entre as espécies a uma diferença fenotípica entre elas em uma configuração experimental bem controlada. Até o momento, as aplicações deste teste foram em um quadro de genes candidatos, ou seja, casos em que a hipótese já está em mãos que a variação natural em um locus candidato pode impactar uma característica.

No que se segue, nós dispor o protocolo para uma tela de hemizygosity reciprocidade em escala de genoma, usando levedura como um sistema modelo. Nosso método cria um complemento genómico de mutantes hemizygote, gerando híbridos F1 viáveis e estéreis entre as espécies e submetendo-os à mutagenese de Transposon. Nós pool os hemizygotes, medimos seus fenótipos em arranjar em seqüência-baseou ensaios, e testamos para diferenças na freqüência entre clones da associação que carregam os dois pais ' alelos de um gene dado. O resultado é um catálogo de loci em que variantes entre as espécies influenciam o traço de interesse. Implementamos o fluxo de trabalho RH-Seq para elucidar a base genética de diferenças de termotolerância entre duas espécies de levedura brotamento, Saccharomyces cerevisiae e S. paradoxus, que divergiram ~ 5 milhões anos atrás6.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. preparação do plasmídeo contendo piggyBac para transformação

  1. Raia para fora às únicas colônias a tensão de E. coli que endireita o plasmídeo pJR487 em uma placa do agar da carbenicilina de lb +. Incubar por 1 noite no ° c 37 ou até que as únicas colônias apareçam.
    Nota: uma descrição de como plasmídeo pJR487 foi clonado pode ser encontrado em nosso trabalho anterior3.
  2. Inocular 1 L de LB + carbenicilina a 100 μg/mL com uma única colônia de E. coli contendo pJR487 em um balão de vidro de 2 l. Cresça durante a noite em 37 ° c com agitação em 200 rpm até saturado (OD600 ≥ 1,0).
  3. Purifique o DNA plasmídeo da cultura usando um kit de preparação de plasmídeo em grande escala conforme instruído no protocolo publicado pelo fabricante (consulte a tabela de materiais para obter detalhes). Elute o ADN após uma incubação de 10 minutos com 5 mL do amortecedor da eluição aquecido a 37 ° c.
  4. Meça a quantidade e a qualidade do ADN do plasmídeo com um espectrofotômetro (veja a tabela de materiais para detalhes).
  5. Repita os passos 1,2 – 1,4 até um total de pelo menos 11 mg de DNA plasmídeo a260: a280 proporção de pelo menos 1,8 são isolados. Isso pode levar alguns Preps, dependendo da eficiência.
  6. Misture todos os Preps do plasmídeo junto em um único tubo e traga o volume total até 20 mL com amortecedor ou água da eluição. Meça a quantidade e a qualidade finais outra vez com um espectrofotômetro. A concentração de plasmídeo deve ser de pelo menos 538 ng/μL neste volume final de 20 mL. Se a concentração for superior a 538 ng/μL, diluir o plasmídeo com tampão de eluição ou água para 538 ng/μL. Plasmídeo pode ser armazenado a 4 ° c até algumas semanas até o uso.

2. criando um pool de hemizygotes recíprocos genoma-largos unalvejados

  1. Preparação de células de levedura híbridas para transformação
    1. Raia para fora JR507 de uma tensão do estoque do congelador do ° c-80 às únicas colônias em uma placa do agar de YPD. Incubar a 26 ° c durante 2 dias ou até que as colônias apareçam.
      Nota: JR507 é uma cepa híbrida feita através de acasalamento unicelular de esporos haploides de S. cerevisiae DBVPG1373 e S. paradoxus Z1 (usando um microscópio de tetrad-dissecção)3.
    2. Inocular 100 mL de YPD líquido em um balão de vidro de 250 mL com uma única colônia de JR507 e agitar a 28 ° c, 200 rpm por 24 horas, ou até que a fase estacionária seja alcançada.
    3. No dia seguinte, medir a densidade óptica em 600 nm (OD600) da cultura overnight. Criar uma nova cultura de volta-diluindo alguns dos overnight cultura com líquido fresco YPD em um novo 1 L frasco de vidro para um OD600 de 0,2 e um volume de 500 ml.
      Nota: exemplo de cálculo de um back-diluição se a cultura durante a noite tem um OD600 de 5,0, onde C é a densidade óptica e V é o volume:
      Equation 1
      Assim, 20 mL de cultura saturada durante a noite seria adicionado a 480 mL de YPD líquido para fazer um total de 500 mL de cultura em um OD600 de 0,2.
    4. Repita a etapa 2.1.3 mais três vezes para fazer um total de 4 500 mL de culturas em um OD600 de 0,2 em quatro frascos de vidro de 1 L, usando a mesma cultura overnight para todas as quatro culturas novas. Incubar-os todos a 28 ° c por 6 horas (2-3 gerações) agitando a 200 rpm.
    5. Combine duas das culturas de 500 mL para criar uma cultura de 1 L. Combine as culturas de 2 500 mL restantes para criar outra cultura de 1 L. Neste ponto, há duas culturas de 1 L. Cada uma dessas culturas de 1 L estará sujeita à transformação com pJR487 nas etapas a seguir.
  2. Transformação de pJR487 em células de levedura híbridas
    1. Divida cada uma das culturas de 1 L em 70 mL de alíquotas em 20 tubos cônicos plásticos para um total de 40 tubos. Reserve 20 tubos e realize os seguintes passos em 20 tubos de cada vez.
    2. Centrifugue cada um dos vinte tubos para 3 min em 1.000 x g para pellet as células de levedura. Descarte o sobrenadante.
    3. Ressuspender cada pellet com 25 mL de H2O estéril por vortexing. Centrifugador por 3 min a 1.000 x g. Descarte o sobrenadante.
    4. Ressuscitar cada pellet com 5 mL de 1x TE, 0,1 M LiOAc tampão por vortexing. Centrifugador por 3 min a 1.000 x g. Descarte o sobrenadante.
    5. Repita o passo 2.2.4. Enquanto as células são centrifugação, prepare pelo menos 120 mL de uma solução de 39,52% polietileno glicol, 0,12 M LiOAc e 1,2 x tampão Tris-EDTA (12 mM Tris-HCl e 1,2 mM EDTA). Guarde no gelo.
    6. Para preparar o DNA plasmídeo para transformação, primeiro ferver 4 mL de DNA de esperma de salmão a 100 ° c por 5 min e resfriar imediatamente no gelo por 5 min. Em seguida, misture 20 mL de pJR487 (obtido na secção 1) a uma concentração de 538 ng/μL com os 4 mL de ADN de esperma de salmão arrefecido para um volume total de 24 mL. Mantenha no gelo até o uso.
    7. Adicionar 600 μL de DNA plasmídeo misturado com DNA de esperma de salmão em cima de cada pellet celular. Não ressuscitem ainda.
    8. Adicionar 3 mL de PEG-LiOAc-TE solução feita no passo 2.2.5 para cada pellet. Resuspend o pellet pipetando para cima e para baixo e vortexing.
    9. Incubar cada tubo por 10 min à temperatura ambiente.
    10. Choque de calor cada tubo para 26 min em um banho de água definido para 39 ° c.
      Nota: a cada poucos minutos, inverta cada tubo para evitar que as células se fixem na parte inferior do tubo.
    11. Centrifugar cada tubo durante 3 min a 1.000 x g. Descarte o sobrenadante e ressuscitem cada pellet em 10 mL de YPD por vortexing. Combine todos os vinte tubos em um novo balão de vidro. O volume total de células deve ser ~ 200 mL.
    12. Transferir 66,6 mL de células para um novo balão de vidro de 1 L e trazer até um volume de 500 mL com YPD líquido. Repita mais duas vezes para usar todo o 200 mL de células transformadas. Meça o OD600 de cada cultura 500 ml nova (Espere um OD600 de ~ 0.35-4).
    13. Agitar as três garrafas a 28 ° c durante 2 horas para recuperar (< 1 geração) a 200 rpm.
    14. Adicionar 0,5 mL de 300 mg/mL G418 a cada um dos três frascos, a uma concentração final de 300 μg/mL G418 e colocar de volta a agitar a 28 ° c, 200 rpm.
      Nota: antes desta etapa, as células híbridas transformadas foram se recuperando da transformação. Após a adição de G418, a presença do plasmídeo pJR487 é selecionada para. Todas as células que não tomam o plasmídeo durante a transformação começará a morrer.
    15. Repita os passos 2.2.2 – 2.2.14 com os restantes 20 tubos cônicos das células. Neste ponto deve haver seis frascos de vidro de 1 L, cada um com 500 mL das pilhas com o G418 adicionado.
    16. Incubar todos os seis frascos das pilhas em 28 ° c, agitando em 200 rpm, por aproximadamente 2 dias ou até que um OD600 de ~ 2,3 esteja alcangado em cada frasco. Combine todos os seis frascos juntos para criar uma única cultura.
      Observação: embora todas as células nessa cultura não serão usadas em etapas downstream, o objetivo de usar esses grandes volumes foi criar tantos eventos de transformação exclusivos quanto possível e normalizar qualquer vieses em uma única transformação, reunindo-os todos os Juntos.
    17. Use a cultura criada em 2.2.16 para inocular dois novos frascos de 1 L com 500 mL de YPD + G418 (300 μg/mL) para um OD600 de 0,2. Haverá restos de cultura que podem ser descartados.
    18. Incubar ambos os frascos de 1 L a 28 ° c durante a noite, com agitação em 200 rpm, até que cada um atinja um OD600 de ~ 2,2 (~ 3,5 gerações). Combine ambas as culturas em uma única cultura e medir o OD600 da cultura combinada novamente.
      Nota: neste ponto, a cultura deve ser quase inteiramente composta de células que abrigando plasmídeo pJR487. Em parte da população de células, a transposão de piggybac terá sido transposta do plasmídeo para o genoma pela peptídeo expressa fora do plasmídeo. No entanto, a continuação da expressão da peptídeo pode levar à transposição durante o curso de uma seleção, o que obscurecer a relação entre o genótipo e o fenótipo. O objetivo das próximas etapas é realizar uma contrseleção contra a presença do plasmídeo, para garantir que não haja mais expressão da transposase. O pool resultante é uma mistura de células com ou sem o Transposon integrado no genoma, mas apenas as células que contêm o Transposon são detectadas durante as etapas de mapeamento subsequentes. O tempo na transformação durante que o peptídeo é expressado, antes que a codificação do plasmídeo esteja perdida, pode governar a possibilidade que um clone dado após o mutagênese abriga mais de uma inserção do transposon. A frequência destes, que se manifestam como mutações "secundárias" na análise de qualquer um gene de cada vez, pode ser estimada por arraying um número definido de colônias após a mutagenese, em seguida, combinando seu DNA e seqüência-confirmando o número de inserção independente posições na piscina.
    19. Centrifugue 25 mL desta cultura por 3 min em 1.000 x g. Calcule o número de unidades de OD600 total de células que estão no 25 ml (consulte o cálculo de exemplo abaixo). Descarte o sobrenadante e ressuscitem o suficiente H2o para criar uma suspensão celular de 1,85 OD600/ml por vortexing.
      Nota: exemplo de cálculo para ressuscitura de células em água se OD600 de cultura combinada foi 2,2:
      Equation 2
      Assim, depois de girar 25 mL de cultura celular e descartar o sobrenadante, adicione o suficiente H2o para as células para trazer o volume total de células e água até ~ 29,7 ml (uma vez que o pellet celular também terá um volume, adicionar menos de 29,7 ml de h2o).
    20. Usando grânulos de vidro, placa de 1 mL de células de ressuscipended em água em cada um dos 12 grandes quadrados completos placas de agar sintético com 5-FOA. Incubar cada placa a 28 ° c por 1-2 dias ou até que um gramado se forma na placa.
    21. Usando pequenos squeegees estéreis, raspar as células de cada uma das 6 placas e em um tubo com 35 mL de água estéril. Repita com as outras 6 placas para um total de dois tubos de células e água. Combine todas as suspensões de células em um único tubo. Meça o OD600 desta suspensão, usando a água como um espaço em branco. Traga o OD600/ml de concentração de células para 44,4 OD600 unidades/ml com água. Em nossa experiência, a eficiência de transposição (a proporção de células KAN + que são URA-) é em média 50%.
    22. Determine o número de-80 estoques do congelador do ° c das pilhas para armazenar. Cada alíquota pode ser usada no futuro para um único experimento.
      Nota: dado o tempo que consome a geração do pool, armazene vários frascos em caso de uso indevido acidental ou para realizar experimentos replicados. 20-30 ações são um número razoável.
    23. Cada estoque de freezer conterá 40 OD600 unidades de células em 1 ml de DMSO de 10%. Adicionar 900 μL de células a 100 μL de DMSO. Repita o número total de estoques de freezer criados. Armazene cada um a-80 ° c para uso futuro.

