Humanisierte NOG-Mäuse für intravaginale HIV-Exposition und Behandlung von HIV-Infektionen

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wir haben ein Protokoll zur Generierung und Bewertung eines humanisierten und humanen, mit Immundefizienz virusinfizierten NOG-Mausmodells entwickelt, das auf Stammzelltransplantation, intravaginaler exposition menschlicher Immundefizienzviren und Tropfen-Digital-PCR-RNA basiert. Quantifizierung.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Andersen, A. H. F., Nielsen, S. S. F., Olesen, R., Mack, K., Dagnæs-Hansen, F., Uldbjerg, N., Østergaard, L., Søgaard, O. S., Denton, P. W., Tolstrup, M. Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection. J. Vis. Exp. (155), e60723, doi:10.3791/60723 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humanisierte Mäuse bieten eine ausgeklügelte Plattform, um die Virologie des Humanen Immundefizienzvirus (HIV) zu untersuchen und antivirale Medikamente zu testen. Dieses Protokoll beschreibt die Etablierung eines menschlichen Immunsystems bei erwachsenen NOG-Mäusen. Hier erklären wir alle praktischen Schritte von der Isolierung von Nabelschnurblut abgeleiteten menschlichen CD34+ Zellen und deren anschließende intravenöse Transplantation in die Mäuse, die Manipulation des Modells durch HIV-Infektion, Kombination antiretrovirale Therapie ( cART) und Blutentnahme. Etwa 75.000 hCD34+ Zellen werden intravenös in die Mäuse injiziert und das Niveau des menschlichen Chimären, auch als Humanisierung bekannt, im peripheren Blut wird längs für Monate durch Durchflusszytometrie geschätzt. Insgesamt ergeben 75.000 hCD34+ Zellen 20%–50% menschliche CD45+ Zellen im peripheren Blut. Die Mäuse sind anfällig für intravaginale Infektionen mit HIV und Blut kann einmal wöchentlich zur Analyse und zweimal monatlich für längere Zeit entnommen werden. Dieses Protokoll beschreibt einen Test zur Quantifizierung der Plasmaviruslast mit Tropfen digitaler PCR (ddPCR). Wir zeigen, wie die Mäuse effektiv mit einem Standard-pflege-cART-Regime in der Ernährung behandelt werden können. Die Lieferung von cART in Form von regulärem Maus-Chow ist eine signifikante Verfeinerung des Versuchsmodells. Dieses Modell kann sowohl zur präklinischen Analyse systemischer als auch topischer Präexpositionsprophylaxeverbindungen sowie zur Erprobung neuartiger Behandlungen und HIV-Heilungsstrategien verwendet werden.

Introduction

Das Humanimmundeficiency Virus (HIV) ist eine chronische Infektion mit mehr als 37 Millionen Infizierten weltweit1. Die kombinationsantivirale Therapie (cART) ist eine lebensrettende Therapie, aber eine Heilung ist immer noch gerechtfertigt. Daher sind Tiermodelle erforderlich, die das menschliche Immunsystem und seine Reaktionen spiegeln, um die weitere HIV-Forschung zu erleichtern. Mehrere Arten von humanisierten Mäusen, die in der Lage sind, Zell- und Gewebetransplantation zu unterstützen, wurden durch Transplantation menschlicher Zellen in stark immundefizienten Mäusen2entwickelt. Solche humanisierten Mäuse sind anfällig für HIV-Infektionen und stellen eine wichtige Alternative zu nichtmenschlichen Primaten-Simian-Immundefizienz-Virusmodellen, da sie billiger und einfacher zu bedienen sind als nichtmenschliche Primaten. Humanisierte Mäuse haben die Forschung in HIV-Virusübertragung, Pathogenese, Prävention und Behandlung3,4,5,6,7,8,9,10,11erleichtert.

Wir präsentieren ein flexibles humanisiertes Modellsystem für die HIV-Forschung, das durch die Transplantation von nabelschnurblutabgeleiteten menschlichen Stammzellen in Mäuse des NOD entwickelt wurde. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) Hintergrund. Abgesehen davon, dass es nicht-fetaler Herkunft ist, ist das praktische Bioengineering dieser Mäuse im Vergleich zu den mikrochirurgischen Verfahren, die an der Transplantation des Blut-Leber-Thymus -Konstrukts (BLT) beteiligt sind, weniger technisch anspruchsvoll.

Wir zeigen, wie man eine HIV-Infektion durch intravaginale Übertragung herstellt und wie man die Plasmaviruslast mit einem empfindlichen Droplet-Digital PCR(ddPCR)-basierten Setup überwacht. Anschließend beschreiben wir die Etablierung von Standard-cART als Teil der täglichen Maus-Diät gegeben. Ziel dieser kombinierten Methoden ist es, den Stress für die Tiere zu verringern und groß angelegte Experimente zu erleichtern, bei denen die Fürstin des Umgangs mit jedem Tier begrenzt ist12.

Beim Menschen verursacht ein CCR5-Genotypmit 32/32 oder CCR532/32 eine verminderte Anfälligkeit für HIV-Infektionen mit Sender-/Gründerviren13, und es müssen einige Vorsichtsmaßnahmen getroffen werden, wenn humanisierte Mäuse mit Stammzellen für HIV-Studien bioengineering entwickelt werden. Dies gilt insbesondere in unserer Region, weil natürlich vorkommende Varianten im CCR5-Gen, insbesondere 32 Deletionen, in skandinavischen und baltischen Ureinwohnern häufiger sind als im Rest der Welt14,15. So enthält unser Protokoll einen einfachen, hochdurchsatzhohen Assay zum Screening von hämatopoetischen Stammzellen für CCR5-Varianten vor der Transplantation.

Für die intravaginale Exposition wählten wir den Sender/Gründer R5 Virus RHPA4259, isoliert von einer Frau in einem frühen Stadium der Infektion, die intravaginal infiziert war16. Wir setzten die Mäuse einer viralen Dosis aus, die ausreichte, um bei der Mehrheit der Mäuse eine erfolgreiche Übertragung zu erzielen, aber unter einer Übertragungsrate von 100 %. Die Wahl einer solchen Dosis ermöglicht einen ausreichenden Dynamikbereich in der Übertragungsrate, so dass antivirale Wirkungen eines Arzneimittelkandidaten zu geschützten Tieren in HIV-Präventionsexperimenten und einer verringerten Viruslast für Behandlungsstudien führen können.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle Nabelschnurblutproben wurden in strikter Übereinstimmung mit lokal zugelassenen Protokollen, einschließlich der informierten Zustimmung der Eltern zur anonymen Spende, erhalten. Alle Tierversuche wurden gemäß den dänischen nationalen Vorschriften unter der Lizenz 2017-15-0201-01312 genehmigt und durchgeführt.

VORSICHT: Behandeln Sie HIV-exponierte Mäuse und Blut mit äußerster Vorsicht. Dekontaminieren Sie alle Oberflächen und Flüssigkeiten, die mit HIV in Kontakt gekommen sind, mit einem bestätigten HIV-Desinfektionsmittel (Materialtabelle).

1. Isolierung menschlicher CD34+ Stammzellen

  1. Sammeln Sie Nabelschnurblutproben in EDTA-beschichteten Blutentnahmeröhrchen nach geplanten Kaiserschnitten oder vaginalen Geburten und gemäß den örtlichen ethischen Genehmigungen.
  2. Isolieren Sie PMBCs aus Nabelschnurblut durch Dichte-Gradienten-Trennung gemäß dem Herstellerprotokoll.
  3. Isolieren Sie CD34+-Zellen aus der PBMC-Population, indem Sie zuerst mit Antikörpern gegen gemeinsame Marker für reife Zellen voranreichen, was eine Vernetzung von Zellen unerwünschter Linien mit roten Blutkörperchen induziert. Es folgt die CD34+ Zellanreicherung mit magnetischen Perlen, nach dem Herstellerprotokoll.
    1. Bestimmen Sie die Anzahl der lebenden Zellen durch den standardmäßigen Trypan-Blau-Ausschluss, indem Sie 10 l Zellsuspension in 90 l Trypanblau wieder aufhängen. Fügen Sie 10 L dieser Lösung zu einem Hemacytometer hinzu und zählen Sie nicht-blaue Zellen, entsprechend dem Herstellerprotokoll.
    2. Viably kryopreserve CD34+ Zellen in 1 ml von 10% DMSO in fetalem Rinderserum (FBS) bis zum Tag der Maustransplantation.
    3. Viably kryokonservieren einen kleinen Bruchteil sowohl isolierter (CD34+) als auch durchfließender Zellen (CD34-) getrennt zur Beurteilung der CD34+ Stammzellreinheit (30.000 Zellen jeder Probe). Alternativ können Sie die Reinheit an frisch angereicherten Zellen testen (siehe Schritt 2 unten).
    4. Einfrieren eines Bruchteils des nicht-pelletierten Durchflusses (CD34-) zur Bestimmung des CCR5-Status32. Zellen können direkt ohne konditionierte Gefrierlösung eingefroren werden, aber das Vorhandensein von roten Blutkörperchen im Pellet kann die nachfolgende PCR hemmen, wenn der Durchfluss pelletiert wird.

2. Beurteilung der CD34+ Stammzellreinheit über Durchflusszytometrie

  1. Tauen Sie die isolierten Zellen (CD34+) und durchfließende Zellen (CD34-). Waschen Sie die Zellen, indem Sie die Zellen aus jeder Durchstechflasche in 9 ml Raumtemperatur (RT) FACS-Puffer, bestehend aus 2% fetalem Rinderserum (FBS) in phosphatgepufferter Saline (PBS), wieder aufhängen.
  2. Zentrifuge für 5 min bei 300 x g bei RT zu Pelletzellen.
  3. Gießen Sie den Überstand ab, suspendieren Sie die Zellen in der verbleibenden Flüssigkeit und übertragen Sie ihn in FACS-Rohre. Wiederholen Sie den Waschschritt mit 3 ml FACS-Puffer. Nach der zweiten Zentrifugation den Überstand abgießen und die Zellen in der verbleibenden Flüssigkeit wieder aufsetzen.
  4. Fügen Sie 5 l fc Receptor Blockierlösung (Tabelle der Materialien) und lassen Sie für 10 min bei RT. Waschen Sie die Fc-Rezeptor-Blockierlösung nicht ab.
  5. Fügen Sie den Mix hinzu, der vorgegebene Mengen von Antikörpern gegen menschliche CD3 (Klon SK7) BUV395, CD34 (Klon AC136), FITC und CD45 (Klon 2D1) APC (Tabelle 1) enthält. Lassen Sie die Zellen 30 min bei RT im Dunkeln. Die Fluorophore müssen auf der Grundlage von Parametern ausgewählt werden, die mit verfügbaren Durchflusszytometern bewertet werden können, ohne dass eine Kompensationsmatrix erforderlich ist.
  6. Waschen Sie die Zellen mit 3 ml FACS-Puffer.
  7. Zentrifuge für 5 min bei 300 x g bei RT, um die Zellen zu pellet.
  8. Gießen Sie den Überstand ab und suspendieren Sie die Zellen in der verbleibenden Flüssigkeit.
    1. Wiederholen Sie diesen Waschschritt 2x, um sicherzustellen, dass alle ungebundenen Antikörper entfernt wurden.
  9. Zeichnen Sie die Proben auf dem Durchflusszytometer (Materialtabelle) auf und führen Sie datenanalysen mit entsprechender Software durch. Die Gating-Strategie ist in Abbildung 1A–Fdargestellt.

3. Genetisches Screening für CCR5-32-Variantenim Nabelschnurblut

  1. Inkubieren Sie 1,25 l nicht-pelletierten Durchfluss mit 11,25 l PCR-Mix, der 200 m dNTP-Mix, 0,01 U/L-Hochtreue-DNA-Polymerase und die in Tabelle 2beschriebenen Vorwärts- und Rückwärtsgrundierungen enthält.
    1. Stellen Sie das Volumen mit nukleasefreiem Wasser für jede PCR-Reaktion auf ca. 12,5 l ein.
  2. Verstärken Sie die genomischen Fragmente mit dem PCR-Zyklusprogramm, das in Tabelle 3beschrieben ist.
  3. Trennen Sie die PCR-Produkte auf einem 2% Agarose-Gel13.
    1. PCR-Produkte aus den Wild-Typ-Allelen und den 32-Allelen ergeben PCR-Fragmente von 196 Basenpaaren bzw. 164 Basenpaarbändern, wodurch sie leicht durch Gelelektrophorese13 (Abbildung 1G)zu unterscheiden sind.

4. Intravenöse Stammzelltransplantation

HINWEIS: Eine Person die Zellen im Labor vorzubereiten und eine andere Person die Mäuse und den Arbeitsplatz für Transplantationen vorzubereiten, ist ein effizienter Ansatz.

  1. In einer Tieranlage, 4-6 h vor der geplanten Transplantation der Stammzellen, bestrahlen 6-7 Wochen alte weibliche NOD. Cg-Prkdcscid Il2rgtm1Sug/JicTac (NOG) Mäuse (Materialtabelle) mit 0,75 Gy mit einer Cs137 Quelle. Die beste Vorbedingungsdosis kann je nach Mausalter, Strahlungsquelle und anderen Faktoren variieren. Dieser Prozess bedingt die Tiere für eine erfolgreiche Engraftmentierung mit menschlichen Stammzellen.
  2. Bereiten Sie in einer Tieranlage den Flow-Bench-Arbeitsplatz und alle Reagenzien vor, bevor Sie die Mäuse oder Zellen in den Arbeitsbereich bringen.
    1. Legen Sie ein steriles blaues Pad auf, um die Arbeitsfläche der Fließbank zu bedecken. Bereiten Sie sterile Gaze und einen scharfen Behälter vor.
    2. Legen Sie eine mit 70% Ethanol desinfizierte Heizlampe in die Fließbank mit einem leeren sterilen Mauskäfig unter der Hitze.
  3. Im Labor isolierte CD34+-Zellen auftauen und in 9 ml 37 °C einfachem RPMI verdünnen.
  4. Zentrifugieren Sie die Zellen bei 350 x g für 5 min bei RT, entsorgen Sie den Überstand durch Aspiration und setzen Sie das Pellet in 1 ml reinem RPMI bei 37 °C wieder auf.
  5. Bestimmen Sie die Zellanzahl durch Trypan-Blauausschluss, und passen Sie das Volumen auf 200 L pro Maus an. Machen Sie extra, um mögliche Verluste durch die nachfolgenden Handhabungsschritte zu berücksichtigen.
    1. Bereiten Sie sich darauf vor, 75.000 CD34+ Zellen pro 200 L in jede Maus zu transplantieren.
    2. Die Zellen können während des Transports zur Tieranlage vor der Transplantation bei 4 °C gehalten werden. Vermeiden Sie es, die Zellen auf Eis zu halten, um die Aggregation oder Verklumpung zu reduzieren.
  6. In der Tieranlage den Käfig mit den Mäusen in die Fließbank bringen und die Mäuse in den Käfig unter der Heizlampe bringen, um die Blutgefäße zu verdünnen. Lassen Sie ein Ende des Käfigs von der Wärmequelle weg, damit sich die Mäuse von der Hitze entfernen können, wenn sie warm werden. Mäuse, die sich an das Ende des Käfigs, weg von der Wärmequelle, bewegt haben, sind ausreichend warm für eine erfolgreiche Schwanzveneninjektion.
  7. Mit aufgehängten CD34+-Zellen eine geschmierte Spritze von 1 ml über die 800-L-Marke legen. Die Verwendung einer geschmierten 1 ml Spritze erleichtert die intravenöse Injektion dramatisch und erhöht die Präzision dieser Technik.
  8. Befestigen Sie eine 30 G 13 mm Nadel und bereiten Sie die Nadel und Spritze für die Injektion vor. Diese Reihenfolge ermöglicht es, die Spritze schneller zu beladen und gleichzeitig die Integrität der zu transplantierenden Zellen zu schützen, da mögliche Schäden auftreten können, die während der schnellen Aspiration der Zellen durch eine solche kleine Nadel auftreten können. Füllen Sie die Nadelnbenabe mit Flüssigkeit, indem Sie den Kolben drücken, und entfernen Sie die Flüssigkeit bis zur 200-L-Marke der Nadel.
  9. Legen Sie eine beheizte Maus (Schritt 4.6) in ein Restrainer, das für IV-Injektionen verwendet wird. In jizieren Sie vorsichtig 200 l der Zellsuspension in die Schwanzvene der Maus. Verbringen Sie 2 s mit dem Tauchgang und halten Sie die Nadel nach Abschluss der Injektion ca. 2 s in positioniiert. Dadurch wird sichergestellt, dass die Zellen vor dem Entfernen der Nadel ausreichend weit von der Injektionsstelle abgewandert sind.
  10. Wischen Sie bei Bedarf den Schwanz der Maus mit steriler Gaze ab, um sichtbares Blut zu entfernen. Setzen Sie die Maus wieder in ihren nicht beheizten Hauskäfig. Wiederholen Sie den Injektionsvorgang mit den verbleibenden Mäusen.

5. Blutentnahme und -verarbeitung zur Analyse

HINWEIS: Die menschliche Zelltransplantation im peripheren Blut kann 3–5 Monate nach der Transplantation menschlicher Stammzellen mittels Durchflusszytometrie bewertet werden.

  1. Zeichnen Sie Blutproben von den Mäusen mit lokalen IACUC-zugelassenen Techniken.
  2. Sammeln Sie maximal 70–100 l Blut in sterile PCR-Mikrozentrifugenröhren, die 10 l 0,5 M EDTA (pH = 8,0) enthalten, um eine Gerinnung von Blut zu vermeiden.

6. Bewertung der menschlichen Engraftment mittels Durchflusszytometrie

  1. Übertragen Sie 40–50 L Blut in FACS-Röhrchen.
  2. Fügen Sie 5 l fc Receptor Blockierlösung hinzu, um eine unspezifische Bindung von Antikörpern zu verhindern und 10 min bei RT zu lassen.
  3. Fügen Sie die Maus Anti-Human-Antikörper-Mix mit CD4 (Klon SK3) BUV 496, CD8 (Klon RPA-T8) BV421, CD3 (Klon OKT3) FITC, CD19 (Klon sj25c1) PE-Cy7, CD45 (Klon 2D1) APC (Tabelle 4) und 30 min bei RT im Dunkeln färben lassen. Fluorophore müssen anhand von Parametern ausgewählt werden, die mit den verfügbaren Durchflusszytometern ohne Kompensationsmatrix bewertet werden können.
  4. Fügen Sie 2 ml eines geeigneten roten Blutkörperchensingpuffers in jede Röhre ein, um die roten Blutkörperchen zu lysieren. Verwenden Sie einen Lysepuffer, der speziell für die Antikörperfärbung vor der Lyse roter Blutkörperchen formuliert wurde (ein geeignetes Beispiel ist in der Tabelle der Materialienangegeben). Wirbel kurz, um eine gleichmäßige Verteilung der Zellen in der Lysing-Lösung zu gewährleisten und lassen Sie für 10 min bei RT. Gleiche Verteilung der Zellen ist wichtig.
  5. Fügen Sie 2 ml FACS-Puffer hinzu, um die Lyse-Reaktion zu stoppen.
  6. Zentrifuge für 5 min bei 300 x g bei RT, um die Zellen zu pellet.
  7. Gießen Sie den Überstand und Wirbel sanft ab, bis die Zellen resuspendiert werden.
  8. Fügen Sie 3 ml FACS Puffer und Zentrifuge für 5 min bei 300 x g bei RT.
  9. Gießen Sie den Überstand ab und suspendieren Sie die Zellen.
  10. Zeichnen Sie die Proben auf einem geeigneten Durchflusszytometer auf und analysieren Sie sie mit entsprechender Software (Materialtabelle). Repräsentative Analysen und Ergebnisse sind in Abbildung 2 und Abbildung 3dargestellt.

7. Intravaginale HIV-Exposition

HINWEIS: Das Virus, das für die intravaginale Exposition der Mäuse verwendet wird, kann mit den zuvor veröffentlichten Protokollen17hergestellt werden. Das Virus wird bei -80 °C gehalten und zwischen den Standorten transportiert, während es nach lokal zugelassenen Protokollen auf Trockeneis gelagert wird. Das Virus wird auf Trockeneis gespeichert, bis unmittelbar vor der Exposition der Mäuse. Das Virus kann in einfaches RPMI verdünnt werden (vermeiden Sie RPMI, das Antibiotika oder Serumzusätze enthält), um die entsprechende Konzentration unmittelbar vor der Exposition zu erreichen (21.400 EIT wurden für diese IVAG-Exposition verwendet). Einmal erzeugt, halten Sie den verdünnten Bestand während des gesamten Verfahrens auf nassem Eis, um Frost-Tau-Zyklen zu vermeiden, die auftreten würden, wenn das verdünnte Virus nach dem Auftauen wieder auf Trockeneis gelegt würde.

  1. Bereiten Sie alle Geräte und den Fließtischarbeitsbereich vor, wie in Abbildung 4 dargestellt, bevor Sie die Mäuse oder das Virus in die Fließbank bringen (ähnlich wie Schritt 4.2).
    1. Platzieren Sie den Fokus der Heizlampe in der Mitte des Arbeitsbereichs, in dem sich die Maus während des HIV-Expositionsverfahrens befindet. Die Heizlampe sorgt dafür, dass die Körpertemperatur der Mäuse nicht abnimmt. Andere Geräte, die die Temperatur steuern, können ebenfalls verwendet werden (z. B. ein beheiztes Gelpad oder eine zirkulierende Warmwasserdecke gemäß den lokalen IACUC-Vorschriften18).
    2. Bringen Sie sterile 20 L Pipettenspitzen und eine entsprechende Pipette in die Bank. Legen Sie einen Behälter mit flüssigem Desinfektionsmittel(Materialtabelle) auf die Bank für die sofortige Inaktivierung von Materialien und Flüssigkeiten, die mit dem Virus in Berührung gekommen sind.
  2. Legen Sie eine Maus in eine Kammer mit 3% Isoflurangas und Papiertüchern. Dieser Gasanteil wird die Tiere innerhalb von 2–4 min befruchten. Wie bei allen anderen Materialien, die bei immundefizienten Mäusen verwendet werden, muss das Anästhesiegerät vor der Verwendung ordnungsgemäß desinfiziert werden.
  3. Nach der Beästhesoniert, übertragen Sie die Maus auf ein steriles blaues Pad unter der Heizlampe. Legen Sie die Mausschnarbe in eine Maske ein, die kontinuierliche3% Isoflurangas liefert, um die Anästhesie aufrechtzuerhalten. Halten Sie die Maus an der Basis des Schwanzes, Magen nach oben, mit der Hand unterstützt die Maus zurück, wie in Abbildung 4dargestellt.
  4. Mit einer sterilen Pipettenspitze stimulieren Sie den Genitalbereich, indem Sie sanft nach oben zum Anus streicheln, um eine Entleerung des Rektums zu induzieren und so den Druck auf die Vagina zu lindern.
  5. Entblößen Sie vorsichtig die vaginale Öffnung, indem Sie den Mausschwanz so über Ihre Finger wickeln, dass sich die Vulva natürlich öffnet, vielleicht mit leichtem Nudging mit einer sterilen Pipettenspitze.
  6. Ändern Sie die Pipette Spitze und Pipette 20 L Virus atraumatisch in die Maus Vagina, ohne Blasen zu schaffen. Setzen Sie die Spitze nicht tief in die Vagina ein. Stattdessen, mit der Vulva geöffnet, legen Sie die Pipette Spitze auf der Ebene der vaginalen Öffnung, vermeiden Sie tiefer gehen, um das Potenzial für Abschürfungen während des Impfprozesses zu beseitigen, das Virus freizusetzen, und lassen Sie die Schwerkraft, um das Virus in die Vagina zu ziehen. Alternativ können Sie eine 22 G 1,25 mm stumpfe, gerade Nadel verwenden, wie in Veselinovic et al.6beschrieben.
  7. Halten Sie die Maus in dieser Position mit der Vagina nach oben für 5 min nach der Exposition, um schwerkraftinduzierte Leckage der Virussuspension zu vermeiden.
    1. Legen Sie die Maus vorsichtig in den heimischen Käfig und achten Sie darauf, die Maus auf den Rücken zu legen.

8. Verarbeitung von Blutproben vor der Viruslastanalyse

  1. Sammeln Sie Blut, wie in Abschnitt 5 oben beschrieben.
  2. Zentrifuge die Blutproben für 5 min bei 500 x g bei RT, um das Plasma und die Zellen zu trennen.
  3. Sammeln Sie 40 l Plasma für die Viruslastmessung in ein neues steriles PCR-zugelassenes Mikrozentrifugenrohr und lagern Sie bei -80 °C mindestens 1 h bis zur Weiterverarbeitung. Es ist wichtig, alle Proben vor der RNA-Extraktion einzufrieren, um das Risiko einer Verzerrung durch den Vergleich von RNA-Spiegeln in Proben zu vermeiden, die vor der RNA-Isolierung nicht eingefroren wurden, mit Proben, die vor der RNA-Isolierung eingefroren wurden.
  4. Passen Sie das Blutvolumen wieder auf das ursprüngliche Volumen an, indem Sie 40 l Suspensionsmedien (PBS mit 2,5 % Rinderserumalbumin, 50 U/ml Penicillin G und Streptomycin und 10 U/ml DNase, sterilgefiltert bei 0,22 m) hinzufügen.
  5. Übertragen Sie 15 l des eingestellten Blutvolumens auf ein neues PCR-zugelassenes Mikrozentrifugenrohr.
  6. 1 ml 1x RBC-Lyselösung (Materialtabelle), Wirbel hinzufügen und 10 min bei RT inkubieren.
  7. Zentrifuge für 1 min bei 9.600 x g bei RT zu Pelletzellen.
  8. Aspirieren Sie Überstand und lassen Sie nur das winzige weiße Zellpellet, weil rote Blutkörperchen Kontamination PCR hemmen kann.
  9. Pellet bei -80 °C mindestens 1 h bis zur Weiterverarbeitung lagern.
    HINWEIS: Optional kann jedes verbleibende Blut aus Schritt 8.4 für die Analyse der Durchflusszytometrie verwendet werden, wie oben in Schritt 6 beschrieben.

9. DNA-Extraktion mit einer Proteinase-K-Extraktionsmethode

  1. Extrahieren Sie DNA aus peripheren Zellpellets (in Schritt 8.8 erzeugt) mit einer Proteinase-K-Extraktionsmethode, wie unten beschrieben. Diese Methode wurde gezeigt, um die höchste DNA-Ausbeute aus einem kleinen Volumen von Blut zu extrahieren, wie für die seriellen Blutsammlungen in dieser Studie verwendet19erforderlich.
  2. Fügen Sie 25 l Proteinase K (20 g/ml) zu 1 ml 0,1M Tris Puffer hinzu.
  3. Wirbel die Proteinase-K-Lösung kurz.
  4. Fügen Sie jedem zu verdauenden Zellpellet 50 l der Proteinase-K-Lösung hinzu.
  5. Durch Pipettieren nach oben und unten mischen und die Resuspension des Zellpellets bestätigen.
  6. Schütteln Sie auf einem Thermoshaker(Materialtabelle) bei 400 U/min (je nach Instrument) bei 56 °C für 1 h. Bandröhren nach unten, um sie bei Bedarf an Ort und Stelle zu halten.
  7. Sofort und im selben Thermoshaker die Proteinase K mit einer Temperaturverschiebung auf 95 °C inaktivieren, während das Schütteln für weitere 20 min anhält.
  8. Wirbel pro Probe.
  9. Platzieren Sie jede Probe mindestens 30 min bei -80 °C.
  10. Tauen, dann zentrifugieren Sie die Proben bei 17.000 x g für 1 min bei RT, um unerwünschte Zellfragmente zu pellet.
  11. Legen Sie den DNA-haltigen Überstand in ein neues Mikrozentrifugenrohr.
  12. Die DNA-Vorlage ist bereit für PCR. Die DNA-Vorlagen können bei -80 °C gespeichert werden.

10. RNA-Extraktion, cDNA-Synthese und ddPCR-Quantifizierung viraler RNA

  1. Isolieren Sie RNA aus aufgetautem Mausplasma mit einem Virus-RNA-Isolationskit nach dem Herstellerprotokoll (Tabelle der Materialien).
  2. Fügen Sie nach Zugabe der Probe zur Spalte einen on-column DNase-Behandlungsschritt hinzu, um die Entfernung der gesamten DNA in der Plasmaprobe sicherzustellen.
    1. Fügen Sie für jede Probe 95 L RNase-freie DNase-Lösung (Mix 2 L RNAse-freie DNase und 98 -L-Reaktionspuffer) in die Spalte und inkubieren Sie 15 min bei RT.
  3. Bewahren Sie die RNA-Proben vor der Weiterverarbeitung mindestens 1 h bei -80 °C auf. Es ist wichtig, alle Proben einzufrieren, nachdem die RNA-Extraktion das Risiko von Verzerrungen beim Vergleich von Proben, die nicht eingefroren wurden, mit Proben, die eingefroren wurden, vermeidet.
  4. Synthetisieren Sie cDNA mit einem Reverse-Transkriptase-Schritt mit Reagenzien, wie zuvorbeschrieben 20. Stellen Sie sicher, dass Sie der cDNA-Reaktion 0,5 l eines RNase-Inhibitors hinzufügen, um eine Verschlechterung der RNA zu vermeiden.
    1. Führen Sie die cDNA-Synthese mit dem in Tabelle 5beschriebenen Programm durch.
  5. Bewahren Sie die cDNA-Proben mindestens 1 h bei -80 °C auf. Es ist wichtig, alle Proben einzufrieren, nachdem die cDNA-Synthese das Risiko von Verzerrungen beim Vergleich von Proben, die nicht eingefroren wurden, mit Proben, die eingefroren wurden, vermeidet.
  6. Bereiten Sie Proben für ddPCR wie folgtvor 20:
    1. Mischen Sie 3 l der cDNA-Probe mit 11 l des ddPCR-Sondengemisches (keine dUTP)20, 250 nM-Moll-Nutbindungssonde und 900 nM jeder Vorwärts- und Rückwärtsgrundierung, wie in Tabelle 6beschrieben.
    2. Stellen Sie das gesamte PCR-Volumen mit nukleasefreiem Wasser auf 22 l ein.
  7. Emulgieren Sie die PCR-Mischungen mit Droplet Generation Oil für Sonden auf einem Tröpfchengenerator nach dem Herstellerprotokoll und früheren Beschreibungen20.
  8. Führen Sie das PCR-Programm wie in Tabelle 7beschrieben aus.
    HINWEIS: Die hier angezeigten Primer/Sondensequenzen und PCR-Programme wurden speziell für die empfindliche Erkennung des HIV-Stamms RHPA4259 entwickelt und optimiert. Primer- und Sondensequenzen können leicht angepasst werden, um jeden anderen HIV-Stamm ihrer Wahl zu erkennen.
  9. Erkennen Sie die Tröpfchenfluoreszenz aus den Proben auf einem Tröpfchenleser und analysieren Sie die Ergebnisse mit entsprechender Software gemäß dem Herstellerprotokoll.

11. Behandlung mit cART-haltigem Chow

  1. Füttern Sie Mäuse mit Pellets, die ein Standard-cART-Regime mit 4.800 mg/kg Raltegravir (RAL), 720 mg/kg Tenofovirdisdisoproxil-Fumarat (TDF) und 520 mg/kg Emtricitabin (FTC)21 (Tabelle 8) enthalten. Diese Dosen wurden unter der Annahme bestimmt, dass eine Maus 25 g wiegt und 4 g Chow pro Tag isst. Dies entspricht einer Tagesdosis von 768 mg/kg RAL, 2,88 mg/kg TDF und 83 mg/kg FTC21.
  2. Verwenden Sie eine cART-Diät, die von einem externen Anbieter (siehe Tabelle der Materialien)von verschreibungspflichtigen Medikamenten vorbereitet wurde. Andere Unternehmen könnten möglicherweise auch dieses Regime herstellen. Verwenden Sie eine cART-Diät rot gefärbt, um es leicht von gewöhnlichen Maus Chow zu unterscheiden.
    1. Produzieren Sie eine Kontroll-Chow-Diät ohne cART in einer Standard-Braunfarbe für eine einfache Unterscheidung.
  3. Für die Einleitung von cART, bereiten Sterile Mauskäfige mit der Zugabe von cART-haltigen Chow-Diät, und dann übertragen Sie die Mäuse aus dem alten Käfig in den neuen Käfig.
    1. Überwachen Sie die Gewichte der Mäuse und den Verzehr von cART-haltigem Chow durch visuelle Inspektion, um sicherzustellen, dass sich die Mäuse an die Veränderung anpassen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die Gating-Strategie zur Analyse der Stammzellreinheit ist in Abbildung 1dargestellt. Abbildung 1A–C zeigt die gereinigte CD34+-Population und Abbildung 1D–F, die CD34-Durchfluss, die verwendet wird, um zu veranschaulichen, dass die minimale Menge der CD34+-Population im Isolationsprozess verloren geht. Die Reinheit isolierter CD34+-Stammzellen lag zwischen 85% und 95% bei weniger als 1% T-Zell-Kontamination. Abbildung 1G zeigt CCR5-Bänder von einem erwachsenen menschlichen Kontrollspender mit dem GEnotyp CCR532/wt, gefolgt von Bändern von zwei CCR5-Wt/Wt- und einem CCR5-Stammzellspender. Die Häufigkeit des Genotyps CCR532/wt in einer Gruppe von 19 Spendern betrug 15,8% (Abbildung 1H). Dies stimmt mit größeren epidemiologischen Studienüberein 14,15 berichten über den Genotyp bei bis zu 23,6 % der untersuchten Personen in Dänemark.

Der humane CD45+-Spiegel in peripherem Blut von Mäusen wurde 3–5 Monate nach der Transplantation menschlicher CD34+-Stammzellen über Durchflusszytometrie untersucht. Die Gating-Strategie ist in Abbildung 2A–Edargestellt. Abbildung 3A und Abbildung 3B veranschaulichen die Variabilität zwischen 10 und 16 einzelnen Mäusen, die Stammzellen von zwei verschiedenen Spendern erhalten. Die Transplantation von 75.000 hCD34+ Zellen ergab 20%–50% menschliche CD45+ im peripheren Blut. Alle Mäuse entwickelten menschliche B- und T-Zellen, einschließlich CD4- und CD8+ T-Zellen.

Für atraumatische intravaginale Expositionen wurde das in Abbildung 4 dargestellte Setup verwendet. Mäuse wurden in einer geschlossenen Kammer beästheisiert und während der Exposition unter Anästhesie gehalten. Mäuse wurden mit der Vagina nach 5 min nach der Exposition gehalten, um eine Viruslösung mit Schleimhautoberflächen zu gewährleisten.

Abbildung 5A zeigt die mit diesem Modell beobachtete Erfolgsrate von 64 % bei der HIV-Übertragung. Mäuse wurden mit 21.400 infektiösen Einheiten (I.E.) von RHPA4259 intravaginal herausgefordert. Diese Dosis führte dazu, dass 64 % der Mäuse nach einer vaginalen Exposition HIV-infiziert wurden. Zum Vergleich sind Daten von zwei verschiedenen Kohorten von Mäusen enthalten, die über einen intravenösen Weg exponiert wurden. Wie erwartet, wurden 100% der Mäuse HIV+ mit ähnlichen Dosen von RHPA und einem zusätzlichen Stamm (YU2) auf diesem Weg.

Abbildung 5B zeigt repräsentative Ergebnisse von drei Mäusen, die mit HIV infiziert waren und auf eine Diät umgestellt wurden, die Standard-CART enthält. Mäuse wurden nach 40 Tagen cART wieder auf reguläres Maus-Chow umgestellt. Bei diesem Assay-Setup lag der Grenzwert für die Erkennung von Viruslasten bei 725 Kopien/ml. Virale Belastungen lagen alle unter der Nachweisgrenze nach 4 Wochen cART. Nach Beendigung von cART erholte sich das Virus und spiegelte die klinischen Daten22wider. Mäuse auf cART tolerierten die Änderung der Ernährung gut, wie in Abbildung 5Cangegeben.

Figure 1
Abbildung 1: Repräsentative Flusszytometrie-Gating-Strategie zur Validierung der Stammzellreinheit und des CCR5-Spendervariantenstatus. (AC) Die gating-Strategie, die für die isolierte CD34+-Zellpopulation verwendet wird. Doublets und Trümmer sind in Panel A bzw. B ausgeschlossen (FSC-A gegen FSC-H und FSC-A vs. SSC-A). (C) Die Häufigkeit von CD34+ Stammzellen und CD3+ T-Zellkontamination. (DF) Die CD34-Durchfluss-Gating-Strategie. Prozentsätze in Toren werden als Bruchteil der übergeordneten Grundgesamtheit berechnet. (G) Die Ergebnisse einer CCR5-32/-wt-PCR-Analyse. Spur 1: DNA eines menschlichenCCR5-Spenders, Spur 2 und 3: zwei CCR5-Wt/-Wt-Human-Stammzellspender,Spur 4: A CCR5-32/gew. (H) Die Häufigkeit des Genotyps CCR532/wt in unserer Gruppe von 19 Stammzellproben beträgt 15,8%. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Flusszytometrie-Gating-Strategie zur Validierung der menschlichen Zelltransplantation und -differenzierung. Die gesamte mononukleäre Zellpopulation von humanisierten Mäusen wurde mittels Durchflusszytometrie analysiert. (A) Der Prozentsatz der menschlichen CD45+-Zellen wurde als Bruchteil der gesamten aufgezeichneten Ereignisse bestimmt. (B) Doublets wurden anschließend aufgrund von FSC-A/FSC-H-Gating ausgeschlossen. (C) Die wahre Lymphozytenpopulation wurde anhand von Größe und Granularität definiert. (D) Lymphozyten wurden dann entweder als CD3+ (T-Zellen) oder CD19+ (B-Zellen) charakterisiert. (E) CD3+ T-Zellen waren entweder CD4+ T-Zellen oder CD8+ T-Zellen. Prozentsätze in Toren wurden als Bruchteil der übergeordneten Bevölkerung berechnet. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Repräsentative Humanisationswerte 4–5 Monate nach Stammzelltransplantation mit Zellsubtypfraktionen für 10 und 16 Mäuse, die von zwei verschiedenen menschlichen Spendern erzeugt wurden. (A) Die mononukleäre Zellpopulation (MNC) von 10 und (B) 16 humanisierte Mäuse wurden mittels Durchflusszytometrie analysiert und wie in Abbildung 2dargestellt. Der Anteil der menschlichen CD45+-Zellen wird als %hCD45 (des gesamten MNC) und %B- und %T-Zellen als Anteil von hCD45 dargestellt. T-Zellen wurden anschließend in %CD4 und %CD8 unterteilt. Jeder Datenpunkt stellt eine Maus dar. Die Daten werden als mittelwertige SD dargestellt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Experimentelle Laborbankeinrichtung für intravaginale Exposition von Mäusen. Experimentelles Setup für die HIV-Exposition von humanisierten Mäusen über den intravaginalen Weg. Das Verfahren wird in einer Durchflussbank durchgeführt, wo alle Reagenzien und Oberflächen vor der Verwendung sterilisiert wurden. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: Rate der ÜBERTRAGUNG von HIV-Stämmen durch verschiedene Expositionswege und Wirksamkeit und Sicherheit von cART-haltigem Chow bei der Virusunterdrückung. (A) Humanisierte NOG-Mäuse wurden erfolgreich mit zwei verschiedenen HIV-Stämmen entweder über den intravaginalen oder den intravenösen Weg infiziert. Mäuse wurden mit 21.400 IUs VON RHPA4259 intravaginal, 5.157 IUs IV mit RHPA4259 oder 3.000 IUs IV mit YU2 exponiert. Details zur IV-Exposition von humanisierten Mäusen sind in diesem Protokoll nicht enthalten. HIV-Infektionen wurden erfolgreich mit einem cART-Regime behandelt, das über Maus-Chow geliefert wurde. (B) Die Viruslast verringerte sich auf unter detektion für alle drei Mäuse auf cART und Rebound entstand nach der Beendigung von cART. Die gepunktete Linie gibt die Quantifizierungsgrenze bei 725 Kopien/ml an. Mäuse, die mit cART Chow gefüttert wurden, hatten eine ähnliche Gewichtsentwicklung wie Mäuse, die im gleichen Zeitraum auf Nicht-CART-Chow untergebracht waren, was auf keine Geschmackspräferenz oder Nebenwirkungen der cART-Diät hindeutet. (C) Gewichte werden im Vergleich zum Beginn von cART als Faltenänderung dargestellt. Jeder Datenpunkt stellt den Mittelwert von drei Tieren dar. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Antikörperziel Klon Fluorophor
CD3 Klon SK7 BUV395
CD34 Klon AC136 Fitc
CD45 Klon 2D1 Apc

Tabelle 1: Antikörper zur Bestimmung der Reinheit der Stammzellen. Vorgeschlagenes multicolor Flow Zytometrie-Panel zur Bewertung der Stammzellreinheit. Aufgeführt sind das Antikörperziel, der Klon und das Fluorophor.

CCR5-32-Erkennung Zündkapseln
Vorwärtsgrundierung 5'CTTCATTACTACTGCAGCT'3
Reverse Primer 5'TGAAGATAAGCCTCACAGCC'3

Tabelle 2: CCR5-32-Variantenerkennung PCR-Primer. Vorwärts- und Reverse-Primer, die zum Nachweis der 32-bp-Deletion im CCR5-Gen verwendet werden.

Nein. von Zyklen 1 45 1
Temperatur (°C) 98 98/63/72 72 10
Zeit 30 s 10 s/30 s/15 s 5 Min.

Tabelle 3: CCR5-32-VariantenerkennungPCR-Programm. PCR-Zyklusprogramm zur Verstärkung des CCR5-Gens.

Antikörperziel Klon Fluorophor
CD4 SK3 BUV 496
CD8 RPA-T8 BV421
CD3 OKT3 Fitc
CD19 sj25c1 PE-Cy7
CD45 2D1 Apc

Tabelle 4: Antikörper zur Bestimmung der Maushumanisierung. Vorgeschlagenes multicolor Flow Zytometrie-Panel für die Humanisierung. Aufgeführt sind das Antikörperziel, der Klon und das Fluorophor.

Nein. von Zyklen 1 1
Temperatur (°C) 51 80 4
Zeit 45 Min. 15 Min.

Tabelle 5: cDNA-Verstärkungsprogramm. Programm zur Amplifikation der komplementären Strang-DNA zur viralen RNA.

HIV-Quantifizierung Zündkapseln
Vorwärtsgrundierung 5'AGGGCAGCATAGAGCAAAAAA3
Reverse Primer 5'CAAAGGAATGGGGGTTCTTT'3
FAM-Sonde 5'ATCCCCACCAACAGATGC'3

Tabelle 6: HIV ddPCR Primer. Primer und Sonden zur ddPCR-Verstärkung viraler cDNA.

Nein. von Zyklen 1 39 1
Temperatur (°C) 95 95/54.5 98 4
Zeit 10 Min. 30 s/1 min 10 Min.

Tabelle 7: HIV ddPCR-Programm. PCR-Zyklusprogramm zur Amplifikation viraler RNA.

Raltegravir (RAL) 4800 mg/kg
Tenofovirdisdisoproxil-Fumarat (TDF) 720 mg/kg
Emtricitabin (FTC) 520 mg/kg

Tabelle 8: Maus cART Chow Diät. Maus-Chow-Diät wurde wie zuvor veröffentlichtformuliert 21. Die Chow-Diät wurde auf einer Basis von Standard-Maus-Chow gemacht, und nach der Produktion wurde das Essen mit 25 kGy bestrahlt und doppelt verpackt. Das Chow wurde bis zur Verwendung bei -20 °C gelagert.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Der stark immungeschwächte Mausstamm NOD. Cg-PrkdcscidIl2rgtm1Sug/JicTac (NOG) eignet sich hervorragend für die Transplantation menschlicher Zellen und Gewebe. Sowohl angeborene als auch adaptive Immunbahnen bei diesen Mäusen sind beeinträchtigt. NOG- und NSG-Mäuse beherbergen eine Prkdc-Cid-Mutation, die zu einer fehlerhaften T- und B-Zellfunktion führt. Darüber hinaus fehlt diesen Mäusen eine funktionelle Interleukin-2-Rezeptor-Kette (gemeinsame Gammakette, IL2rg), die in den Bindungskomplexen vieler wichtiger Zytokine wie IL-2, IL-4, IL-7, IL-9, IL-15 und IL-21 unverzichtbar ist. Immundefizienten Mäuse, wie das NOG, transplantiert mit einem menschlichen Immunsystem sind ein leistungsfähiges Werkzeug für die Untersuchung der HIV-Übertragung und Immunologie. Beiträge in diesen Bereichen, die mit humanisierten Mäusen gemacht wurden, wurden ausgiebig überprüft2,23,24,25,26. Die Verwendung dieser Mäuse zur Untersuchung von angeborenen Immunantworten beim Menschen gewinnt ebenfalls erhöhte Aufmerksamkeit27,28.

Ziel dieses Manuskripts ist es, ein umfassendes Protokoll von Maus- und ddPCR-Verfahren zu liefern, um von einer naiven Maus zu HIV-Übertragungs- und Behandlungsdaten zu gelangen. Unser System nutzte ddPCR zur Quantifizierung von viraler RNA und DNA. Bei einer ddPCR-Reaktion werden die Reaktanten in bis zu 20.000 Tröpfchen aufgeteilt, die jeweils eine einzige, separate Mikro-PCR-Reaktion enthalten. Die Verstärkung eines Ziels in einem Tröpfchen führt zu einem positiven fluoreszierenden Signal für dieses Tröpfchen. So ist die Auslesung binär und durch die Anwendung von Poisson statistischen Analysen kann die Anzahl der positiven Reaktionen direkt in eine Reihe von Vorlagenkopien in der Originalstichprobe übersetzt werden. Der Vorteil von ddPCR liegt in seiner Fähigkeit, ein Ziel unabhängig von einer Standardkurve direkt zu quantifizieren. Dies ist besonders attraktiv bei der Analyse von RNA-Proben, die aufgrund ihrer labilen Natur als PCR-Standardkurven zu verwenden sind29. Darüber hinaus ermöglicht die Binärität von ddPCR durch die Analyse mehrerer Replikate derselben Stichprobe und das Zusammenführen der einzelnen Datenpunkte für die endgültige Stichprobenquantifizierung die Erkennungsgrenze von Vorlagenkopien pro ml der Stichprobe29. Dies ist besonders wichtig bei einer humanisierten Mauseinstellung, bei der nur begrenztes Probenmaterial zur Verfügung steht und eine hohe Empfindlichkeit erforderlich ist.

Die Verabreichung von cART an humanisierte Mäuse kann entweder durch orale Gavage oder intraperitoneale Injektionen mit Lösungen von cART30,31,32und wie vor kurzem gezeigt, durch Formulierung in die Ernährung durchgeführt werden21. Eines unserer Hauptziele war die Einführung eines cART-Regimes in der Mausdiät, um die potenzielle Belastung der Tiere aufgrund der zusätzlichen Handhabungsschritte, die anderen Methoden der Arzneimittelabgabe innewohnen, zu verringern. Die Dosis des Arzneimittels, die eine Maus essen wird, kann auf der Grundlage der durchschnittlichen täglichen Nahrungsaufnahme der Mäuse33genau geschätzt werden. Die orale Lieferung durch die Diät dient als einfachste Lieferung mit minimalem Stress für das Tier und minimaler Arbeitsbelastung für den Handler. Wir basierten unsere Kombination von antiviralen Medikamenten auf frühere veröffentlichte Studien an humanisierten Mäusen21,30. Darüber hinaus ist unsere cART-Strategie klinisch relevant, da die klinisch eingesetzte Arzneimittelkombination von Patienten auf der ganzen Welt oral verabreicht wird.

Bestimmte Einschränkungen werden in Bezug auf die Verwendung von NOG-Mäusen festgestellt. Wichtig ist, dass menschliche T-Zellen in diesen Mäusen in einer mausthymischen Umgebung kultiviert werden, im Gegensatz zu einer menschlichen Umgebung. Der jüngste Fokus liegt auf der Erzeugung von Xenoempfängerstämmen, die ein günstiges Umfeld für die Entwicklung robuster menschlicher Immunantworten haben. Zu diesen neuen Stämmen gehören immundefizizizizizizizizizizizizizizizide Mäuse, die für menschliche MHC-Moleküle wie A2 transgen sind. Diese Modelle ermöglichen HLA-beschränkte Antigen-T-Zell-Antworten, die zu einer besseren Reifung und Effektorfunktionen des adaptiven Immunsystems34führen. Ein anderer Ansatz besteht darin, Mausgene durch wichtige menschliche Zytokine für IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38und IL-7/TSLP31zu ersetzen. Solche Modelle haben erhöhte Aufmerksamkeit für ihre Fähigkeit, eine bessere Differenzierung von angeborenen Zelltypen zu erzeugen gewonnen. Unser Protokoll ist leicht anpassungsfähig für die Humanisierung und HIV-Infektion von Mäusen mit einem solchen verbesserten genetischen Hintergrund immundefizienten Stamm.

Zusammenfassend lässt sich sagen, dass die Leichtigkeit und nützlichkeit des beschriebenen Ansatzes die Forschung in HIV-bezogenen Bereichen in vivo erleichtert. Humanisierte Mäuse können ein sehr leistungsfähiges Werkzeug sein, um die Forschung zu besseren Forschungshypothesen zu führen. Zusammen mit der Erzeugung von mehr "menschlichen" humanisierten Mäusen mit menschlichen Transgenen glauben wir, dass unser standardisiertes Protokoll zur Straffung der experimentellen Verfahren in verschiedenen Forschungsumgebungen beitragen wird.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären keine Interessenkonflikte.

Acknowledgments

Die Autoren danken den Mitarbeitern der Biomedicine Animal Facility an der Universität Aarhus, insbesondere Frau Jani Kér für die Erhaltung der Kolonien und für die Verfolgung von Mausgewichten. Die Autoren danken Professor Florian Klein für die Entwicklung von Standard-care cART und für die Beratung. Das folgende Reagenz wurde durch das NIH AIDS Reagenzprogramm, Abteilung AIDS, NIAID, NIH: pRHPA.c/2635 (Kat. 11744) von Dr. John Kappes und Dr. Christina Ochsenbauer erhalten.

Materials

Name Company Catalog Number Comments
Blue pad VWR 56616-031 Should be sterilized prior to use
Bovine serum albumin (BSA) Sigma A8022
CD19 (clone sj25c1) PE-Cy7 BD Bioscience 557835
CD3 (clone OKT3) FITC Biolegend 317306
CD3 (clone SK7) BUV395 BD Bioscience 564001
CD34 (clone AC136) FITC Miltenyi 130-113-740
CD4 (clone SK3) BUV 496 BD Bioscience 564652/51
CD45 (clone 2D1) APC Biolegend 368511/12
CD8 (clone RPA-T8) BV421 BD Bioscience 562428
ddPCR Supermix for probes (no dUTP) Bio-Rad 1863025
DMSO Merck 10,02,95,21,000
DNAse Sigma D4263 For suspension buffer
dNTP mix Life Technologies R0192
Dulbeccos phosphate-buffered saline (PBS) Biowest L0615-500
EasySep Human Cord Blood CD34 Positive Selection Kit II Stemcell 17896
EDTA Invitrogen 15575-038
FACS Lysing solution 10X BD 349202 Dilute 1:10 in dH20 immediately before use
FACS tubes (Falcon 5 mL round-botton) Falcon 352052
Fc Receptor blocking solution (Human Trustain FcX) Biolegend 422302
Fetal bovine serum Sigma F8192-500
Ficoll-Paque PLUS GE Healthcare 17144002
Flowjo v.10
Gauze Mesoft 157300 Should be sterilized prior to use
Heating lamp Custom made
Hemacytometer (Bürker-Türk) VWR DOWC1597418
Isoflurane gas Orion Pharma 9658
LSR Fortessa X20 flow cytometer BD
Microcentrifuge tubes, PCR-PT approved Sarstedt 72692405
Mouse cART food ssniff Spezialdiäten GmbH Custom made product
Mouse restrainer Custom made product
Needle, Microlance 3, 30G ½" BD 304000
NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac Taconic NOG-F
Nuclease-free water VWR chemicals 436912C
Nucleospin 96 Virus DNA and RNA isolation kit Macherey-Nagel 740691
PCR-approved microcentrifuge tubes Sarstedt 72.692.405
Penicillin-Streptomycin solution 100X Biowest L0022-100
Phusion Hot Start II DNA polymerase Life Technologies F549S
Pipette tips, sterile, ART 20P Barrier ThermoScientific 2149P
Proteinase K NEB 100005398
QuantaSoft software Bio-Rad
QX100 Droplet Generator Bio-Rad 1886-3008
QX100 Droplet Reader Bio-Rad 186-3003
RBC lysis solution Biolegend 420301
RNase-free DNAse size F + reaction buffer Macherey-Nagel 740963
RNAseOUT Recombinant Ribonuclease inhibitor ThermoScientific 10777-019
RPMI Biowest L0501-500 Dissolve in H20
Softject 1 mL syringe Henke Sass Wolf 5010-200V0
Superscript III Reverse Transcriptase ThermoFisher Scientific 18080044
Thermoshaker VWR 89370-910
Trypane blue Sigma T8154
Ultrapure 0.5 EDTA, pH 8.0 ThermoFisher Scientific 15575-020
Virkon S (virus disinfectant) Dupont 7511

DOWNLOAD MATERIALS LIST

References

  1. WHO. GHO | By category | Antiretroviral therapy coverage - Data and estimates by WHO region (2018). World Health Organization. Available from: http://apps.who.int/gho/data/node.main.626 (2018).
  2. Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. A Hitchhiker's guide to humanized mice: new pathways to studying viral infections. Immunology. 154, (1), 50-61 (2018).
  3. Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice. PLoS ONE. 5, (1), 8829 (2010).
  4. Zou, W., et al. Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes. Retrovirology. 9, (1), 44 (2012).
  5. Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- γc -/- (RAG-hu) mice. Virology. 373, (2), 342-351 (2008).
  6. Veselinovic, M., Charlins, P., Akkina, R. Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice. Methods Mol Biol. 203-220 (2016).
  7. Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice. PLoS ONE. 6, (6), 20209 (2011).
  8. Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model. PLoS ONE. 5, (12), 15257 (2010).
  9. Veselinovic, M., et al. HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model. Virology. 464-465, 253-263 (2014).
  10. Akkina, R., et al. Humanized Rag1-/-γc-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes. PLoS ONE. 6, (6), 20169 (2011).
  11. Zhou, J., et al. Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice. Molecular Therapy. 19, (12), 2228-2238 (2011).
  12. Balcombe, J. P., Barnard, N. D., Sandusky, C. Laboratory routines cause animal stress. Contemporary Topics in Laboratory Animal Science. 43, (6), 42-51 (2004).
  13. Trecarichi, E. M., et al. Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals. AIDS Research and Therapy. 3, (1), (2006).
  14. Novembre, J., Galvani, A. P., Slatkin, M. The geographic spread of the CCR5 Δ32 HIV-resistance allele. PLoS Biology. 3, (11), 1954-1962 (2005).
  15. Solloch, U. V., et al. Frequencies of gene variant CCR5-Δ32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers. Human Immunology. 78, (11-12), 710-717 (2017).
  16. Ochsenbauer, C., et al. Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages. Journal of Virology. 86, (5), 2715-2728 (2012).
  17. Andersen, A. H. F., et al. Long-Acting, Potent Delivery of Combination Antiretroviral Therapy. ACS Macro Letters. 7, (5), 587-591 (2018).
  18. Caro, A. C., Hankenson, F. C., Marx, J. O. Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters. Journal of the American Association for Laboratory Animal Science JAALAS. 52, (5), 577-583 (2013).
  19. Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Human Gene Therapy. 12, (9), 1079-1089 (2001).
  20. Leth, S., et al. HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy. AIDS. 30, (5), 713-721 (2016).
  21. Halper-Stromberg, A., et al. Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice. Cell. 158, (5), 989-999 (2014).
  22. Rothenberger, M. K., et al. Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption. Proceedings of the National Academy of Sciences. 112, (10), 1126-1134 (2015).
  23. Rongvaux, A., et al. Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine. Annual Review of Immunology. 31, (1), 635-674 (2013).
  24. Walsh, N. C., et al. Humanized Mouse Models of Clinical Disease. Annual Review of Pathology: Mechanisms of Disease. 12, (1), 187-215 (2017).
  25. Denton, P. W., García, J. V. Humanized mouse models of HIV infection. AIDS Reviews. 13, (3), 135-148 (2011).
  26. Denton, P. W., Søgaard, O. S., Tolstrup, M. Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research. Journal of Translational Medicine. 14, (1), (2016).
  27. Andersen, A. H. F., et al. cAIMP administration in humanized mice induces a chimerization-level-dependent STING response. Immunology. 157, (2), 163-172 (2019).
  28. Tanaka, S., et al. Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice. The Journal of Immunology. 188, (12), 6145-6155 (2012).
  29. Quan, P. L., Sauzade, M., Brouzes, E. DPCR: A technology review. Sensors (Switzerland). 18, (4), (2018).
  30. Denton, P. W., et al. Generation of HIV Latency in Humanized BLT Mice. Journal of Virology. 86, (1), 630-634 (2012).
  31. Li, Y., et al. A human immune system mouse model with robust lymph node development. Nature Methods. 15, (8), 623-630 (2018).
  32. Satheesan, S., et al. HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy. Journal of Virology. 92, (7), 02118 (2018).
  33. Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. Food intake, water intake, and drinking spout side preference of 28 mouse strains. Behavior Genetics. 32, (6), 435-443 (2002).
  34. Shultz, L. D., et al. Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice. Proceedings of the National Academy of Sciences. 107, (29), 13022-13027 (2010).
  35. Willinger, T., et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proceedings of the National Academy of Sciences. 108, (6), 2390-2395 (2011).
  36. Hanazawa, A., et al. Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice. Frontiers in Immunology. 9, FEB (2018).
  37. Huntington, N. D., et al. IL-15 trans-presentation promotes human NK cell development and differentiation in vivo. The Journal of Experimental Medicine. 206, (1), 25-34 (2009).
  38. Rongvaux, A., et al. Development and function of human innate immune cells in a humanized mouse model. Nature Biotechnology. 32, (4), 364-372 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics