Cuantificación de microorganismos ambientales y virus utilizando qPCR

Environmental Microbiology

Your institution must subscribe to JoVE's Environmental Sciences collection to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 1 hour trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Overview

Fuente: Laboratorios del Dr. Ian Pepper y el Dr. Charles Gerba - Universidad de Arizona
Demostrando autor: Bradley Schmitz

Reacción en cadena de la polimerasa cuantitativa (qPCR), también conocido como PCR en tiempo real, es una técnica molecular utilizada para la enumeración de microorganismos en el ambiente. Antes de este enfoque, cuantificación de microorganismos fue limitada en gran medida a las técnicas clásicas basadas en la cultura. Sin embargo, el cultivo de microbios de muestras ambientales puede ser particularmente difícil, y generalmente se mantiene número 1 y el 10% de los microorganismos presentes en muestras ambientales son detectable utilizando estas técnicas. El advenimiento de la qPCR en investigación Microbiología Ambiental por lo tanto ha avanzado el campo enormemente permitiendo más precisa determinación de las concentraciones de microorganismos como causantes de enfermedades de patógenos en muestras ambientales. Sin embargo, una limitación importante de qPCR como una técnica microbiológica aplicada es que viva y viables de las poblaciones no pueden ser distinguidas de poblaciones inactivas o inertes.

Este video muestra el uso de qPCR para detectar virus del moteado suave de pimienta de una muestra de agua ambiental.

Cite this Video

JoVE Science Education Database. Fundamentos de la Microbiología Ambiental. Cuantificación de microorganismos ambientales y virus utilizando qPCR. JoVE, Cambridge, MA, (2017).

Principles

Los principios básicos detrás de qPCR es igual a PCR regular – repetido ciclos de primer recocido a la plantilla, alargamiento del producto de PCR y la desnaturalización del producto de plantilla, conduciendo a la amplificación exponencial de una secuencia de destino de interés, conocido como el "amplicón", de una piscina de material de partida. La innovación de qPCR es en la adición de productos químicos fluorescentes en la reacción, que permite la síntesis del producto de PCR en cada ciclo para ser visualizados directamente en "tiempo real" por termocicladores especializados, lo que permite cuantificar la cantidad de secuencia de la plantilla en la muestra original. La cantidad se mide generalmente en términos del ciclo umbral (Ct, también conocido como ciclo de cuantificación o Cq), que es el ciclo de la polimerización en cadena en el que la cantidad de productos fluorescentes supera el nivel de fondo.

Cuantificación puede ser relativa, cuando el valor det de C de una secuencia es comparada con la de otra secuencia estándar o control. Alternativamente, si se ejecuta una serie de ADN de cantidad conocida junto con las muestras en la reacción, una "curva estándar" comparar valor de fluorescencia a la cantidad de ADN se puede producir y permite que el ADN de la muestra a cuantificarse absolutamente.

En un método de qPCR, un corto tramo de ADN, conocidas como punta de prueba, está diseñado contra una secuencia Diana de interés. La sonda se une químicamente a un colorante fluorescente, así como una molécula "quencher" que suprime la señal de fluorescencia del tinte cuando en proximidad cercana. La enzima polimerasa, que sintetiza el producto ADN, tiene una actividad degradante de ADN que la molécula fluorescente a liberarse de la sonda, así separando el tinte del extintor y permitiendo que la señal de fluorescencia para detectar. Niveles de fluoróforo se miden cuantitativamente después de cada PCR ciclo, con creciente fuerza señal correlacionar a niveles más altos de secuencias objetivo amplificado (llamado "amplicones") presentes en la muestra ambiental.

Procedure

1. muestras

  1. Recoger el suelo con una barrena o pala a una profundidad determinada. Recogida de suelo de la rizosfera, sólo recoger suelo de 7 mm alrededor de la raíz de la planta, por golpear el exceso de suciedad de la raíz y raspar el suelo deseada en un barril de la colección.
  2. Coloque una botella de Nalgene estéril en palillo de la inmersión. Sujete el extremo del palo y recoger agua sumergiendo la botella. Coloque la botella en una hielera con hielo.
  3. Transferencia de muestras al laboratorio.

2. los ácidos nucleicos extracción

  1. Para aislar microorganismos a partir de las muestras recolectadas y extraer DNA o RNA de ellos, por favor ver el video de Zeus Ciencias de la educación en la extracción de ácidos nucleicos de comunidad.

3. transcripción reversa

  1. Si el material genético se ensayaron es ARN, debe utilizarse para generar ADN complementario (ADNc) mediante transcripción inversa antes de proceder a la PCR. Para obtener más información, consulte educación JoVE video de RT-PCR.

4. configuración del qPCR

  1. Recuperar reactivos almacenados a-20 ° C y descongelarles en hielo o a temperatura ambiente dentro de una campana limpia. Reactivos utilizados en este ejemplo son la mezcla de reacción de qPCR (depende de la máquina de qPCR utilizado; contiene DNA polimerasa), cartillas de avance y retroceso y la sonda TaqMan. Las secuencias de la cartilla y la sonda están diseñadas con secuencias específicas en el organismo que se se enumeran. Se refieren a la literatura actual para encontrar secuencias de interés. En este ejemplo, se utilizará el sistema de reactivos Roche Light Cycler 480 puntas mezcla. Virus de moteado suave del pimiento se enumeran en la muestra de agua. 1.2 ver tabla 1 para la cartilla y sonda de secuencias.
  2. Deshielo extraído (c) el ADN de las muestras y el control positivo ADN (que se compone de secuencias específicas del organismo clonadas en plásmidos bacterianos) a temperatura ambiente.
  3. Preparar una plantilla de 96 celdas de tabla que se asemeja a la placa de 96 pocillos qPCR. Etiqueta de cada célula con la que se cargará sobre la placa de reacción. Incluyen reacciones para cada muestra y estándar por triplicado, así como para el control positivo y control negativo, como una reacción no-DNA.
  4. Calcular los volúmenes de reactivo necesarios para una reacción "master mix", que incluye todos los reactivos que son constantes entre las reacciones, basadas en las instrucciones del fabricante y de la literatura. Preparar suficiente mezcla maestra para reacciones por triplicado para todas las muestras y controles y un 10% adicional para tener en cuenta errores de pipeteo. Para un maestro muestra mezcla receta, refiérase a la tabla 2.
  5. Trabajando dentro de una campana de limpieza, una vez que todos los reactivos son completamente descongelados, agregar la cantidad calculada de cada reactivo en un tubo de microcentrífuga de 1,5 mL enlace de bajo para crear mix master. Vórtice y brevemente minicentrifuge cada reactivo antes de agregar. Cambiar la punta de la pipeta entre cada reactivo para evitar contaminación y asegurar concentraciones correctas. Después se han añadido los reactivos, vortex y minicentrifuge el tubo con la mezcla principal para asegurar la homogeneidad.
  6. Alícuota del volumen adecuado de mezcla principal en cada uno señalado en la placa PCR de 96 pocillos.
  7. Añadir el volumen adecuado de muestra de ADN (c), plásmido de control positivo y control negativo (agua grado molecular) en los pocillos designados.
  8. Una vez que se han añadido todas las muestras y los controles, placa del sello con papel de aluminio del lacre. Utilice una herramienta de sellado para empujar el aire hacia fuera de debajo de la hoja y evitar burbujas. Corte los bordes de la hoja con cuidado.
  9. Centrifugar la placa de 96 pocillos sellada en una centrifugadora con un sostenedor de la placa para obtener la mezcla en el fondo de cada pozo. Asegúrese de utilizar una placa de contrapeso para que la centrífuga equilibrará adecuadamente mientras gira. Pulse centrifugar a 1000 rpm y luego dejó la centrífuga lentamente deje sin frenos.

5. operación de qPCR

  1. Coloque la placa de 96 pocillos sellada en qPCR máquina. Asegúrese de que la máquina indica que está listo para comenzar.
  2. Siga las instrucciones de máquina de qPCR para ingresar correctamente toda la información necesaria por el software, luego fije el qPCR máquina para funcionar.
  3. Una vez finalizada la máquina funcione, el software será capaz de utilizar las concentraciones conocidas de control positivo para calcular la cantidad de cDNA en cada reacción. Entonces se puede calcular la cantidad de virus en la muestra original basada en la dilución, filtración, concentración, amplificación y procesos de extracción para obtener la muestra de ADN.
Reactivo de Secuencia (5' → 3') Volumen (μL / pozo) Concentrado final
Primer avance GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Primer revés TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Punta de prueba FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Tabla 1. Secuencias de la cartilla y la sonda de muestra para la detección de virus del moteado suave de la pimienta.

Reactivo de Volumen (μL / pozo) Número de pozos Master Mix volumen (μL)
Mezcla de LC 480 12.5 26 325
Molecular H2O 4.5 117
Primer avance 2.25 58.5
Primer revés 2.25 58.5
Punta de prueba 1.0 26
Total 22.5 585

Tabla 2. Volúmenes de reactivo para cada reacción y mezcla principal.

El advenimiento de la reacción en cadena de la polimerasa cuantitativa o qPCR, ha hecho posible determinar cuantitativamente la cantidad de cualquier microorganismo en una muestra ambiental.

Como estándar de PCR, qPCR identifica microorganismos mediante la detección de la presencia o ausencia de secuencias de ADN específicas a los organismos de interés. Esto permite la detección de microbios que no pueden cultivarse en el laboratorio, lo que es posible analizar una gama mucho más amplia de organismos ambientales. Además, qPCR permite la cantidad de ADN a ser evaluados cuantitativamente. Pero al mismo tiempo, metodologías PCR detectan ADN de todos los organismos vivo o muertos, limitando la capacidad de buscar sólo crecimiento microbios en la muestra.

Este video será revisar las innovaciones químicas que distinguen la qPCR de PCR regular, explicar cómo qPCR puede utilizarse para medir cuantitativamente el ADN, demostrar un protocolo para el uso de qPCR para detectar un virus de ARN de muestras de suelo y por último, mostramos cómo qPCR se aplica a la Microbiología Ambiental hoy.

Los principios básicos detrás de qPCR son los mismos que PCR regular - repetido ciclos de primer recocido a la plantilla, alargamiento del producto de PCR y la desnaturalización del producto de plantilla, conduciendo a la amplificación exponencial de una secuencia de destino de interés, conocido como el amplicon, de una piscina de material de partida.

La innovación de qPCR es en la adición de productos químicos fluorescentes en la reacción, que permite la síntesis del producto de PCR en cada ciclo para ser visualizados directamente en "tiempo real" por termocicladores especializados, lo que permite cuantificar la cantidad de secuencia de la plantilla en la muestra original. La cantidad se mide generalmente en términos del ciclo umbral, abreviado Ct, también conocido como ciclo de cuantificación o Cq, que es el ciclo de la polimerización en cadena en el que la cantidad de productos fluorescentes supera el nivel de fondo.

Cuantificación puede ser relativa, cuando el valor det de C de una secuencia es comparada con la de otra secuencia estándar o control; la cantidad relativa es igual a dos elevado a la potencia de la diferencia de Ct. Alternativamente, si se ejecuta una serie de ADN de cantidad conocida junto con las muestras en la reacción, una curva estándar de comparar valor de fluorescencia a la cantidad de ADN se puede producir y permite que el ADN de la muestra a cuantificarse absolutamente.

Hay dos tipos generales de moléculas fluorescentes utilizados en qPCR. En un caso, tintes fluorescentes que se unen específicamente a ADN de doble hebra se incluye en la reacción. El tinte aparece sólo cuando ligada a ADN, por lo que la cantidad de producto de ADN de doble hebra a cuantificarse.

En el otro método, un corto tramo de ADN, conocidas como punta de prueba, está diseñado contra una secuencia Diana de interés. La sonda se une químicamente a un colorante fluorescente, así como una molécula "quencher" que suprime la señal de fluorescencia del tinte cuando en proximidad cercana. La enzima polimerasa, que sintetiza el producto ADN, tiene una actividad degradante de ADN que la molécula fluorescente a "liberarse" de la sonda, así separando el tinte del extintor y permitiendo que la señal de fluorescencia para detectar.

Ahora que usted entiende los principios detrás de qPCR, echemos un vistazo a un protocolo para el uso de esta técnica a la identificación de un virus ARN que infecta plantas, el virus del moteado suave de pimienta, de muestras de suelo.

En esta demostración, se recogerán muestras de la rizosfera, la zona de suelo aproximadamente de 7 mm alrededor de las raíces de la planta que está influenciado por las raíces y sus microorganismos simbióticos.

A recoger suelo de rizosfera, primero cuidadosamente extraer la planta de interés desde el suelo y golpear para eliminar todo el exceso a granel del suelo como sea posible. Paquete de la planta para su posterior procesamiento en el laboratorio.

Después de traer las muestras hacia el laboratorio, utilizar una espátula estéril para el desguace el suelo deseado en un vaso de colección. Luego, recoger el virus desde el suelo y extraer el RNA.

Una vez que la RNA es recogida de la muestra, se convierte en complementario o ADNc mediante transcripción inversa. Por favor, consulte el SciEd de JoVE video de transcripción reversa-PCR para los detalles de este procedimiento.

Cuando esté listo para llevar a cabo la qPCR, descongelar los congelados reactivos a temperatura ambiente dentro de una campana de flujo laminar dedicado y coloque en hielo descongelado. Componentes reactivos que contienen la enzima ADN polimerasa siempre debe mantenerse en hielo.

Descongele el cDNA de la muestra y el control positivo ADN, como un pedazo circular de ADN conocidas como un plásmido que tiene el amplicon de interés clonados en él.

Antes de ensamblar las reacciones en una placa de 96 pocillos qPCR, preparar una plantilla de 96 celdas de tabla en el papel y cada célula con la reacción que se cargarán en la placa de la etiqueta. Incluyen reacciones para cada muestra y estándar por triplicado, así como para el control positivo y control negativo, como una reacción no-DNA.

Calcular los volúmenes de reactivo necesarios para una reacción "master mix", que incluye todos los reactivos que son constantes entre las reacciones. Preparar suficiente mezcla maestra para reacciones por triplicado para todas las muestras y controles y un 10% adicional para tener en cuenta errores de pipeteo.

Una vez que los reactivos son descongelados, montar la mezcla principal en un tubo de microcentrífuga de 1,5 mL baja adsorción. Para ello, brevemente vortex cada reactivo a mezclar bien, recoger cualquier líquido en el lado de los tubos utilizando una mini centrífuga y pipetear el reactivo en el tubo de microcentrífuga. Asegúrese de usar puntas de pipeta nueva para cada componente de la reacción. Después de todos los reactivos se han añadido, vortex para mezclar y centrifugar. Entonces, alícuota la cantidad apropiada de mezcla principal en los pocillos designados en la placa de la polimerización en cadena.

A continuación, vortex y centrifugar cada tubo con la muestra y el control de ADN y pipetear la cantidad apropiada en los pocillos respectivos en la placa de la polimerización en cadena. Una vez que las muestras se han agregado, sellar la placa con una papel selladora y utilizar la herramienta selladora aplanar el sello y expulsar cualquier burbuja de aire. Rasgue con cuidado las lengüetas no adhesiva de los extremos del sello.

Para recoger completamente la mezcla de reacción en la parte inferior de los pozos, coloque la placa de reacción en una centrifugadora con un sostenedor de la placa y equilibrar adecuadamente el rotor con una placa de contrapeso. Centrifugadora de pulso la placa hasta 1.000 rpm, entonces permita que la centrifugadora lentamente a una parada sin frenos.

Coloque la placa de reacción en la máquina de la qPCR. Establecer el programa PCR según la especificación del fabricante, ajuste la temperatura de fusión según el par de la cartilla se utiliza. Establecer el programa de reacción para ejecutarse.

Una vez terminado el programa de qPCR, el software será capaz de utilizar las concentraciones conocidas de control positivo para calcular la cantidad de cDNA en cada reacción. Entonces se puede calcular la cantidad de virus en la muestra original.

Una vez terminado el programa de qPCR, el software será capaz de utilizar las concentraciones conocidas de control positivo para calcular la cantidad de cDNA en cada reacción.

Con los resultados de la qPCR, el volumen transferido en los pozos, la extracción de suelo y el factor de la transcripción reversa, se puede calcular el número de virus en la muestra de suelo inicial.

Ahora que sabes cómo se realiza la qPCR, veamos cómo puede utilizarse para analizar diferentes muestras ambientales.

qPCR puede utilizarse para cuantificar la cantidad de virus de muchos tipos de muestras. En esta aplicación, dos tipos diferentes de adenovirus se concentra a partir de muestras de agua por una serie de métodos diferentes. ADN fue extraído de los virus y sometido a la qPCR, para evaluar la eficiencia relativa de los métodos de concentración.

Otra aplicación para el recuento microbiano basado en qPCR es cuantificar el contenido bacteriano en muestras alimentarias y agrícolas - en este ejemplo, fecal y las muestras de granjas de pollo de la camada. En lugar de dirigidas a especies individuales, los científicos realizaron qPCR utilizando cebadores contra un gen altamente conservado que se encuentra en todas las bacterias y cuantificaron la total comunidad bacteriana encontrada en las muestras.

Finalmente, como se mencionó anteriormente, una de las desventajas de la metodología tradicional de la qPCR es que microbios vivos y muertos no pueden ser distinguidos. Sin embargo, mediante la adición de un químico conocido como monoazide de propidio, o PMA, que sólo puede entrar células muertas donde se une al ADN para inhibir reacciones enzimáticas posteriores como PCR, los investigadores aquí fueron capaces de distinguir entre las culturas vivas y muertas de e. coli O157: H7, una cepa patogénica común en agua y alimentos contaminados.

Sólo ha visto la introducción de Zeus para cuantificar microorganismos ambientales y los virus mediante qPCR. Ahora debe entender cómo funciona la qPCR, cómo utilizar qPCR para medir la cantidad de un microbio en una muestra ambiental y algunas aplicaciones de esta técnica. ¡Gracias por ver!

Applications and Summary

La capacidad de cuantificar objetivo segmento genómico copias utilizando la técnica de qPCR es de importancia en un número de campos científicos. Aplicaciones de ejemplo incluyen:

(1) la enumeración de patógenos en el agua, suelo, alimentos, superficies, etcetera.

PCR en tiempo real se utiliza para enumerar patógenos en varios ambientes. Durante los brotes, se pueden analizar muestras de agua y suelo para el patógeno de interés para encontrar la fuente que causa propagación. La fuente puede entonces analizarse más para enumerar la concentración del patógeno y determinar el grado de contaminación. Por ejemplo, durante un brote de norovirus en un crucero que ha causado severa gastroenteritis, vómitos y diarrea que entre los pasajeros, las muestras de agua y los alimentos pueden ser sometidas a PCR en tiempo real para identificar la fuente del virus, por ejemplo, agua que no fue tratada correctamente y contiene alta contaminación fecal.

(2) medir la reducción de microbios patógenos por tratamiento de aguas residuales

Agua aguas residuales contiene una abundancia de enfermedad-causar microorganismos y por lo tanto debe ser tratado con el fin de proteger la salud pública. Muestras de agua se pueden recoger en diferentes puntos a lo largo de un tren de tratamiento de aguas residuales y analizan usando qPCR para determinar la reducción en los niveles de microorganismos patógenos como los virus. La reducción calculada entonces proporciona información valiosa en cuanto a la eficacia de procesos de tratamiento de aguas residuales y posibles aplicaciones de reutilización de agua.

(3) medición de marcadores de genes funcionales en el medio ambiente

Las comunidades microbianas están sujetos a cambios en la membresía y las fluctuaciones en la actividad debido a las presiones ambientales. Estos cambios pueden controlarse mediante análisis de genes funcionales que podrían activarse por estresores ambientales particulares. PCR en tiempo real puede utilizarse para cuantificar la expresión de estos genes en las muestras para monitorizar los cambios en la actividad de la comunidad microbiana. Por ejemplo, qPCR permite ecologistas microbianos cuantificar la expresión de los genes activados para rutas de biodegradación en la presencia de contaminantes artificiales presentes en los suelos.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

1. muestras

  1. Recoger el suelo con una barrena o pala a una profundidad determinada. Recogida de suelo de la rizosfera, sólo recoger suelo de 7 mm alrededor de la raíz de la planta, por golpear el exceso de suciedad de la raíz y raspar el suelo deseada en un barril de la colección.
  2. Coloque una botella de Nalgene estéril en palillo de la inmersión. Sujete el extremo del palo y recoger agua sumergiendo la botella. Coloque la botella en una hielera con hielo.
  3. Transferencia de muestras al laboratorio.

2. los ácidos nucleicos extracción

  1. Para aislar microorganismos a partir de las muestras recolectadas y extraer DNA o RNA de ellos, por favor ver el video de Zeus Ciencias de la educación en la extracción de ácidos nucleicos de comunidad.

3. transcripción reversa

  1. Si el material genético se ensayaron es ARN, debe utilizarse para generar ADN complementario (ADNc) mediante transcripción inversa antes de proceder a la PCR. Para obtener más información, consulte educación JoVE video de RT-PCR.

4. configuración del qPCR

  1. Recuperar reactivos almacenados a-20 ° C y descongelarles en hielo o a temperatura ambiente dentro de una campana limpia. Reactivos utilizados en este ejemplo son la mezcla de reacción de qPCR (depende de la máquina de qPCR utilizado; contiene DNA polimerasa), cartillas de avance y retroceso y la sonda TaqMan. Las secuencias de la cartilla y la sonda están diseñadas con secuencias específicas en el organismo que se se enumeran. Se refieren a la literatura actual para encontrar secuencias de interés. En este ejemplo, se utilizará el sistema de reactivos Roche Light Cycler 480 puntas mezcla. Virus de moteado suave del pimiento se enumeran en la muestra de agua. 1.2 ver tabla 1 para la cartilla y sonda de secuencias.
  2. Deshielo extraído (c) el ADN de las muestras y el control positivo ADN (que se compone de secuencias específicas del organismo clonadas en plásmidos bacterianos) a temperatura ambiente.
  3. Preparar una plantilla de 96 celdas de tabla que se asemeja a la placa de 96 pocillos qPCR. Etiqueta de cada célula con la que se cargará sobre la placa de reacción. Incluyen reacciones para cada muestra y estándar por triplicado, así como para el control positivo y control negativo, como una reacción no-DNA.
  4. Calcular los volúmenes de reactivo necesarios para una reacción "master mix", que incluye todos los reactivos que son constantes entre las reacciones, basadas en las instrucciones del fabricante y de la literatura. Preparar suficiente mezcla maestra para reacciones por triplicado para todas las muestras y controles y un 10% adicional para tener en cuenta errores de pipeteo. Para un maestro muestra mezcla receta, refiérase a la tabla 2.
  5. Trabajando dentro de una campana de limpieza, una vez que todos los reactivos son completamente descongelados, agregar la cantidad calculada de cada reactivo en un tubo de microcentrífuga de 1,5 mL enlace de bajo para crear mix master. Vórtice y brevemente minicentrifuge cada reactivo antes de agregar. Cambiar la punta de la pipeta entre cada reactivo para evitar contaminación y asegurar concentraciones correctas. Después se han añadido los reactivos, vortex y minicentrifuge el tubo con la mezcla principal para asegurar la homogeneidad.
  6. Alícuota del volumen adecuado de mezcla principal en cada uno señalado en la placa PCR de 96 pocillos.
  7. Añadir el volumen adecuado de muestra de ADN (c), plásmido de control positivo y control negativo (agua grado molecular) en los pocillos designados.
  8. Una vez que se han añadido todas las muestras y los controles, placa del sello con papel de aluminio del lacre. Utilice una herramienta de sellado para empujar el aire hacia fuera de debajo de la hoja y evitar burbujas. Corte los bordes de la hoja con cuidado.
  9. Centrifugar la placa de 96 pocillos sellada en una centrifugadora con un sostenedor de la placa para obtener la mezcla en el fondo de cada pozo. Asegúrese de utilizar una placa de contrapeso para que la centrífuga equilibrará adecuadamente mientras gira. Pulse centrifugar a 1000 rpm y luego dejó la centrífuga lentamente deje sin frenos.

5. operación de qPCR

  1. Coloque la placa de 96 pocillos sellada en qPCR máquina. Asegúrese de que la máquina indica que está listo para comenzar.
  2. Siga las instrucciones de máquina de qPCR para ingresar correctamente toda la información necesaria por el software, luego fije el qPCR máquina para funcionar.
  3. Una vez finalizada la máquina funcione, el software será capaz de utilizar las concentraciones conocidas de control positivo para calcular la cantidad de cDNA en cada reacción. Entonces se puede calcular la cantidad de virus en la muestra original basada en la dilución, filtración, concentración, amplificación y procesos de extracción para obtener la muestra de ADN.
Reactivo de Secuencia (5' → 3') Volumen (μL / pozo) Concentrado final
Primer avance GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Primer revés TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Punta de prueba FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Tabla 1. Secuencias de la cartilla y la sonda de muestra para la detección de virus del moteado suave de la pimienta.

Reactivo de Volumen (μL / pozo) Número de pozos Master Mix volumen (μL)
Mezcla de LC 480 12.5 26 325
Molecular H2O 4.5 117
Primer avance 2.25 58.5
Primer revés 2.25 58.5
Punta de prueba 1.0 26
Total 22.5 585

Tabla 2. Volúmenes de reactivo para cada reacción y mezcla principal.

El advenimiento de la reacción en cadena de la polimerasa cuantitativa o qPCR, ha hecho posible determinar cuantitativamente la cantidad de cualquier microorganismo en una muestra ambiental.

Como estándar de PCR, qPCR identifica microorganismos mediante la detección de la presencia o ausencia de secuencias de ADN específicas a los organismos de interés. Esto permite la detección de microbios que no pueden cultivarse en el laboratorio, lo que es posible analizar una gama mucho más amplia de organismos ambientales. Además, qPCR permite la cantidad de ADN a ser evaluados cuantitativamente. Pero al mismo tiempo, metodologías PCR detectan ADN de todos los organismos vivo o muertos, limitando la capacidad de buscar sólo crecimiento microbios en la muestra.

Este video será revisar las innovaciones químicas que distinguen la qPCR de PCR regular, explicar cómo qPCR puede utilizarse para medir cuantitativamente el ADN, demostrar un protocolo para el uso de qPCR para detectar un virus de ARN de muestras de suelo y por último, mostramos cómo qPCR se aplica a la Microbiología Ambiental hoy.

Los principios básicos detrás de qPCR son los mismos que PCR regular - repetido ciclos de primer recocido a la plantilla, alargamiento del producto de PCR y la desnaturalización del producto de plantilla, conduciendo a la amplificación exponencial de una secuencia de destino de interés, conocido como el amplicon, de una piscina de material de partida.

La innovación de qPCR es en la adición de productos químicos fluorescentes en la reacción, que permite la síntesis del producto de PCR en cada ciclo para ser visualizados directamente en "tiempo real" por termocicladores especializados, lo que permite cuantificar la cantidad de secuencia de la plantilla en la muestra original. La cantidad se mide generalmente en términos del ciclo umbral, abreviado Ct, también conocido como ciclo de cuantificación o Cq, que es el ciclo de la polimerización en cadena en el que la cantidad de productos fluorescentes supera el nivel de fondo.

Cuantificación puede ser relativa, cuando el valor det de C de una secuencia es comparada con la de otra secuencia estándar o control; la cantidad relativa es igual a dos elevado a la potencia de la diferencia de Ct. Alternativamente, si se ejecuta una serie de ADN de cantidad conocida junto con las muestras en la reacción, una curva estándar de comparar valor de fluorescencia a la cantidad de ADN se puede producir y permite que el ADN de la muestra a cuantificarse absolutamente.

Hay dos tipos generales de moléculas fluorescentes utilizados en qPCR. En un caso, tintes fluorescentes que se unen específicamente a ADN de doble hebra se incluye en la reacción. El tinte aparece sólo cuando ligada a ADN, por lo que la cantidad de producto de ADN de doble hebra a cuantificarse.

En el otro método, un corto tramo de ADN, conocidas como punta de prueba, está diseñado contra una secuencia Diana de interés. La sonda se une químicamente a un colorante fluorescente, así como una molécula "quencher" que suprime la señal de fluorescencia del tinte cuando en proximidad cercana. La enzima polimerasa, que sintetiza el producto ADN, tiene una actividad degradante de ADN que la molécula fluorescente a "liberarse" de la sonda, así separando el tinte del extintor y permitiendo que la señal de fluorescencia para detectar.

Ahora que usted entiende los principios detrás de qPCR, echemos un vistazo a un protocolo para el uso de esta técnica a la identificación de un virus ARN que infecta plantas, el virus del moteado suave de pimienta, de muestras de suelo.

En esta demostración, se recogerán muestras de la rizosfera, la zona de suelo aproximadamente de 7 mm alrededor de las raíces de la planta que está influenciado por las raíces y sus microorganismos simbióticos.

A recoger suelo de rizosfera, primero cuidadosamente extraer la planta de interés desde el suelo y golpear para eliminar todo el exceso a granel del suelo como sea posible. Paquete de la planta para su posterior procesamiento en el laboratorio.

Después de traer las muestras hacia el laboratorio, utilizar una espátula estéril para el desguace el suelo deseado en un vaso de colección. Luego, recoger el virus desde el suelo y extraer el RNA.

Una vez que la RNA es recogida de la muestra, se convierte en complementario o ADNc mediante transcripción inversa. Por favor, consulte el SciEd de JoVE video de transcripción reversa-PCR para los detalles de este procedimiento.

Cuando esté listo para llevar a cabo la qPCR, descongelar los congelados reactivos a temperatura ambiente dentro de una campana de flujo laminar dedicado y coloque en hielo descongelado. Componentes reactivos que contienen la enzima ADN polimerasa siempre debe mantenerse en hielo.

Descongele el cDNA de la muestra y el control positivo ADN, como un pedazo circular de ADN conocidas como un plásmido que tiene el amplicon de interés clonados en él.

Antes de ensamblar las reacciones en una placa de 96 pocillos qPCR, preparar una plantilla de 96 celdas de tabla en el papel y cada célula con la reacción que se cargarán en la placa de la etiqueta. Incluyen reacciones para cada muestra y estándar por triplicado, así como para el control positivo y control negativo, como una reacción no-DNA.

Calcular los volúmenes de reactivo necesarios para una reacción "master mix", que incluye todos los reactivos que son constantes entre las reacciones. Preparar suficiente mezcla maestra para reacciones por triplicado para todas las muestras y controles y un 10% adicional para tener en cuenta errores de pipeteo.

Una vez que los reactivos son descongelados, montar la mezcla principal en un tubo de microcentrífuga de 1,5 mL baja adsorción. Para ello, brevemente vortex cada reactivo a mezclar bien, recoger cualquier líquido en el lado de los tubos utilizando una mini centrífuga y pipetear el reactivo en el tubo de microcentrífuga. Asegúrese de usar puntas de pipeta nueva para cada componente de la reacción. Después de todos los reactivos se han añadido, vortex para mezclar y centrifugar. Entonces, alícuota la cantidad apropiada de mezcla principal en los pocillos designados en la placa de la polimerización en cadena.

A continuación, vortex y centrifugar cada tubo con la muestra y el control de ADN y pipetear la cantidad apropiada en los pocillos respectivos en la placa de la polimerización en cadena. Una vez que las muestras se han agregado, sellar la placa con una papel selladora y utilizar la herramienta selladora aplanar el sello y expulsar cualquier burbuja de aire. Rasgue con cuidado las lengüetas no adhesiva de los extremos del sello.

Para recoger completamente la mezcla de reacción en la parte inferior de los pozos, coloque la placa de reacción en una centrifugadora con un sostenedor de la placa y equilibrar adecuadamente el rotor con una placa de contrapeso. Centrifugadora de pulso la placa hasta 1.000 rpm, entonces permita que la centrifugadora lentamente a una parada sin frenos.

Coloque la placa de reacción en la máquina de la qPCR. Establecer el programa PCR según la especificación del fabricante, ajuste la temperatura de fusión según el par de la cartilla se utiliza. Establecer el programa de reacción para ejecutarse.

Una vez terminado el programa de qPCR, el software será capaz de utilizar las concentraciones conocidas de control positivo para calcular la cantidad de cDNA en cada reacción. Entonces se puede calcular la cantidad de virus en la muestra original.

Una vez terminado el programa de qPCR, el software será capaz de utilizar las concentraciones conocidas de control positivo para calcular la cantidad de cDNA en cada reacción.

Con los resultados de la qPCR, el volumen transferido en los pozos, la extracción de suelo y el factor de la transcripción reversa, se puede calcular el número de virus en la muestra de suelo inicial.

Ahora que sabes cómo se realiza la qPCR, veamos cómo puede utilizarse para analizar diferentes muestras ambientales.

qPCR puede utilizarse para cuantificar la cantidad de virus de muchos tipos de muestras. En esta aplicación, dos tipos diferentes de adenovirus se concentra a partir de muestras de agua por una serie de métodos diferentes. ADN fue extraído de los virus y sometido a la qPCR, para evaluar la eficiencia relativa de los métodos de concentración.

Otra aplicación para el recuento microbiano basado en qPCR es cuantificar el contenido bacteriano en muestras alimentarias y agrícolas - en este ejemplo, fecal y las muestras de granjas de pollo de la camada. En lugar de dirigidas a especies individuales, los científicos realizaron qPCR utilizando cebadores contra un gen altamente conservado que se encuentra en todas las bacterias y cuantificaron la total comunidad bacteriana encontrada en las muestras.

Finalmente, como se mencionó anteriormente, una de las desventajas de la metodología tradicional de la qPCR es que microbios vivos y muertos no pueden ser distinguidos. Sin embargo, mediante la adición de un químico conocido como monoazide de propidio, o PMA, que sólo puede entrar células muertas donde se une al ADN para inhibir reacciones enzimáticas posteriores como PCR, los investigadores aquí fueron capaces de distinguir entre las culturas vivas y muertas de e. coli O157: H7, una cepa patogénica común en agua y alimentos contaminados.

Sólo ha visto la introducción de Zeus para cuantificar microorganismos ambientales y los virus mediante qPCR. Ahora debe entender cómo funciona la qPCR, cómo utilizar qPCR para medir la cantidad de un microbio en una muestra ambiental y algunas aplicaciones de esta técnica. ¡Gracias por ver!

A subscription to JoVE is required to view this article.
You will only be able to see the first 20 seconds.

RECOMMEND JoVE