3. seleção de hemizygotes recíprocos em um formato agrupada

  1. Descongelar do congelador-80 ° c uma única alíquota de hemizygotes recíprocos agrupados da seção 2 na temperatura ambiente.
    Nota: não deixe que a alíquota se sente por muito tempo à temperatura ambiente, uma vez que ele Thaws, usá-lo imediatamente.
  2. Use toda a alíquota de 1 mL para inocular 150 mL de YPD líquido em um balão de vidro de 250 mL. Meça o OD600 desta cultura, e incube então em 28 ° c, agitando em 200 rpm, por ~ 7 horas, ou até que a cultura tenha passado por 2-3 doublings da população. Neste ponto, a cultura está pronta para ser usada para inocular culturas submetidas à seleção.
    Nota: exemplo de cálculo: se o OD600 do frasco original mede 0,25, incubar a cultura até atingir um OD600 de pelo menos 1,0. Se todos os pontos da amostra são desejados no "tempo-zero" (T-0), como uma maneira de investigar a população do hemizygote antes da seleção, as pelotas da pilha podem ser tomadas agora centrifugando 5-10 mL da cultura por a pelota em 1.000 x g por 3 minutos, descartando o sobrenadante e congelamento a-80 ° c.
  3. Use a associação cultivada do hemizygote para inocular culturas para a seleção em um esquema replicado apropriado, na temperatura de alta temperatura (39 ° c) e permissiva (° c 28). No mínimo, configurar três culturas de seleção de replicação biológica em cada temperatura, para um total de seis culturas de seleção.
    1. Criar cada cultura de seleção com 500 mL total em um balão de vidro de 2 L com YPD líquido e inoculado para um OD600 de 0, 2. Agitar cada cultura de seleção em 100 RPM a 28 ° c ou 39 ° c até 6-7 duagações populacionais ocorreram (correspondendo a um OD600 de ~ 1,28-2,56). Tente combinar o mais próximo possível o OD final600 de todas as culturas de seleção.
      Nota: as culturas de seleção a 28 ° c crescerão mais rapidamente do que as culturas de seleção a 39 ° c. Conseqüentemente, as culturas da seleção em 39 ° c gastarão um período de tempo mais longo na incubadora. Prossiga com as etapas a seguir com cada balão à medida que ele se tornar pronto, independentemente do número total de horas gastas na incubadora. Em nossa experiência, as culturas em 28 ° c ou 39 ° c tomaram ~ 12 ou ~ 18 horas, respectivamente, para alcangar um OD de ~ 2,0. As seleções longas podiam ter a vantagem de amplificar efeitos pequenos da aptidão, mas igualmente permitem que as mutações do fundo de novo surjam, que introduziriam o ruído na distribuição final dos adequação através dos mutantes do Transposon em todo o um gene/alelo. Como tal, é importante limitar o tempo de seleção em um experimento RH-Seq.
  4. Coletar pelotas de células de cada cultura de seleção. Calcule o volume necessário para obter 7 OD600 unidades de células e centrifugar a 1.000 x g durante 3 min pelo menos quatro pellets deste volume de cada cultura de seleção como réplicas técnicas para preparação e sequenciamento de bibliotecas (ver secções 4 e 5 , abaixo). Descarte o sobrenadante e armazene em-80 ° c.
    Nota: exemplo se um balão de seleção tem um OD final600 de 2,0:
    Equation 3

4. TN-Seq construção da biblioteca e Illumina seqüenciamento para determinar a abundância de hemizygotes mutante Transposon

  1. Descongelar no gelo cada pelota da pilha da seção 3 que está indo ser seqüenciada.
  2. Isole o ADN genomic total (gDNA) de cada pelota da pilha usando um jogo da purificação do gDNA do fermento que segue as instruções do fabricante. Ressuscitem o DNA em 50 μL de tampão de eluição aquecido a 65 ° c.
  3. Quantifique a quantidade de gDNA de cada pellet usando um fluorímetro. A quantidade total mínima de gDNA exigida para cada pelota da pilha para criar uma biblioteca de sequenciamento da próxima geração (NGS) para TN-Seq usando o seguinte procedimento é 1 μg.
    Nota: menos de 1 μg de gDNA pode ser usado para criar uma biblioteca, mas a quantidade final e a qualidade da biblioteca sofrerão.
  4. Siga um protocolo estabelecido para criar bibliotecas TN-Seq7. Observe as seguintes informações relevantes que são exclusivas para este protocolo:
    1. Após a corte de gDNA, o reparo da extremidade e a ligadura do adaptador, amplificar o gDNA que contem o Transposon através do PCR. Para esse PCR, use o seguinte primer dianteiro e reverso, que são específicos para os adaptadores do transposon e do NGS de PiggyBac, respectivamente:
      Forward (N – nucleotídeo aleatório)
      5 ' ATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
      CTCTTCCGATCTNNNNNNAGCAATATTTCAAGAATGCATGCGTCAAT 3 '
      Reverse (o trecho de ns representa um índice 6-BP exclusivo usado para multiplexação. Veja abaixo mais informações sobre índices)
      5 ' CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAG
      ACGTGTGCTCTTCCGATCT 3 '
    2. Use as etapas de limpeza incluídas com grânulos seletivos de tamanho para minimizar a proporção de fragmentos clonados na biblioteca final que seria muito curta para incluir a sequência genômica mapeável.
      Observação: tendo seguido os requisitos mínimos de replicação até agora para culturas de seleção, haverá 24 amostras de gDNA individuais para seqüenciamento. Dado o custo atual para seqüenciamento, é improvável que cada amostra será executada por conta própria. Para combinar amostras na mesma pista, crie vários primers reversos, cada um com um índice de par de 6-base exclusivo. Amostras com índices diferentes podem ser combinadas na mesma pista de sequenciamento e separadas computacionalmente depois.
  5. Seqüência single-end 150 BP lê de cada biblioteca usando tecnologias NGS em oito pistas.
    Nota: a quantidade de seqüenciamento leituras necessárias depende fortemente da qualidade das bibliotecas preparadas na etapa anterior (ou seja, a proporção de DNA na biblioteca, na verdade, contendo DNA transposon, representando o DNA proveniente de hemizygotes recíprocos). Há dois fatores principais que contribuem para isso. Primeiramente, desde que as pilhas sem um Transposon integrado não são counterselected de encontro durante a criação da associação, cada cultura será uma mistura das pilhas com e sem o Transposon. Em segundo lugar, mesmo dentro dos genomas de hemizygotes recíprocos decontenção, a maioria do genoma não é Transposon que contem a seqüência, e este gDNA inevitavelmente fará parte da preparação da biblioteca. O objetivo da amplificação final do PCR do ADN decontenção-contendo é aumentar a relação de Transposon-contendo o ADN a estas duas fontes de gDNA do fundo. Quanto mais eficiente for essa amplificação, a maior proporção de leituras poderá ser utilizada na análise a jusante. Quanto menor a qualidade das bibliotecas, mais seqüenciamento precisará ser feito, uma vez que uma proporção crescente de leituras não conterá DNA de transposão e não será útil. Dadas as limitações acima, oito pistas de sequenciamento foram capazes de rastrear abundâncias de hemizygote recíprocas a um grau razoável. Mais sequenciamento permitiria uma análise mais aprofundada.

5. mapeando os locais de inserções de Transposon e análise de RH-Seq

Observação: a análise de dados a seguir foi realizada com scripts Python personalizados (encontrados on-line em https://github.com/weiss19/rh-seq), mas pode ser refeito usando outras linguagens de script. Abaixo, as principais etapas do processo são descritas. Execute as seguintes etapas em cada arquivo de leitura de replicação individual, a menos que seja observado para combiná-los.

  1. Aparar seqüências de adaptador fora de leituras e separar as leituras de cada repetição de acordo com o índice.
  2. Encontrar leituras contendo cruzamentos Transposon-genoma. Para fazer isso, procure dentro de cada leitura para os últimos 20 pares de base do transposon, CAGACTATCTTTCTAGGGTTAA. Descarte todas as leituras que não contenham essa sequência.
    Nota: em nossa experiência, a proporção de leituras mapeando para o final da Transposon é de 83-95%.
  3. Aparar as leituras restantes, contendo Transposon para conter apenas a sequência a jusante da extremidade 3 ' do transposon. Mapeando esta sequência para o genoma do fermento, determine o contexto genómico da inserção de Transposon para cada leitura (etapa 5,4 abaixo).
  4. Use BLAT ou uma ferramenta de mapeamento equivalente para mapear a sequência a jusante do transposão para o genoma híbrido s. cerevisiae DBVPG1373 x s. paradoxus Z1 (nome do script: map_and_pool_BLAT. py).
    1. Descarte todas as leituras para as quais há menos de 50 pares de base de sequência utilizável a jusante de 3 ' fim do transposon. Seqüências curtas são difíceis de mapear exclusivamente.
    2. Se utilizar BLAT, utilize os seguintes parâmetros: Identity = 95, tamanho do mosaico = 12.
    3. Criar um genoma híbrido básico a ser usado para mapeamento concatenando as versões mais recentes de genomas de referência de S. cerevisiae S288c e S. paradoxus CBS432.
      Nota: um arquivo de anotação básico descrevendo os limites genóricos de genes individuais em todo o genoma híbrido pode ser encontrado no repositório GitHub listado acima (filename: YS2 + CBS432 + plasmid_clean). Use somente leituras que mapeiam para um único local no genoma híbrido (ou seja, são exclusivas para S. cerevisiae ou S. paradoxus). Uma frequência uniforme de eventos de inserção em todo o genoma é esperada; a distribuição de posições da inserção através dos genomas é relatada em outra parte3.
  5. Tally o número total de leituras de mapeamento para cada local de inserção única transposon, que inferimos todos originados de células de uma única inserção Transposon clone mutante. A soma de todos esses valores de uma única biblioteca é conhecida como o número total de leituras mapeadas para essa biblioteca.
  6. Em casos onde há várias inserções de mapeamento dentro de 3 pares de base um do outro, combiná-los todos para um único ponto de inserção, atribuindo todas as leituras para o único local com a maior contagem de leitura. Esse valor, nInsert, representa a abundância desse clone de inserção no pellet de célula do qual o gDNA foi seqüenciado. Neste ponto, haverá listas de nInsert, cada uma a abundância de uma inserção de Transposon mapeada única, uma lista para cada pellet de células seqüenciado.
    Nota: as inserções do transposon de PiggyBac em seqüências de TTAA no genoma, uma seqüência do par da base 4. Assim, inferimos que o mapeamento de inserções dentro de 3 pares de base entre si deve ter origem no mesmo site da TTAA.
  7. Como haverá um número ligeiramente diferente de leituras totais provenientes de cada biblioteca seqüenciada, normalizar os valores nInsert em todos os arquivos se eles forem comparados. Faça isso tabulando o número total de leituras mapeadas de cada biblioteca individual, npellet, e tome a média de todos os npellet em todas as bibliotecas, < npellet>. Multiplique cada nInsert em dados de uma biblioteca individual pela razão de < npellet>/npellet para calcular umapastilha, a abundância normalizada de um determinado clone de inserção de Transposon.
    Equation 4
    Alternativamente, o tamanho da biblioteca pode ser estimado usando ferramentas disponíveis como DESeq28 (nome do script: total_reads_and_normalize. py).
  8. Tabulate o conjunto de todas as inserções mapeadas em todas as bibliotecas. Para inserções encontradas em algumas bibliotecas, mas não em outras, defina umInsert = 1 para cálculos downstream.
  9. Filtre as leituras para localizar as inserções que caem dentro de genes de acordo com o arquivo de anotação (nome do script: remove_NC_and_plasmid_inserts. py).
  10. Para cada inserção exclusiva, calcule a abundância média em réplicas técnicas de cada seleção (cada cultura a 28 ° c ou 39 ° c), < umainserção>técnica (nome do script: combine_tech_reps_V2. py).
  11. Para cada inserção única, calcule a abundância média através de réplicas biológicas de cada temperatura, < umapastilha>total, tomando a média de todos os < umapastilha>técnica a cada temperatura. Ao mesmo tempo, calcule o coeficiente de variação para cada inserção, inserção CV, total em toda a < umainserção>técnica (nome do script: combine_bio_reps. py).
    Nota: neste ponto, para cada temperatura, 28 ° c e 39 ° c, há uma lista de inserções de transposões únicas, sua abundância média e o coeficiente de variação entre repetições biológicas para cada um. Estes dados para o nosso experimento são relatados em outros lugares3.
  12. Filtre a lista de todas as inserções para aquelas que têm, a 28 ° c ou a 39 ° c, < umainserção>total > 1,1, e ainserçãodo CV,total ≤ 1,5 (nome do script: filter_inserts. py).
  13. Para cada inserção única, calcule o log2(< umapastilhatotal, 28 ° c /< aInsert >total, 39 ° c). Esse valor representa a "termotolerância" de um clone mutante de inserção de Transposon determinado (nome do script: fitness_ratios. py).
  14. Classifique todas as inserções exclusivas por Gene e por alelo (s. cerevisiae ou s. paradoxus), e tabular o número de inserções em cada alelo. Filtre genes para que apenas os genes que tenham pelo menos 5 inserções em cada alelo sejam analisados (nome do script: organize_and_filter_genes. py).
    Nota: as inserções originais múltiplas através de cada alelo permitem uma medida mais exata daquele hemizygote recíproco de thermotolerance. Reduzir o número de inserções exigidas por alelo é possível, mas comprometerá a precisão desta medida e aumentará a carga de testes múltiplos permitindo que mais genes sejam testados. Adicionalmente, filtrar genes com demasiado poucas inserções por o alelo ajudará a reduzir o impacto em resultados de teste de todo o clone individual do hemizygote que abrigue uma mutação secundária do local que confira um phenotype muito díspar.
  15. Para cada gene remanescente no conjunto de dados após a filtragem acima, compare as termotolerâncias (relações de log2 ) de todas as inserções no alelo s. cerevisiae àqueles no alelo s. paradoxus usando um teste U de Mann-Whitney. Alternativamente, um modelo de regressão pode ser implementado, adaptado de DESeq28 (nome do script: mann_whitney_u. py).
  16. Corrija os valores de ppara vários testes usando o método benjamini-Hochberg.
  17. Genes com valores de psignificativos (digamos, ≤ 0, 1) são candidatos a genes importantes para diferenças na termotolerância entre as duas espécies.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nós acoplamos s. cerevisiae e s. paradoxus para formar um híbrido estéril, que nós sujeitamos à mutagenese do transposon. Cada clone mutagenized era um hemizygote, um híbrido Diploid em que um alelo de um gene é interrompido (Figura 1a, Figura 2). Nós competimos os hemizygotes um contra o outro pelo crescimento em 39 ° c e, em uma experimentação separada como um controle, em 28 ° c (Figura 1b), e Nós isolamos o ADN de cada cultura. Para relatar a aptidão de cada hemizygote nós quantificamos a abundância através de sequenciamento em massa, utilizando um protocolo no qual o DNA foi fragmentado e ligado aos adaptadores, seguido pela amplificação das posições de inserção de Transposon (Figura 1C). Se os primers para esta amplificação forem distintos e menos eficientes do que os fornecidos no protocolo, as leituras de fundo predominarão nos dados de sequenciamento, levando a menos leituras utilizáveis e corroendo a exatidão das estimativas de condicionamento físico. Problemas de qualidade semelhantes podem resultar da baixa entrada de DNA na preparação da biblioteca de sequenciamento.

Com resultados na mão de nosso seqüenciamento, para um determinado gene nós comparamos abundâncias hemizygote nas duas temperaturas entre duas classes de hemizygotes: clones onde somente o alelo de S. cerevisiae era selvagem-tipo e funcional, e os clones que confiam somente no Alelo S. paradoxus (Figura 1D). Em análise nesta fase, se a estratégia de pós-processamento computacional do protocolo não for seguida e os genes com relativamente poucos mutantes de Transposon na piscina forem incluídos na análise, o poder estatístico cairá e nenhuma chamada genética significativa resultará. Em nossa implementação, detectamos forte sinal em oito genes de limpeza (Figura 3). Em cada caso, as inserções do transposon no alelo de S. cerevisiae no híbrido comprometeram o crescimento na alta temperatura (Figura 3). Estes Locus representaram determinantes do candidato do traço do termotolerância que distingue s. cerevisiae de s. paradoxus. Em experimentos separados relatados em outros lugares, validamos o impacto da variação alélica em cada local usando métodos padrão de transgénese além do escopo do protocolo atual3.

Figure 1
Figura 1. Esquema do fluxo de trabalho RH-Seq.
A . s. cerevisiae e S. paradoxus (azul e amarelo, respectivamente), são acasalados para formar um híbrido (verde) que contém uma única cópia de cada um dos genomas dos pais. Em um locus dado no híbrido, uma inserção do transposon (caixa preta) no alelo de cada espécie por sua vez cria um hemizygote, que seja diploid no descanso do genoma à exceção do locus do interesse. Comparando os fenótipos através dos hemizygotes revela os efeitos fenotípicos da variação alélicas no locus manipulado. B. através de muitos clones hemizygous em um determinado gene (yfg), alguns alcançam uma abundância mais elevada do que outro na cultura do competidor, como quantificada arranjando em seqüência. C. DNA de uma piscina hemizygote é cortado e ligado a adaptadores (vermelho). Para um determinado clone, a junção entre o Transposon (TN, preto) e o genoma (azul) é amplificada com um primer Transposon-específico (ponta de seta preta) e um primer adaptador-específico (ponta de seta vermelha). Seqüenciamento de contagens de leitura do relatório do amplicon a aptidão do clone na população. D. para um hit do gene RH-Seq, tabulando a proporção de clones de hemizygote (eixoy) exibindo uma determinada aptidão após a competição em alta temperatura (eixox) revela uma diferença marcante entre duas classes genotípicas: aqueles com uma inserção do transposon no alelo de s. cerevisiae (com o alelo de s. paradoxus restante; amarelo) e aqueles com o alelo de s. paradoxus interrompido (e alelo de s. cerevisiae restante; azul). Por favor clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2. Esquema de seleção para gerar um pool de hemizygotes recíprocos genoma-largos com o Transposon Plasmid-borne de PiggyBac.
O plasmídeo piggybac (pJR487) é transformado em um clone URA3-/- do híbrido diploide s. cerevisiae DBVPG1373 x s. paradoxus Z1 (JR507). A presença do plasmídeo ou do transposon é selecionada para através do crescimento em G418, que seleciona para a presença da gaveta de KanMX; os sobreviventes são as pilhas que tomaram acima do plasmídeo de PiggyBac e/ou abrigam um Transposon integrado. Células sem os últimos são selecionados contra o crescimento em 5-FOA, que é tóxico na presença da gaveta URA3 . Uma vez que o híbrido não transformado é URA3-/-, as únicas células que morrerão nesta etapa são aquelas que ainda contêm o plasmídeo piggybac, que contém uma gaveta URA3 . O que resta é um conjunto de células mutantes híbridas contendo o Transposon integrado no genoma. Por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3. Top Hits mapeados por RH-Seq.
Cada painel relata dados RH-Seq para o gene indicado de RH-Seq. O eixo xrelata o log2 da abundância de um clone mutante do transposon após a seleção em 39 ° c, relativo à quantidade análoga em 28 ° c. O eixo yrelata a proporção de todos os clones que carregam inserções no alelo indicado que exibiu a proporção de abundância no x, como uma estimativa de densidade do kernel. Dados de leitura e contagem subjacentes para inserções são relatados em outro lugar3. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

As vantagens do RH-Seq sobre os métodos estatísticos-genéticos precedentes são várias vezes. Em contraste com a análise do enlace e da associação, RH-Seq oferece a definição do mapeamento do único-gene; como tal, provavelmente será de utilidade significativa mesmo em estudos de variação de traço entre indivíduos de uma determinada espécie, bem como diferenças interespecíficas. Também, as tentativas precedentes na análise recíproca genoma-larga do hemizygosity usaram coleções de mutants do apagamento do gene, alguns de que abrigam mutações secundárias que podem conduzir aos resultados positivos falsos9,10. A estratégia RH-Seq evita este problema gerando e fenotipando muitos mutantes hemizygote em cada gene, por sua vez, de tal forma que o fundo de qualquer clone mutante individual contribui apenas marginalmente para o resultado final. Em princípio, RH-Seq também oferece o estudo de loci não-codificadores, embora no trabalho atual nos concentramos exclusivamente em genes.

Há algumas peculiaridades para RH-Seq, alguns biológicos e alguns técnicos, que um praticante de sucesso vai lidar com a frente para maximizar a utilidade da abordagem e acelerar o caminho para os melhores resultados. Biologicamente, o RH-Seq só faz sentido como uma técnica se as duas espécies-alvo podem ser acasaladas para formar um híbrido estável e viável que pode ser geneticamente manipulado. Assim nós não podemos prever a aplicação de RH-Seq à espécie tão divergente que não se fundem em um karyotipicamente estábulo diploid. De um lado, se os dois pais do híbrido diploid são demasiado similares a nível do ADN, a maioria lê do sequenciamento da inserção do transposon não pode ser alelo mapeado-especificamente a apenas um dos dois genomas do pai e será inutilizável; assim, um determinado experimento RH-Seq será mais bem-sucedido quando os pais tiverem genomas de referência de alta qualidade disponíveis e atingirão um "ponto doce" de divergência de sequência. Como um ponto de consideração separado, dado um projeto RH-Seq formulado para dissecar a base genética de uma diferença traço entre as espécies-mãe, os resultados são susceptíveis de ser muito mais interpretável quando, para o traço de interesse, a biologia do híbrido serve como um representante razoável do dos pais. Os fenótipos extremos originais ao híbrido (heterosis) podiam influenciar ou obscurecer os efeitos dos genes do interesse que subjacente o phenotype porque difere entre os pais. Todos os genes traçados através da análise recíproca da hemizygosity devem ser validados por experimentos independentes do alelo-swap nos fundos genéticos da espécie do pai do puro-sangue.

Quanto às questões técnicas em um experimento RH-Seq, nossa experiência destacou várias fontes potenciais de ruído e forneceu soluções viáveis. O ruído manifesta como desacordo entre as estimativas baseadas em sequenciamento da aptidão dos hemizygotes abrigando inserções de Transposon em um alelo dado de um determinado Gene. Isto pode derivar de mutações secundárias diferentes nos fundos de mutantes do transposon (veja abaixo); variabilidade na eficiência da PCR amplificando diferentes locais de inserção; baixa representação de um dado mutante no pool a granel, levando a uma baixa cobertura de sequenciamento que enfraquece a precisão; e as diferenças na posição da inserção do transposon dentro do gene (por exemplo, transposons que inserem em um 3 ' a extremidade do gene pode ter o efeito fenotípico mínimo). Por todas estas razões, consideramos crítico gerar piscinas mutantes de transposões muito grandes e, na análise final, excluir do teste de qualquer gene sem um número razoável de mutantes em cada um dos dois alelos. Nós anotamos que, embora nós não o implementamos aqui, um sistema de Transposon codificado7 poderia mais ajudar a resolver edições do viés do PCR e reduzir no custo e no trabalho de um experimento RH-Seq.

Em conclusão, estabelecemos um fluxo de trabalho direto para RH-Seq, e especificamos as advertências da abordagem. Nós achamos que este último não compromete significativamente a utilidade do RH-Seq; Consideramos que ele tem grande promessa de dissecção de alta resolução, em escala de genoma, das conseqüências fenotípicas da variação genética, incluindo diferenças entre espécies que foram reproductivamente isoladas por milhões de anos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Agradecemos a J. Roop, R. Hackley, I. Grigoriev, A. Arkin e J. Skerker por suas contribuições para o estudo original, F. AlZaben, A. FLURY, G. Geiselman, J. Hong, J. Kim, M. Maurer, e L. Oltrogge para assistência técnica, D. Savage por sua generosidade com microscopia recursos, e B. Blackman, S. Coradetti, A. Flamholz, V. Guacci, D. Koshland, C. Nelson, e A. Sasikumar para discussões; Agradecemos também a J. Dueber (departamento de bioengenharia, UC Berkeley) pelo plasmídeo PiggyBac. Este trabalho foi apoiado pelo R01 GM120430-a1 e pelo projeto de sequenciamento da Comunidade 1460 para o RBB no Instituto do genoma conjunto do departamento de energia dos EUA, uma facilidade de usuário do escritório de ciência da DOE. O trabalho conduzido por este último foi apoiado pelo escritório da ciência do departamento de energia dos E.U. o contrato no. DE-AC02-05CH11231.

Materials

Name Company Catalog Number Comments
1-2 plasmid Gigaprep kits Zymo Research D4204 The number of kits required depends on how efficient your preps are in each kit. This kit comes with 5 individual plasmid prep columns. Run 1 L of saturated E. coli culture through each prep column, as using more than 1 L per column can cause clogging of the prep filter, leading to low yield and poor quality DNA.
10X Tris-EDTA (TE) buffer (100 mM Tris-HCl and 10 mM EDTA) Any N/A Filter sterilize through a 0.22 μm filter before use.
1M LiOAc Any N/A Filter sterilize through a 0.22 μm filter before use.
300 mg/mL Geneticin (G418) Gibco 11811023
52% polyethylene glycol (PEG) 3350 Sigma 1546547 Dissolve in water and filter sterilize through a 0.22 μm filter before use. 1X trafo mix: 228 uL 52% PEG, 36 uL 1M LiOAc, 36 uL 10X TE buffer
Autoclaved LB liquid broth BD Difco 244620 Make LB liquid broth using your powder from any brand, and milliQ water. Autoclave it before use.
Carbenicillin stock in water (100 mg/mL) Any N/A Filter sterilize through a 0.22 μm filter before use.
Complete synthetic agar plates (24.1cm x 24.1cm) with 5-fluoroorotic acid (5-FOA) [0.2% drop-out amino acid mix without uracil or yeast nitrogen base (YNB), 0.005% uracil , 2% D-glucose, 0.67% YNB without amino acids, 0.075% 5-FOA] 5-FOA: Zymo Research, Drop-out mix: US Biological, Uracil: Sigma, D-glucose: Sigm), YNB: Difco 5-FOA: F9001-5, Drop-out mix: D9535, Uracil: U0750, D-glucose: G8270, YNB: DF0919
DMSO Any N/A
E. coli strain carrying pJR487 (CEN-/ARS+ piggyBac-containing plasmid) N/A N/A Request from Brem lab.
Hybrid yeast strain JR507 (S. cerevisiae DBVPG1373 x S. paradoxus Z1, URA-/URA-) N/A N/A Request from Brem lab.
Illumina Hiseq 2500 used for SE-150 reads
Large shaking incubators with variable temperature settings Any N/A
LB + carbenicillin agar plates (100 μg/mL) Agar: BD Difco Agar: 214010 Make LB agar plates as normal and add carbenicillin to 100 μg/mL before drying.
Nanodrop spectrophotometer Thermo Scientific ND-2000
Qubit Fluorimeter Thermo Scientific Q33240
Salmon sperm DNA Invitrogen 15632011
Water bath at 39°C Any N/A
Yeast fungal gDNA prep kit Zymo Research D6005
Yeast peptone dextrose (YPD) liquid media BD Difco Peptone: 211677, Yeast Extract: 212750 Add filter-sterilized D-glucose to 2% after autoclaving.
YPD + G418 agar plates (300 μg/mL) Agar: BD Difco Agar: 214010 Make YPD agar plates as normal and add G418 to 300 μg/mL before drying.
YPD agar plates Agar: BD Difco Agar: 214010

DOWNLOAD MATERIALS LIST

References

  1. Flint, J., Mott, R. Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics. 2, 437-445 (2001).
  2. Allen Orr, H. The genetics of species differences. Trends in Ecology and Evolution. 16, 343-350 (2001).
  3. Weiss, C. V., et al. Genetic dissection of interspecific differences in yeast thermotolerance. Nature Genetics. 50, 1501-1504 (2018).
  4. Stern, D. L. Identification of loci that cause phenotypic variation in diverse species with the reciprocal hemizygosity test. Trends in Genetics. 30, 547-554 (2014).
  5. Steinmetz, L. M., et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 416, 326-330 (2002).
  6. Scannell, D. R., et al. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus. G3 (Bethesda). 1, 11-25 (2011).
  7. Wetmore, K. M., et al. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 6, e00306-e00315 (2015).
  8. Love, M. I., Huber, W., Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 15, 550 (2014).
  9. Wilkening, S., et al. An evaluation of high-throughput approaches to QTL mapping in Saccharomyces cerevisiae. Genetics. 196, 853-865 (2014).
  10. Kim, H. S., Huh, J., Riles, L., Reyes, A., Fay, J. C. A noncomplementation screen for quantitative trait alleles in saccharomyces cerevisiae. G3 (Bethesda). 2, 753-760 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics