Rilevamento di trascrizioni di RNA di tipo 1 (HIV-1) di proteina antisenso (ASP) di immunodeficienza umana nei pazienti da parte di RT-PCR specifico di Strand

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Le forcine e i loop di RNA possono funzionare come primer per la trascrizione inversa (RT) in assenza di primer specifici della sequenza, interferendo con lo studio delle trascrizioni antisense sovrapposte. Abbiamo sviluppato una tecnica in grado di identificare l'RNA specifico del filamento, e l'abbiamo usata per studiare la proteina antisenso HIV-1 ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nei retrovirus, la trascrizione antisenso è stata descritta sia nel virus dell'immunodeficienza umana di tipo 1 (HIV-1) che nel virus T-linfotropico umano 1 (HTLV-1). Nell'HIV-1, il gene ASP della proteina antisenso si trova sul filamento negativo di env, nel fotogramma di lettura -2, che si estende per la giunzione gp120/gp41. Nell'orientamento del senso, l'estremità 3' del frame di lettura ASP aperto si sovrappone alle regioni ipervariabili gp120 V4 e V5. Lo studio dell'RNA ASP è stato ostacolato da un fenomeno noto come RT-self-priming, per cui le strutture secondarie dell'RNA hanno la capacità di innescare RT in assenza del primer specifico, generando cDNA non specifici. L'uso combinato dell'elevata denaturazione dell'RNA con primer inversi biotinylati nella reazione RT, insieme alla purificazione dell'affinità del cDNA su perline magnetiche rivestite di streptavidin, ci ha permesso di amplificare selettivamente l'RNA ASP nelle cellule T CD4, derivate da individui infettati da HIV-1. Il nostro metodo è relativamente a basso costo, semplice da eseguire, altamente affidabile e facilmente riproducibile. A questo proposito, rappresenta un potente strumento per lo studio della trascrizione antisenso non solo in HIV-1 ma anche in altri sistemi biologici.

Introduction

Il gene della proteina antisenso (ASP) è un telaio di lettura aperto (ORF) situato sul filamento negativo del gene dell'involucro (HIV-1) del virus dell'immunodeficienza umana, che si estende sulla giunzione gp120/gp411. Negli ultimi 30 anni, diversi rapporti hanno dimostrato che il gene ASP HIV è effettivamente trascritto e tradotto2,3,4,5,6,7,8,9. Anche se le trascrizioni antisense ASP sono state completamente caratterizzate in vitro, fino a poco tempo fa mancavano ancora informazioni sulla produzione effettiva di RNA ASP nei pazienti.

La sequenza di ASP è inversa e complementare all'ambiente di env. Questo rappresenta un ostacolo importante quando si tenta di rilevare le trascrizioni per ASP. I metodi standard di reazione a catena di trascrizione inversa (RT-PCR) utilizzano primer antisense specifici genici per sintetizzare DNA complementari (CDA) della polarità destra. Questo approccio, tuttavia, non consente di determinare l'orientamento (senso o antisenso) del modello di RNA iniziale, poiché le forcine o i loop di RNA possono innescare RT in entrambe le direzioni in assenza di primer10, un fenomeno noto come RT self-priming. La maggior parte degli investigatori ASP elude il problema dell'auto-priming RT utilizzando i primer contrassegnati con sequenze che non sono correlate all'HIV-111,12. Questa strategia, tuttavia, non elimina il verificarsi del fenomeno e può portare a potenziali riporti di cDNA non specifici nel PCR11.

Recentemente abbiamo sviluppato un nuovo saggio RT-PCR specifico del filamento per lo studio dell'RNA antisenso e l'abbiamo utilizzato per il rilevamento dell'RNA ASP in una coorte di sei pazienti affetti da HIV, come mostrato nella tabella 1. La procedura descritta di seguito è stata precedentemente pubblicata da Antonio Mancarella etal. Nel nostro protocollo, evitiamo la produzione di cDNA non specifici con un duplice approccio. In primo luogo, eliminiamo le strutture secondarie dell'RNA denimentando l'RNA ad alta temperatura (94 gradi centigradi), e in secondo luogo, invertiamo l'RNA ASP utilizzando un primer biotinylato specifico di ASP e purificando l'affinità-purificailo il cDNA risultante. Con questo approccio, siamo in grado di amplificare solo il nostro cDNA target, poiché altri prodotti RT non specifici sono o impedito di essere generati (denaturazione ad alta temperatura di RNA) o eliminati prima della PCR (purificazione dell'affinità).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Questo studio è stato approvato dall'Institutional Review Board del Centre Hospitalier Universitaire Vaudois (CHUV).

1. Infezione delle cellule mononucleari del sangue periferico (PBMC) con ceppo HIV-1HXB2

  1. Giorno 1: PBMC STIMULATION
    1. Isola i PBMC da un cappotto sano per i donatori.
    2. Contare e risospendere i PBMC a una concentrazione di 1x106/mL nel roswell Park Memorial Institute (RPMI) 1640 medio completo contenente 10% siero bovino fetale (FBS) e 1% penicilli in/streptomicina (R-10), con aggiunta di 50 U/mL di interleuche-2 (IL-2) e 3 fitoaemagglutina g/mL (PHA).
    3. Pipet su e giù e dividere le cellule in due piastre a sei pozzetti (3 mL di sospensione cellulare / bene).
    4. Incubare per 3 giorni a 37 gradi centigradi e il 5% di CO2.
  2. Giorno 3: PMC INFECTION
    NOTA: Utilizzare una delle due piastre come nel passaggio 1.1.3 come controllo negativo (non infettare queste cellule).
    AVVISO: Eseguire l'intera procedura in un laboratorio di biosicurezza di livello III (P3).
    1. Piscina PBMCc da una piastra in un tubo falco 50 mL e centrifugare a 300 x g per 10 min.
    2. Scartare il supernatante e risospendere nuovamente le cellule in 2,2 mL di R-10 contenenti 20 U/mL di IL-2 e 2 g/mL di polibrene.
    3. Scongelare le fiale contenenti il virus HIV-1HXB2 e aggiungere 1,8 mL di sospensione virale (0,376 ng/L) alle cellule.
    4. Incubare le cellule per 2 h a 37 gradi centigradi, ruotando delicatamente il tubo ogni 30 min.
    5. Centrifugare le cellule a 300 x g per 10 min.
    6. Eliminare il supernatante e risospendere nuovamente le cellule a 1x106/mL in R-10 contenente IL-2 (50 U/mL).
    7. Trasferire la sospensione cellulare su una piastra di 24 pozze ad una concentrazione di 1 mL/pozzo e incubare per 5 giorni a 37 e 5% CO2.
    8. Raccogliere 1 bene ogni giorno e trasferire le cellule a tubo da 1,5 mL (etichettato con il giorno dell'infezione).
      NOTA: prima della centrifuga, trasferire 150 l di sospensione cellulare in un tubo di citometria a flusso per il controllo della qualità dell'infezione da PBMCC (vedere il punto 1.3)
    9. Centrifugare i tubi a 400 x g per 10 min e scartare il supernatante.
    10. Congelare i pellet delle cellule a -80 gradi centigradi fino all'uso.
  3. Infezione PBMCs: controllo di qualità
    1. Per ogni giorno di infezione, raccogliere 150 l di PBC infetti e trasferirli in un tubo di citometria a flusso.
    2. Aggiungere 1 mL di salina con buffer fosfato (PBS) e centrifugare a 400 x g per 5 min.
    3. Scartare il supernatante e aggiungere 50 L di PBS contenente 1 OL L di Aqua live/dead dye (precedentemente diluito 1:10 con PBS).
    4. Incubare a 4 gradi centigradi per 15 min.
    5. Aggiungere 1 mL di PBS, centrifugare a 400 x g per 5 min, e scartare supernatante.
    6. Aggiungere 250 -L di soluzione di fissaggio/permeabilizzazione e incubare per 20 min a temperatura ambiente al buio.
    7. Aggiungere 1 mL di 1x Perm/Wash Buffer (10x soluzione di stock contenente sia FBS che saponindi diluito 1:10) e centrifugare a 400 x g per 5 min.
    8. Eliminare il supernatante e aggiungere 50 - L di PBS contenente HIV Gag p24 fluoresceinisonina (FITC) -emigito anticorpo (diluito 1:10).
    9. Incubare per 20 min a temperatura ambiente al buio.
    10. Aggiungere 1 mL di PBS, centrifugare a 400 x g per 5 min, e scartare il supernatante.
    11. Aggiungere 150 l di x CellFIX (soluzione di stock 10x contenente 10% formaldeide, 3,55% di metanolo, 0,93% acita di sodio diluito 1:10) e analizzare le cellule per citometria di flusso.

2. Stimolazione delle cellule T umane CD4 con anticorpi anti-CD3/CD28

  1. Isolare le cellule T CD4 dai PBMC di pazienti affetti da HIV-1 e donatori sani.
  2. Preparare il mix di anticorpi anti-CD3/CD28 umani diluindo anti-CD3 (1:100) e anti-CD28 (1:50) in PBS.
  3. Coprire una piastra di 48 pozzetti aggiungendo 200 l'una di miscela di anticorpi per bene ad un numero adeguato di pozzi e incubare a 37 gradi centigradi per 2 h.
  4. Aspirati la soluzione anticorpale e aggiungete 1 mL di cellule CD4-T a 1x106/mL ai pozzetti anticorpi anti-CD3/CD28.
    NOTA: Stimolare le cellule T CD4 fino a 5 giorni.

3. Trascrizione inversa

NOTA: Per ottenere primer specifici del paziente, il DNA provirale isolato dalle cellule CD4-T di ogni paziente è stato amplificato utilizzando primerHIV-1 HXB2 Pan ASP. I primer specifici del paziente sono stati progettati utilizzando la sequenza provirale interna ai primer Pan ASP. Tutti i primer e le sonde utilizzati in questo studio sono elencati nella tabella 2.

  1. Isolamento dell'RNA totale dalle cellule
    1. Quantifica l'RNA ed elimina la contaminazione del DNA trattando i campioni con DNase.
    2. Eseguire reazioni DI RT in un volume di 50 .L. Trasferire 0,1-1 g di RNA totale in un numero appropriato di pozze di una piastra PCR 96-well. Preparare la miscela di RNA aggiungendo i seguenti componenti all'RNA:
      5 - L di primer inverso ASP biotinylato (20 M)
      2,5 l l di trefosdi deoxynucleotide (dNTP) (10 mM)
      25 -L di acqua distillata trattata con dietilpirocarburo (DEPC) (dH2O).
      Preparare i controlli Endogeni RT aggiungendo 5 - L di acqua priva di nuclesiera al posto dell'innavorino inverso ASP biotinyato.
    3. Mettere la piastra PCR 96 po ' bene in un termociclore e riscaldare la miscela di RNA a 94 gradi centigradi per 5 min.
    4. Raffreddare immediatamente la miscela di RNA in acqua ghiacciata per almeno 1 min.
    5. Preparare la miscela di reazione aggiungendo i seguenti componenti a un tubo da 1,5 mL (calcolare il numero totale di campioni più 1):
      10 L di buffer 5x RT
      2,5 L di 0,1 M di 1,4-dithiothreitol (DTT)
      2,5 ll di RNase fuori (40 unità / l)
      2,5 l di enzima RT (200 unità/L)
    6. Trasferire 17,5 l di questa miscela in ciascuno dei pozzi contenenti RNA. Preparare i controlli RT-minus sostituendo la trascrizione inversa con 2,5 gradi di acqua priva di nuclea.
    7. Mescolare delicatamente e incubare la piastra a 55 gradi centigradi per 60 min utilizzando un termociclore.
    8. Inattivare le reazioni riscaldando a 70 gradi centigradi per 15 minuti.

4. Purificazione dell'affinità del cDNA biotinylato ASP

NOTA: non purificare le reazioni RT-meno.

  1. Preparare 1 L di 2x buffer di lavaggio/associazione contenente 10 mM Tris-HCl (pH 7.5), 1 mM di acido etilenediaminetraetraacetica (EDTA) e 2 M NaCl. Filtrare la soluzione.
    1. Preparare 50 mL di 1x lavaggio/binding buffer utilizzando acqua di grado PCR.
    2. Per ogni reazione, utilizzare 10 L di perline magnetiche coniugate con streptavidin. In base al numero di reazioni, trasferire un volume appropriato di perline in un tubo da 1,5 mL.
    3. Lavare le perline aggiungendo un volume uguale di 2x lavaggio / rilegatura buffer e vortice per 15 s.
    4. Mettere il tubo in un rack di separazione magnetica e incubare per 3 min a temperatura ambiente.
    5. Rimuovere con attenzione il supernatante senza disturbare le perline e aggiungere lo stesso volume di lavaggio / rilegatura buffer 2x come volume iniziale di perline.
    6. Vortice per 30 s e trasferire 10 gradi l delle sospensioni perline ad un numero appropriato di tubi da 1,5 mL.
    7. Mettere i tubi in un rack di separazione magnetica e incubare per 3 min a temperatura ambiente.
    8. Eliminare il supernatante e aggiungere 50 l di lavaggio/rilegatura buffer 2x.
    9. Aggiungere 50 -L di cDNA biotinylato ai tubi corrispondenti contenenti le perline.
    10. Incubare per 30 min a temperatura ambiente ruotando delicatamente.
    11. Separare le perline dal supernatante da un rack di separazione magnete per 3 min a temperatura ambiente.
    12. Lavare le perline aggiungendo 200 l un l di 1x lavaggio/ buffer di rilegatura. Mettere i tubi in un rack di separazione magnete per 3 min a temperatura ambiente e scartare il supernatante. Ripetere due volte.
    13. Risospendere le perline in 10 gradi l di acqua di grado PCR.

5. PCR standard

NOTA: lo scopo della PCR standard è quello di amplificare l'intera ORF del gene ASP. I prodotti di amplificazione vengono poi clonati in pCR2.1 plasmide per sviluppare curve standard per la quantificazione dell'RNA ASP tramite PCR in tempo reale (vedi PCR in tempo reale del paragrafo).

  1. Eseguire i PCR standard in un volume totale di 50 .L. Preparare un volume appropriato di mix master PCR (numero di campioni più 1). Per ogni campione, aggiungere i seguenti componenti a un tubo da 1,5 mL:
    1 - L di 10 M - Primer ASP (avanti e indietro)
    1 - L di 10 mm dNTP
    Cloruro di magnesio (MgCl2)(la concentrazione dipende dai primer utilizzati)
    dH2O ad un volume finale di 49
    1. Mescolare bene, girare rapidamente verso il basso il contenuto e trasferire 49 l/poggia del mix master PCR a una piastra PCR 96-well.
    2. Vorticare con attenzione i tubi contenenti le perline utilizzate per la purificazione dell'affinità ASP cDNA per 15 s.
    3. Aggiungete 1 l di perline nei pozze corrispondenti ed eseguite la PCR utilizzando il seguente programma: 95 gradi centigradi per 2 min, 40 cicli di 95 gradi centigradi per 30 s, 55 gradi centigradi per 30 s e 68 gradi per 40 s, quindi 68 gradi centigradi per 7 min.
    4. Separare i prodotti PCR su gel di agarose dell'1%, tagliare le bande e clonare i prodotti amplificati in pCR2.1 plasmide.
    5. Sequenziare e analizzare le sequenze di ogni clone.

6. PCR quantitativo in tempo reale (qPCR)

NOTA: sviluppare primer e sonde specifiche per il paziente utilizzando l'approccio descritto nel passaggio 3 "Trascrizione inversa". Per qPCR includere diluizioni plasmide ASP per curve standard. Plasmidi contenenti inserti specifici per il paziente sono sviluppati come menzionato nella nota all'inizio del passaggio 5 "PCR standard".

  1. Preparare la curva standard utilizzando diluizioni seriali plasmidASP 1:10 a partire da 3 x 106 copie/L fino a 3 copie/L.
    1. PCR al primo round (preamplificatore). Eseguire reazioni in un volume totale di 25 . Per ogni campione, aggiungere i seguenti componenti a un tubo da 1,5 mL:
      0,5 l di ASP o env primer mix (concentrazione finale 0,2 m ciascuno) (avanti e indietro)
      0,5 l di miscela di dNTP (concentrazione finale 0,2 mM ciascuno)
      MgCl2 (la concentrazione dipende dalle coppie di primer)
      dH2O ad un volume finale di 24
    2. Trasferire 24 l di miscela master PCR su un numero appropriato di pozze di una piastra PCR da 96 pozze.
    3. Vorticare con cura i tubi contenenti le perline con il cDNA per 15 s.
    4. Aggiungere 1 ll di perline ai pozze corrispondenti. Fate lo stesso per le diluizioni plasmide.
    5. Eseguire la PCR utilizzando il seguente algoritmo: denaturazione per 2 min a 95 gradi centigradi; 30 s a 95 gradi centigradi, 30 s a 55 s, 40 s a 68 gradi centigradi per 18 cicli; estensione a 68 gradi centigradi per 7 min.
    6. Diluire i PCR del primo round reazioni 1:5 con acqua di grado PCR.
    7. Secondo round qPCR. Eseguire reazioni in un volume totale di 20 .L. Preparare un volume appropriato di miscela master PCR (numero di campioni più 1). Per ogni campione, aggiungere i seguenti componenti a un tubo da 1,5 mL:
      1,8 -l 10 M primer (avanti e indietro)
      1 l- di 5 sonda M
      6,2 ll di dH2O
    8. Trasferire 19 l di qPCR master mix in un numero appropriato di pozze di una piastra qPCR 96-po'e aggiungere 1 -L delle reazioni PCR del primo round diluito ai pozzi corrispondenti. Fate lo stesso per le diluizioni del plasmide.
    9. Eseguire il qPCR con il seguente algoritmo: denaturazione per 10 min a 95 gradi centigradi; 15 s a 95 , 1 min a 60 gradi centigradi per 40 cicli.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La denaturazione dell'RNA ad alta temperatura accoppiata alla purificazione dell'affinità del cDNA biotinylato previene l'amplificazione di prodotti ASP non specifici durante la PCR nei PBMC infettati in vitro e nelle cellule T CD4 isolate dai pazienti. È stato dimostrato che l'auto-priming RT si verifica durante la trascrizione inversa degli RNA antisenso10,14,15,16,17. Per prevenire questo fenomeno, abbiamo sviluppato un nuovo approccio utilizzando la tecnica originariamente descritta da Heist et al.10. La nostra procedura prevede la denaturazione ad alta temperatura dell'RNA prima della RT e l'uso di primer biotinylati per eseguire RT, seguita da affinità-purificazione dei cDNA biotinylati su perline magnetiche rivestite di streptavidin1 . I cDNA ottenuti con questo metodo possono essere utilizzati per applicazioni a valle, tra cui PCR standard o qPCR.

Le condizioni sperimentali per la trascrizione antisenso sono state testate per la prima volta nei PMC da un donatore sano infetto in vitro con HIV-1HXB2, la sequenza di riferimento per il sottotipo B dell'HIV-1 (tutti i nostri pazienti sono infettati da isolati di questo sottotipo). La tabella 2 mostra le sequenze di primer e sonde utilizzate in questo studio. Le nostre reazioni RT iniziali sono state fatte utilizzando un normale, non biotinylated antisense primer (ASP R1) e ha provocato l'amplificazione di successo di ASP (ASP F1-R1 primer pair) (Figura 1A, Corsie 1 - 3). Tuttavia, con questo approccio, abbiamo anche amplificato una banda dello stesso peso molecolare nei controlli delle reazioni primer-minus RT (Lanes 4 - 6). La completa mancanza di segnale nei nostri controlli negativi (Lanes 7 - 8) ha indicato che il modello non specifico proviene dalla reazione RT e non dalla contaminazione incrociata dei campioni.

Per aggirare il problema creato dall'auto-priming di RT, abbiamo deciso di utilizzare un metodo descritto in precedenza da Haist et al.10, in cui il primer antisenso specifico è etichettato con biotina in modo che il cDNA biotinylato risultante corrispondente all'orientamento antisenso possa essere purificato prima della PCR e amplificato in modo selettivo. Con questo approccio, siamo stati in grado di amplificare la sequenza ASP (Figura 1B, Corsie 1 - 3) con una contaminazione notevolmente ridotta dal cDNA non specifico nei controlli primer-minus (Figura 1B, Lane 4-6).

L'ottimizzazione di questo metodo è stata ottenuta con la completa denaturazione dell'RNA prima della RT a 94 gradi centigradi, seguita dal raffreddamento immediato sull'acqua ghiacciata. Come illustrato nella Figura 2A,B, la banda ASP viene effettivamente amplificata, mentre i prodotti non specifici sono scomparsi.

L'RNA ASP viene rilevato nelle cellule T CD4 da pazienti con viraemia rilevabile e in assenza di terapia, a seguito di stimolazione con anti-CD3/CD28. L'RNA ASP non era rilevabile nei PBMC non frazionati o nelle cellule T CD4 o non stimolate isolate dai pazienti HIV (dati non mostrati). Tuttavia, potrebbe essere facilmente rilevato nelle cellule CD4 isolate da tre soggetti sieropositivi, MP135, MP140 e MP148 (Tabella 1),a seguito della stimolazione con anti-CD3/CD28. La cinetica dell'espressione dell'RNA ASP misurata da qPCR in questi tre pazienti è illustrata nella Figura 3.

Le cellule CD4 isolate da pazienti sottoposti a ART e con viraemia non rilevabile, possono produrre piccole quantità di RNA ASP se stimolate con anti-CD3/CD28. La quantificazione dei livelli di RNA ASP in due di questi pazienti (MP071, MP146) da qPCR mostra che in queste condizioni l'RNA ASP viene rilevato a bassi livelli (10-15 copie/milioni di cellule T CD4) a 3-5 giorni di post-stimolazione (Figura 4). In un paziente tuttavia (MP069), nessun RNA ASP è stato rilevato in qualsiasi momento (dati non mostrati).

ASP e env RNA hanno modelli di espressione simili in un paziente non trattato con viraemia rilevabile (MP140). Sono stati analizzati due pazienti, uno non trattato (MP140) e uno trattato (MP146). In MP140 siamo in grado di rilevare sia ASP che env. Sebbene i loro livelli di trascrizione fossero dissimili (Figura 5A), la curva di espressione di questi due geni nel tempo era identica, che possono essere visualizzati tracciando i dati su una scala logaritmica (Figura 5B). Nel paziente MP146, che è stato trattato e la cui viraemia era al di sotto dei livelli di rilevamento, ASP e env erano appena rilevabili e solo dopo diversi giorni di stimolazione (Figura 5C).

Figure 1
Figura 1: Espressione di RNA ASP nei PBMC LMC da un individuo infetto da HIV-negative in vitro con HIV-1HXB2 da RT-PCR standard e modificato. (A) Rilevamento dell'RNA ASP mediante RT-PCR standard. ASP è amplificato da cDNA sintetizzato in presenza del primer antisenso non biotinylated ASP-3 (Lanes 1-3). La stessa banda si trova anche nei controlli rt primer-minus (Lanes 4–6). (B) Visualizzazione dell'RNA ASP mediante biotinylazione del primer antisenso e purificazione del cDNA (Lanes 1-3). Una banda di intensità ridotta viene ancora rilevata nei controlli primer-minus (Lanes 4-6). Nessuna banda è presente nei controlli negativi. Precedentemente pubblicato nell'articolo "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", by Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: l'RNA ASP è espresso nei PMBC di un individuo SIeropositivo in seguito all'infezione da HIV-1HXB2. (A) La banda ASP è facilmente rilevabile RNA che è stato completamente denaturato e invernato utilizzando il primer RT biotinylated (ASP R1) (Lanes 1–3), ma non in cDNA purificato da controlli primer-minus (Lanes 4–6). (B) Non viene rilevato alcun segnale corrispondente all'ASP nei controlli RT-minus dell'RNA provenienti da PBMC infetti, PBMC non infetti o acqua, anche se una banda chiara è visibile in controllo positivo del bavaglio dalle cellule ACH-2. Precedentemente pubblicato nell'articolo "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", by Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Nei globuli T CD4, stimolati da CD4 e CD28, isolati da tre pazienti non trattati, la produzione di RNA ASP è facilmente rilevabile e raggiunge picchi tra il giorno 2 e 4 della post-stimolazione. In MP135 e MP140, l'espressione di ASP ha raggiunto il picco di post-stimolazione del giorno 4, mentre in MP148 ha raggiunto il picco al secondo giorno. I livelli ASP sono espressi come copie di RNA/milioni di cellule T CD4. I punti nel corso del tempo corrispondono al valore medio delle reazioni PCR triplicati. Precedentemente pubblicato nell'articolo "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", by Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: In due pazienti aviemimici sottoposti a ART, l'ASP è a malapena rilevabile solo dopo pochi giorni di stimolazione. In entrambi i nostri pazienti, ASP non poteva essere rilevato al giorno 0. Nel paziente MP071, bassi livelli di ASP potrebbero essere rilevati al giorno 3, mentre nel paziente MP146, abbiamo dovuto aspettare fino al giorno 5 per vedere alcuni livelli di RNA. I livelli ASP sono espressi come copie di RNA/milioni di cellule T CD4. I punti nel corso del tempo corrispondono al valore medio delle reazioni PCR triplicati. Precedentemente pubblicato nell'articolo "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", by Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: Espressione di ASP e env in cellule T CD4, stimolate da CD4 e non trattati (MP140) anti-CD3/CD28, stimolate da CD4 e non trattati. (A) Nel paziente non trattato (MP140), env è espresso a livelli superiori a ASP; (B) Gli stessi dati tracciati su scala logaritmica mostrano che l'espressione ASP e env sono caratterizzati da un profilo simile nel tempo; (C) Espressione cinetica di ASP e env in un paziente con viraemia non rilevabile e sottoposto ART (MP146). Precedentemente pubblicato nell'articolo "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", by Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244). Fare clic qui per visualizzare una versione più grande di questa figura.

ID paziente Età Sesso Stadio dell'infezione da HIV Clade Carico virale (copie/ml) Conteggio CD4 (celle/zl) Stato ART
MP135 (in tiopero MP135 44 M C3 B 1,6x105 176 Non trattata
MP140 (in questo stato del sistema) 23 M A2 (in modo inade B 3.6x104 427 Non trattata
MP148 (in questo stato del sistema) 37 M A1 (in modo inade B 2.0x104 (in questo 0) 717 Non trattata
MP069 (informazioni in inglese) 42 M A1 (in modo inade B <20 1309 Trattati
MP071 (in tissuma 47 M C3 B <20 167 Trattati
MP146 (in inglese) 59 M C3 B <20 385 Trattati

Tabella 1: Caratteristiche dei pazienti. Precedentemente pubblicato nell'articolo "Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1)", by Mancarella et al.13 (J Gen Virol 100(5):863-876. doi: 10.1099/jgv.0.001244).

Nome Primer/Probe Sequenza primer (da 5' a 3')
ASP F1 TTAGGAGTAGCACCAAA
ASP R1 GAACCCAAGGAACAAAGCTC
PAN ASP F ACCAAGCCTCCTACTATCATTATG
PAN ASP R GCACATTGTAACATTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCAA
ASP MP135, 146, 071 Sonda FAM/TAMRA TCTCTCTCTCTCTCTCTCTCTCTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R AGAAGAGTGGGGCAGAGAGA
Sonda ASP MP140 FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTCTCTCTCTCTCTCTCTCtTCt
ASP MP148 R AGACCTGGAGGAGADATG
Sonda ASP MP148 FAM/TAMRA TGGTGGGGCTACTCCTAATGGTT
ENV MP140 F AGAAGAGTGGGGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
Env MP140 Sonda FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCAA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
Env MP146 Sonda FAM/TAMRA TCTCTCTCTCTCTCTCTCTCTCTTGCC

Tabella 2: primer e sonde RT-PCR

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In questo rapporto viene descritto un saggio RT specifico del filamento applicato al rilevamento dell'RNA ASP nelle cellule T CD4, isolate da individui infettati dall'HIV-1. Il verificarsi di priming non specifico durante RT ostacola la rilevazione di trascrizioni dell'RNA con la polarità destra, portando a un'errata interpretazione dei risultati. I gruppi precedenti hanno sviluppato diverse strategie volte a prevenire la sintesi cDNA indipendente dal primer durante la reazione RT. Contrassegnare l'inversione all'estremità 3' con sequenze non correlate all'HIV si è dimostrata efficace nel raggiungimento dell'amplificazione specifica del filamento6,8,9. Tuttavia, questo approccio consente solo di rendere il cDNA falsamente innescato inosservabile piuttosto che evitarlo, con il rischio che fuoriesca nella reazione PCR, causando l'amplificazione di prodotti DNA non specifici (cioè env invece di ASP).

I nostri tentativi iniziali di RT-PCR per rilevare l'RNA ASP sono stati eseguiti utilizzando un primer antisenso standard. Le amplificazioni hanno avuto successo, poiché abbiamo ottenuto bande del giusto peso molecolare, ma le bande della stessa dimensione erano presenti anche nei nostri controlli primer-minus. Sulla base di questi risultati, abbiamo usato un approccio diverso, eseguendo RT con un primer antisenso specifico biotinylato, come descritto da Haist et al.10. Anche se i nostri esperimenti preliminari hanno portato a una drastica diminuzione dell'auto-priming RT, non siamo riusciti a rimuovere completamente i prodotti non specifici di amplificazione. Haist e colleghi eliminano i prodotti cDNA non specifici lavando le perline in condizioni di cordenza elevata10. Nel nostro metodo, abbiamo rimosso completamente la fonte di auto-priming sotto forma di strutture secondarie dell'RNA utilizzando alte temperature di denaturazione per linearizzare completamente il modello di RNA.

Dimostriamo che l'RNA ASP è espresso nei linfociti CD4 T stimolati da CD4 e da CD3. Il rilevamento di ASP, tuttavia, non può essere ottenuto nelle cellule in assenza di stimolazione. I nostri dati sono in qualche modo dissimili da quelli di zepata e colleghi, che hanno segnalato l'espressione di bassi livelli di ASP in cellule CD4 a riposo isolate da pazienti sottoposti ad ART9. Sulla base di questi risultati, propongono che l'RNA ASP possa svolgere un ruolo nella regolazione della latenza dell'HIV. La nostra scoperta che nello stesso individuo la cinetica dell'espressione di ASP e env è caratterizzata dallo stesso profilo non è coerente con il modello9di . Infatti, se realmente ASP è stato coinvolto nella regolazione della latenza, il suo profilo di espressione dovrebbe essere opposto a quello osservato per env18.

Abbiamo anche osservato che i livelli di trascrizione env sono superiori a 2 registri superiori a quelli dell'ASP, almeno nei pazienti in assenza di terapia. Questi dati sono in accordo con gli studi di Laverdure et al.8 che dimostrano che nelle cellule primarie CD4 infette in vitro, la trascrizione antisenso LTR 3' è molto più bassa (fino a 1000 volte) rispetto alla trascrizione di senso 5' . I nostri risultati indicano che l'ASP è espresso in linfociti CD4 infetti indipendentemente dallo stadio della malattia, purché le cellule siano adeguatamente stimolate. Inoltre, i nostri dati dimostrano che l'ASP è espresso in cellule di pazienti sottoposti a trattamento ART, anche se il livello di espressione in queste cellule è inferiore a quello delle cellule di pazienti in assenza di terapia.

In sintesi, suggeriamo un affidabile saggio RT specifico del filamento volto a prevenire la sintesi del cDNA indipendente dal primer. ASP ed env sono due geni che si sovrappongono l'uno all'altro in orientamento opposto, una caratteristica che rende il loro studio molto impegnativo. Il nostro approccio, che consente di catturare selettivamente i cDNA retrotrascritti dall'RNA con polarità negativa e positiva, rappresenta uno strumento ottimale per lo studio di questi due geni in particolare, e geni che si sovrappongono nella loro antisenso orientamento in generale.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano che non ci sono conflitti di interesse.

Acknowledgments

Ringraziamo Patrizia Amelio, Alessandra Noto, Craig Fenwick e Matthieu Perreau per essere sempre disponibili a discutere del nostro lavoro e di tutte le persone del Laboratorio di AIDS Immunopatogenesi per la loro preziosa assistenza tecnica. Vorremmo anche ringraziare John e Aaron Weddle di VSB Associated Inc. Infine, tanti ringraziamenti speciali a tutti i Pazienti, senza i quali questo lavoro non sarebbe stato possibile. Questo lavoro non ha ricevuto alcuna sovvenzione specifica da qualsiasi agenzia di finanziamento.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics