Quantification de qPCR environnement microorganismes et virus à l’aide

Environmental Microbiology

Your institution must subscribe to JoVE's Environmental Sciences collection to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 1 hour trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Overview

Source : Laboratoires du Dr Ian poivre et Dr Charles Gerba - Université de l’Arizona
Auteur mettant en évidence : Bradley Schmitz

Réaction en chaîne par polymérase quantitative (qPCR), également connu sous le nom de PCR en temps réel, est une technique moléculaire largement utilisé pour la numération des microorganismes dans l’environnement. Avant cette approche, quantification des microorganismes se limitait essentiellement à des techniques classiques de culture-basée. Cependant, la mise en culture de microbes d’échantillons environnementaux peut être particulièrement difficile, et il est généralement jugé qu’aussi peu que 1 à 10 % des micro-organismes présents dans les échantillons environnementaux sont détectables à l’aide de ces techniques. L’avènement de qPCR en recherche en microbiologie environnementale a avancé donc considérablement le domaine en tenant compte de la détermination plus précise des concentrations de microorganismes pathogènes tels que les agents pathogènes dans les échantillons environnementaux. Toutefois, une limitation importante de qPCR comme une technique microbiologique appliquée est que les populations vivantes et viables ne peuvent être distinguées des populations inactives ou non vivant.

Cette vidéo illustre l’utilisation de qPCR pour détecter les virus doux de marbrure du poivre d’un échantillon d’eau de l’environnement.

Cite this Video

JoVE Science Education Database. Essentiels de la microbiologie environnementale. Quantification de qPCR environnement microorganismes et virus à l’aide. JoVE, Cambridge, MA, (2017).

Principles

Les principes de base derrière qPCR est le même que PCR régulière – répété des cycles d’apprêt recuit au modèle, allongement du produit PCR et la dénaturation du produit de modèle, conduisant à l’exponentielle amplification d’une séquence cible des intérêts, connu comme le « amplicon », auprès d’un pool de matière première. L’innovation de qPCR est dans l’ajout de produits chimiques fluorescents dans la réaction, ce qui permet la synthèse du produit PCR à chaque cycle à visualiser directement en « temps réel » par thermocycleurs spécialisés, permettant de quantifier la quantité de séquence de modèle dans l’échantillon original. La quantité est habituellement mesurée en ce qui concerne le cycle seuil (Ct, également connu sous le nom cycle de quantification ou Cq), qui correspond au cycle PCR à partir duquel la quantité de produits fluorescents dépasse le niveau de fond.

Quantification peut être relative, où la valeur det C d’une seule séquence est comparée à celle d’une autre séquence standard ou contrôle. Sinon, si une série d’ADN de quantité connue est longent les échantillons dans la réaction, une « courbe d’étalonnage » en comparant la valeur de fluorescence à la quantité d’ADN peut être produite et permet à l’ADN de l’échantillon être dosée absolument.

Dans une méthode de qPCR, une petite portion d’ADN, connu comme une sonde, est conçue contre une séquence cible spécifique d’intérêt. La sonde est liée chimiquement à un colorant fluorescent, mais aussi une molécule « extincteur » qui supprime le signal de fluorescence de la teinture quand à proximité. L’enzyme polymérase, qui synthétise le produit de l’ADN, a une activité capables de dégrader l’ADN qui causerait la molécule fluorescente d’être libéré de la sonde, donc qui la sépare de la teinture de l’extincteur et permettant de détecter le signal de fluorescence. Les niveaux de fluorophore sont mesurés quantitativement après chaque PCR cycle, avec force de signal croissant corrélant aux niveaux supérieurs de séquences cibles amplifié (appelés « amplicons ») présents dans l’échantillon environnemental.

Procedure

1. le prélèvement

  1. Recueillir le sol à l’aide d’une tarière ou pelle à une profondeur déterminée. Si collecte du sol de la rhizosphère, ne recueillons sol intérieur 7 mm autour des racines de la plante, en frappant des excès de saleté hors de la racine et grattage sol souhaité dans un tonneau de collection.
  2. Placez une bouteille Nalgene stérile en trempant le bâtonnet. Tenez l’extrémité du bâton et de recueillir l’eau en immergeant la bouteille. Placer la bouteille dans une glacière avec de la glace.
  3. Transfert des échantillons au laboratoire.

2. Extraction des acides nucléiques

  1. D’isoler des micro-organismes dans les échantillons recueillis et pour en extraire l’ADN et/ou de l’ARN, s’il vous plaît voir la vidéo de l’enseignement des sciences JoVE sur l’extraction des acides nucléiques communautaire.

3. Transcription inverse

  1. Si le matériel génétique étant dosé est RNA, il doit servir à générer l’ADN complémentaire (ADNc) par transcription inverse avant de procéder à la PCR. Pour plus de détails, veuillez consulter JoVE Science Education vidéo sur RT-PCR.

4. mise en place de qPCR

  1. Récupérer les réactifs stockés à-20 ° C et les décongeler sur glace ou à température ambiante à l’intérieur d’une hotte propre. Réactifs utilisés dans cet exemple comprennent le mélange réactionnel de qPCR (dépendant de la machine de qPCR utilisé ; contient l’ADN polymérase), amorces et inverses et la sonde TaqMan. Les séquences d’amorce et de sonde sont conçus avec des séquences spécifiques de l’organisme qui est énuméré. Reportez-vous à la documentation actuelle de trouver des séquences d’intérêt. Dans cet exemple, le système de réactif de Roche Light Cycler 480 sondes Mix servira. Virus doux de marbrure du poivre sont énumérées dans l’échantillon d’eau. 1, 2 Voir le tableau 1 pour apprêt et sonder les séquences.
  2. Dégel extraite (c) l’ADN des échantillons et le contrôle positif ADN (qui se compose de séquences spécifiques d’un organisme clonés dans les plasmides bactériens) à température ambiante.
  3. Préparer un modèle de tableau de 96 cellules qui ressemble à la plaque 96 puits qPCR. Étiquetez chaque cellule avec la réaction qui sera chargée sur la plaque. Comprendre les réactions pour chaque échantillon et de la norme en trois exemplaires, ainsi que pour le contrôle positif et un témoin négatif, comme par exemple une réaction non-ADN.
  4. Calculer les volumes de réactifs nécessaires à une réaction « master mix », qui comprend tous les réactifs qui sont constants parmi les réactions, basées sur les instructions du fabricant et de la littérature. Préparer suffisamment mélange principal pour les réactions en triple pour tous les échantillons plus de contrôles et une majoration de 10 % pour tenir compte de l’erreur de pipettage. Pour un maître échantillon mélanger recette, reportez-vous au tableau 2.
  5. Travaillant à l’intérieur d’une hotte propre, une fois que tous les réactifs sont complètement décongelés, ajouter le montant de chaque réactif dans un tube de microtubes de 1,5 mL basse-liaison pour créer le mélange principal. Vortex et brièvement minicentrifuge chaque réactif avant d’ajouter. Changer de pipette entre chaque réactif pour prévenir la contamination et assurer des concentrations correctes. Après que tous les réactifs ont été ajoutés, vortex et minicentrifuge tube avec master mix afin d’assurer l’homogénéité.
  6. Aliquoter le volume approprié de mélange principal dans chacun désigné bien dans la plaque PCR 96 puits.
  7. Ajouter le volume approprié d’échantillon d’ADN (c), plasmide contrôle positif et le contrôle négatif (eau de qualité moléculaire) dans les puits désignés.
  8. Une fois que tous les échantillons et les contrôles ont été ajoutés, flasque avec feuille d’étanchéité. Utiliser un outil de scellement pour pousser l’air sortir de sous la feuille métallique et éviter les bulles. Déchirez les bords du papier avec soin.
  9. Centrifuger la plaque 96 puits scellée dans une centrifugeuse avec un porte-plaque pour rassembler le mélange au fond de chaque puits. Veillez à utiliser une plaque de contrepoids pour faire en sorte que la centrifugeuse sera correctement équilibrée tout en tournant. Impulsion centrifuger jusqu'à 1000 tr/min, puis laissez la centrifugeuse arrêter lentement sans freins.

5. qPCR opération

  1. Introduisez plaque à 96 puits scellé dans machine de qPCR. S’assurer que la machine indique il est prêt à démarrer.
  2. Suivez les instructions de machine de qPCR pour entrer correctement toutes les informations nécessaires par le logiciel, puis définissez qPCR machine à courir.
  3. Après que la machine complète exécution, le logiciel sera en mesure d’utiliser les concentrations connues du contrôle positif pour calculer la quantité de l’ADNc dans chaque réaction. La quantité de virus dans l’échantillon original peut alors être calculée, basé sur la dilution, filtration, concentration, amplification et/ou les procédés d’extraction effectuées pour obtenir l’échantillon d’ADN.
Réactif Séquence (5' → 3') Volume (μL / bien) Finale conc.
Primer avant GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Inverser l’apprêt TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Sonde FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Le tableau 1. Séquences d’amorce et de sonde échantillon pour détecter les virus doux de marbrure de poivre.

Réactif Volume (μL / bien) Nombre de puits Master Mix Volume (μL)
Mélanger LC 480 12,5 26 325
Moléculaire H2O 4.5 117
Primer avant 2.25 58,5
Inverser l’apprêt 2.25 58,5
Sonde 1.0 26
Total 22,5 585

Le tableau 2. Volumes de réactifs pour la réaction individuelle et mélange principal.

L’avènement de la PCR quantitative ou qPCR, a permis de déterminer quantitativement le montant de tout micro-organisme dans un échantillon environnemental.

Comme PCR standard, qPCR identifie des microorganismes en détectant la présence ou l’absence de séquences d’ADN spécifiques aux organismes d’intérêt. Cela permet une détection des microbes qui ne peuvent pas être cultivées en laboratoire, ce qui permet d’analyser une plus grande variété d’organismes environnementaux. En outre, qPCR permet la quantité d’ADN à évaluer quantitativement. Mais en même temps, des méthodes PCR détecter l’ADN de tous les organismes morts ou vivants, limitant la possibilité de chercher uniquement en croissance active des microbes dans l’échantillon.

Cette vidéo passera en revue les innovations chimiques qui distinguent qPCR PCR régulière, expliquer comment qPCR permet de mesurer quantitativement l’ADN, démontrer un protocole pour l’utilisation de qPCR pour détecter un virus à ARN d’échantillons de sol et enfin, montrer comment qPCR est appliquée à la microbiologie environnementale aujourd'hui.

Les principes de base derrière qPCR sont les mêmes que PCR régulière - répétée des cycles d’apprêt recuit au modèle, allongement du produit PCR et la dénaturation du produit de modèle, conduisant à l’exponentielle amplification d’une séquence cible des intérêts, connu comme l’amplicon, dans un ensemble de matériel de départ.

L’innovation de qPCR est dans l’ajout de produits chimiques fluorescents dans la réaction, ce qui permet la synthèse du produit PCR à chaque cycle à visualiser directement en « temps réel » par thermocycleurs spécialisés, permettant de quantifier la quantité de séquence de modèle dans l’échantillon original. La quantité est généralement mesurée en ce qui concerne le cycle seuil, abrégée Ct, également connu sous le nom du cycle de quantification ou Cq, qui correspond au cycle PCR à partir duquel la quantité de produits fluorescents dépasse le niveau de fond.

Quantification peut être relative, où la valeur det C d’une seule séquence est comparée à celle d’une autre séquence standard ou de contrôle ; la quantité relative est égale à deux élevé à la puissance de la différence de Ct. Sinon, si une série d’ADN de quantité connue est longent les échantillons dans la réaction, une courbe d’étalonnage en comparant la valeur de fluorescence à la quantité d’ADN peut être produite et permet à l’ADN de l’échantillon être dosée absolument.

Il existe deux grands types de molécules fluorescentes utilisées en qPCR. Dans un cas, des colorants fluorescents qui se lient spécifiquement à l’ADN bicaténaire est incluse dans la réaction. La teinture fluorescente uniquement lorsqu’elle est liée à l’ADN, permettant ainsi la quantité de produit ADN double-brin d’être dosée.

Dans l’autre méthode, une petite portion d’ADN, connu comme une sonde, est conçue contre une séquence cible spécifique d’intérêt. La sonde est liée chimiquement à un colorant fluorescent, mais aussi une molécule « extincteur » qui supprime le signal de fluorescence de la teinture quand à proximité. L’enzyme polymérase, qui synthétise le produit de l’ADN, a une activité capables de dégrader l’ADN qui causerait la molécule fluorescente « sortir » de la sonde, donc qui la sépare de la teinture de l’extincteur et permettant de détecter le signal de fluorescence.

Maintenant que vous comprenez les principes qui sous-tendent la qPCR, regardons un protocole pour l’utilisation de cette technique permet d’identifier un virus à ARN qui infecte les plantes, le virus doux de marbrure de poivre, d’échantillons de sol.

Dans cette démonstration, échantillon sera prélevé de la rhizosphère, la zone de sol environ 7 mm autour des racines des plantes qui est influencée par les racines et les micro-organismes symbiotiques.

Pour recueillir la rhizosphère, tout d’abord soigneusement extrait de la plante d’intérêt par rapport au sol et frappez-le à supprimer comme beaucoup excédent du sol que possible. L’usine pour un traitement ultérieur dans le laboratoire de l’emballage.

Après avoir porté les échantillons au laboratoire, utilisez une spatule stérile à la ferraille le sol souhaité dans un récipient de collecte. Ensuite, recueillir le virus dans le sol et extraire l’ARN.

Une fois l’échantillon prélevé RNA, convertir en complémentaire ou ADNc par transcription inverse. Veuillez vous référer à la SciEd JoVE vidéo sur reverse transcription-PCR pour plus de détails de cette procédure.

Lorsque vous êtes prêt à effectuer le qPCR, décongeler les réactifs congelés à la température ambiante à l’intérieur d’une hotte à flux laminaire dédié et mettre sur la glace une fois décongelé. Composants de réactif contenant l’enzyme ADN polymérase doivent toujours être bien sur la glace.

Décongeler le cDNA de l’échantillon et un témoin positif ADN, tel qu’un morceau circulaire d’ADN appelée un plasmide qui a l’amplicon d’intérêt cloné dedans.

Avant d’assembler les réactions dans une plaque à 96 puits qPCR, préparer un modèle de tableau de 96 cellules sur papier et étiquette chaque cellule avec la réaction qui sera chargée dans la plaque. Comprendre les réactions pour chaque échantillon et de la norme en trois exemplaires, ainsi que pour le contrôle positif et un témoin négatif, comme par exemple une réaction non-ADN.

Calculer les volumes de réactifs nécessaires à une réaction « master mix », qui comprend tous les réactifs qui sont constants parmi les réactions. Préparer suffisamment mélange principal pour les réactions en triple pour tous les échantillons plus de contrôles et une majoration de 10 % pour tenir compte de l’erreur de pipettage.

Une fois que les réactifs sont décongelés, assembler le mélange maître dans un tube à centrifuger de 1,5 mL basse-adsorption. Pour ce faire, vortex brièvement chaque réactif à mélanger soigneusement, recueillir tout liquide sur le côté les tubes à l’aide d’une centrifugeuse mini et Pipeter le réactif dans le tube à centrifuger. N’oubliez pas d’utiliser de nouvelles pointes de pipette pour chaque composant de la réaction. Après tous les réactifs ont été ajoutés, vortex pour mélanger et centrifuger. Puis, partie aliquote la quantité appropriée de mélange principal dans les puits désignés sur la plaque de la PCR.

Ensuite, vortex et centrifuger chaque tube échantillon et contrôle ADN et Pipeter le montant approprié dans les puits respectifs sur la plaque de la PCR. Une fois que les échantillons ont été ajoutés, sceller la plaque avec une feuille d’étanchéité et utiliser l’outil étanchéité à pleinement s’aplatir le sceau et faire sortir les bulles d’air. Déchirez soigneusement les onglets non adhésifs aux extrémités du joint.

Pour collecter complètement le mélange réactionnel dans le fond des puits, placer la plaque dans une centrifugeuse avec un porte-plaque et d’équilibrer correctement le rotor avec une plaque de contrepoids. Impulsion-centrifugeuse la plaque jusqu'à 1 000 tr/min, puis laissez la centrifugeuse lentement s’arrête sans freins.

Placer la plaque de réaction dans la machine de qPCR. Configurer le programme PCR selon les spécifications du constructeur, réglage de la température de fusion selon la paire d’amorces utilisée. Définir le programme de réaction à exécuter.

Une fois que le programme de qPCR est terminé, le logiciel sera en mesure d’utiliser les concentrations connues du contrôle positif pour calculer la quantité de l’ADNc dans chaque réaction. La quantité de virus dans l’échantillon initial peut ensuite être calculée.

Une fois que le programme de qPCR est terminé, le logiciel sera en mesure d’utiliser les concentrations connues du contrôle positif pour calculer la quantité de l’ADNc dans chaque réaction.

Avec les résultats de la qPCR, le volume transféré dans les puits, l’extraction du sol et le facteur de la transcriptase inverse, le nombre de virus dans l’échantillon initial du sol peut être calculé.

Maintenant que vous savez comment qPCR est effectué, nous allons étudier comment il peut être utilisé pour analyser des échantillons environnementaux différents.

qPCR permet de quantifier la quantité de virus provenant de nombreux types d’échantillons. Dans cette application, deux types différents d’adénovirus étaient concentrés provenant d’échantillons de l’eau par un certain nombre de différentes méthodes. ADN a été ensuite extraite des virus et soumis à qPCR, afin d’évaluer l’efficacité relative des méthodes de concentration.

Une autre application pour dénombrement microbien qPCR-basé est de quantifier la concentration bactérienne dans les aliments et les échantillons agricoles - dans cet exemple, fécal et échantillons provenant des élevages de poulets de la litière. Plutôt que de cibler les espèces individuelles, les scientifiques ont effectué qPCR en utilisant des amorces contre un gène hautement conservé dans toutes les bactéries et quantifié la communauté bactérienne totale trouvée dans les échantillons.

Enfin, comme mentionné précédemment, l’un des inconvénients de la méthodologie traditionnelle qPCR est que les microbes vivants et morts ne peuvent être distingués. Cependant, en ajoutant un produit chimique appelé propidium monoazide ou PMA, qui ne peut entrer des cellules mortes, où il se lie à l’ADN pour inhiber les réactions enzymatiques comme la PCR, chercheurs ici étaient capables de distinguer entre les cultures vivantes et mortes d’e. coli O157 : H7, une souche pathogène commune trouvée dans l’eau et les aliments contaminés.

Vous avez juste regardé introduction de Jupiter à la quantification des microorganismes environnementales et les virus à l’aide de qPCR. Vous devez maintenant comprendre comment fonctionne le qPCR, comment utiliser qPCR pour mesurer la quantité d’un microbe dans un échantillon environnemental et certaines applications de cette technique. Merci de regarder !

Applications and Summary

La capacité de quantifier la cible segment génomique exemplaires en utilisant la technique de qPCR sont important dans un certain nombre de domaines scientifiques. Exemples d’applications incluent :

(1) énumérant les agents pathogènes dans l’eau, sol, aliments, surfaces, etc..

PCR en temps réel est utilisé pour énumérer les agents pathogènes dans des environnements variés. Lors d’épidémies, des échantillons de l’eau et le sol peuvent être analysés pour l’agent pathogène de l’intérêt de trouver la source de la propagation. Ensuite, la source peut être davantage analysée pour énumérer la concentration de l’agent pathogène et de déterminer le degré de saleté. Par exemple, pendant une épidémie de norovirus sur un bateau de croisière qui a causé la gastro-entérite sévère, des vomissements et diarrhée pour les passagers, échantillons d’eau et de nourriture peuvent être soumis à la PCR en temps réel pour identifier la source du virus, par exemple, l’eau n’était pas correctement traitée et contenu haute contamination fécale.

(2) mesure la réduction des microbes pathogènes de traitement des eaux usées

Eaux usées brutes contient une abondance de pathogène micro-organismes et, par conséquent, doivent être traitées afin de protéger la santé publique. Échantillons d’eau peuvent être prélevés à différents points le long d’un train de traitement des eaux usées et analysées à l’aide de qPCR pour déterminer la réduction des niveaux de micro-organismes pathogènes, y compris les virus. Les réductions calculées ensuite fournissent des informations précieuses quant à l’efficacité des procédés de traitement des eaux usées et les applications potentielles de réutilisation de l’eau.

(3) la mesure des marqueurs de gène fonctionnel dans l’environnement

Des communautés microbiennes sont soumis à des modifications de la composition et les fluctuations dans l’activité en raison de pressions sur l’environnement. Ces changements peuvent être surveillés par l’intermédiaire de l’analyse des gènes fonctionnels peuvent être activés par des agresseurs environnementaux particuliers. PCR en temps réel peut être utilisé pour quantifier l’expression de ces gènes dans des échantillons de surveiller les changements dans l’activité de la communauté microbienne. Par exemple, qPCR permet aux écologistes microbiennes quantifier l’expression des gènes activés pour voies de biodégradation en présence de contaminants d’origine humaine présents dans les sols.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

1. le prélèvement

  1. Recueillir le sol à l’aide d’une tarière ou pelle à une profondeur déterminée. Si collecte du sol de la rhizosphère, ne recueillons sol intérieur 7 mm autour des racines de la plante, en frappant des excès de saleté hors de la racine et grattage sol souhaité dans un tonneau de collection.
  2. Placez une bouteille Nalgene stérile en trempant le bâtonnet. Tenez l’extrémité du bâton et de recueillir l’eau en immergeant la bouteille. Placer la bouteille dans une glacière avec de la glace.
  3. Transfert des échantillons au laboratoire.

2. Extraction des acides nucléiques

  1. D’isoler des micro-organismes dans les échantillons recueillis et pour en extraire l’ADN et/ou de l’ARN, s’il vous plaît voir la vidéo de l’enseignement des sciences JoVE sur l’extraction des acides nucléiques communautaire.

3. Transcription inverse

  1. Si le matériel génétique étant dosé est RNA, il doit servir à générer l’ADN complémentaire (ADNc) par transcription inverse avant de procéder à la PCR. Pour plus de détails, veuillez consulter JoVE Science Education vidéo sur RT-PCR.

4. mise en place de qPCR

  1. Récupérer les réactifs stockés à-20 ° C et les décongeler sur glace ou à température ambiante à l’intérieur d’une hotte propre. Réactifs utilisés dans cet exemple comprennent le mélange réactionnel de qPCR (dépendant de la machine de qPCR utilisé ; contient l’ADN polymérase), amorces et inverses et la sonde TaqMan. Les séquences d’amorce et de sonde sont conçus avec des séquences spécifiques de l’organisme qui est énuméré. Reportez-vous à la documentation actuelle de trouver des séquences d’intérêt. Dans cet exemple, le système de réactif de Roche Light Cycler 480 sondes Mix servira. Virus doux de marbrure du poivre sont énumérées dans l’échantillon d’eau. 1, 2 Voir le tableau 1 pour apprêt et sonder les séquences.
  2. Dégel extraite (c) l’ADN des échantillons et le contrôle positif ADN (qui se compose de séquences spécifiques d’un organisme clonés dans les plasmides bactériens) à température ambiante.
  3. Préparer un modèle de tableau de 96 cellules qui ressemble à la plaque 96 puits qPCR. Étiquetez chaque cellule avec la réaction qui sera chargée sur la plaque. Comprendre les réactions pour chaque échantillon et de la norme en trois exemplaires, ainsi que pour le contrôle positif et un témoin négatif, comme par exemple une réaction non-ADN.
  4. Calculer les volumes de réactifs nécessaires à une réaction « master mix », qui comprend tous les réactifs qui sont constants parmi les réactions, basées sur les instructions du fabricant et de la littérature. Préparer suffisamment mélange principal pour les réactions en triple pour tous les échantillons plus de contrôles et une majoration de 10 % pour tenir compte de l’erreur de pipettage. Pour un maître échantillon mélanger recette, reportez-vous au tableau 2.
  5. Travaillant à l’intérieur d’une hotte propre, une fois que tous les réactifs sont complètement décongelés, ajouter le montant de chaque réactif dans un tube de microtubes de 1,5 mL basse-liaison pour créer le mélange principal. Vortex et brièvement minicentrifuge chaque réactif avant d’ajouter. Changer de pipette entre chaque réactif pour prévenir la contamination et assurer des concentrations correctes. Après que tous les réactifs ont été ajoutés, vortex et minicentrifuge tube avec master mix afin d’assurer l’homogénéité.
  6. Aliquoter le volume approprié de mélange principal dans chacun désigné bien dans la plaque PCR 96 puits.
  7. Ajouter le volume approprié d’échantillon d’ADN (c), plasmide contrôle positif et le contrôle négatif (eau de qualité moléculaire) dans les puits désignés.
  8. Une fois que tous les échantillons et les contrôles ont été ajoutés, flasque avec feuille d’étanchéité. Utiliser un outil de scellement pour pousser l’air sortir de sous la feuille métallique et éviter les bulles. Déchirez les bords du papier avec soin.
  9. Centrifuger la plaque 96 puits scellée dans une centrifugeuse avec un porte-plaque pour rassembler le mélange au fond de chaque puits. Veillez à utiliser une plaque de contrepoids pour faire en sorte que la centrifugeuse sera correctement équilibrée tout en tournant. Impulsion centrifuger jusqu'à 1000 tr/min, puis laissez la centrifugeuse arrêter lentement sans freins.

5. qPCR opération

  1. Introduisez plaque à 96 puits scellé dans machine de qPCR. S’assurer que la machine indique il est prêt à démarrer.
  2. Suivez les instructions de machine de qPCR pour entrer correctement toutes les informations nécessaires par le logiciel, puis définissez qPCR machine à courir.
  3. Après que la machine complète exécution, le logiciel sera en mesure d’utiliser les concentrations connues du contrôle positif pour calculer la quantité de l’ADNc dans chaque réaction. La quantité de virus dans l’échantillon original peut alors être calculée, basé sur la dilution, filtration, concentration, amplification et/ou les procédés d’extraction effectuées pour obtenir l’échantillon d’ADN.
Réactif Séquence (5' → 3') Volume (μL / bien) Finale conc.
Primer avant GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Inverser l’apprêt TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Sonde FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Le tableau 1. Séquences d’amorce et de sonde échantillon pour détecter les virus doux de marbrure de poivre.

Réactif Volume (μL / bien) Nombre de puits Master Mix Volume (μL)
Mélanger LC 480 12,5 26 325
Moléculaire H2O 4.5 117
Primer avant 2.25 58,5
Inverser l’apprêt 2.25 58,5
Sonde 1.0 26
Total 22,5 585

Le tableau 2. Volumes de réactifs pour la réaction individuelle et mélange principal.

L’avènement de la PCR quantitative ou qPCR, a permis de déterminer quantitativement le montant de tout micro-organisme dans un échantillon environnemental.

Comme PCR standard, qPCR identifie des microorganismes en détectant la présence ou l’absence de séquences d’ADN spécifiques aux organismes d’intérêt. Cela permet une détection des microbes qui ne peuvent pas être cultivées en laboratoire, ce qui permet d’analyser une plus grande variété d’organismes environnementaux. En outre, qPCR permet la quantité d’ADN à évaluer quantitativement. Mais en même temps, des méthodes PCR détecter l’ADN de tous les organismes morts ou vivants, limitant la possibilité de chercher uniquement en croissance active des microbes dans l’échantillon.

Cette vidéo passera en revue les innovations chimiques qui distinguent qPCR PCR régulière, expliquer comment qPCR permet de mesurer quantitativement l’ADN, démontrer un protocole pour l’utilisation de qPCR pour détecter un virus à ARN d’échantillons de sol et enfin, montrer comment qPCR est appliquée à la microbiologie environnementale aujourd'hui.

Les principes de base derrière qPCR sont les mêmes que PCR régulière - répétée des cycles d’apprêt recuit au modèle, allongement du produit PCR et la dénaturation du produit de modèle, conduisant à l’exponentielle amplification d’une séquence cible des intérêts, connu comme l’amplicon, dans un ensemble de matériel de départ.

L’innovation de qPCR est dans l’ajout de produits chimiques fluorescents dans la réaction, ce qui permet la synthèse du produit PCR à chaque cycle à visualiser directement en « temps réel » par thermocycleurs spécialisés, permettant de quantifier la quantité de séquence de modèle dans l’échantillon original. La quantité est généralement mesurée en ce qui concerne le cycle seuil, abrégée Ct, également connu sous le nom du cycle de quantification ou Cq, qui correspond au cycle PCR à partir duquel la quantité de produits fluorescents dépasse le niveau de fond.

Quantification peut être relative, où la valeur det C d’une seule séquence est comparée à celle d’une autre séquence standard ou de contrôle ; la quantité relative est égale à deux élevé à la puissance de la différence de Ct. Sinon, si une série d’ADN de quantité connue est longent les échantillons dans la réaction, une courbe d’étalonnage en comparant la valeur de fluorescence à la quantité d’ADN peut être produite et permet à l’ADN de l’échantillon être dosée absolument.

Il existe deux grands types de molécules fluorescentes utilisées en qPCR. Dans un cas, des colorants fluorescents qui se lient spécifiquement à l’ADN bicaténaire est incluse dans la réaction. La teinture fluorescente uniquement lorsqu’elle est liée à l’ADN, permettant ainsi la quantité de produit ADN double-brin d’être dosée.

Dans l’autre méthode, une petite portion d’ADN, connu comme une sonde, est conçue contre une séquence cible spécifique d’intérêt. La sonde est liée chimiquement à un colorant fluorescent, mais aussi une molécule « extincteur » qui supprime le signal de fluorescence de la teinture quand à proximité. L’enzyme polymérase, qui synthétise le produit de l’ADN, a une activité capables de dégrader l’ADN qui causerait la molécule fluorescente « sortir » de la sonde, donc qui la sépare de la teinture de l’extincteur et permettant de détecter le signal de fluorescence.

Maintenant que vous comprenez les principes qui sous-tendent la qPCR, regardons un protocole pour l’utilisation de cette technique permet d’identifier un virus à ARN qui infecte les plantes, le virus doux de marbrure de poivre, d’échantillons de sol.

Dans cette démonstration, échantillon sera prélevé de la rhizosphère, la zone de sol environ 7 mm autour des racines des plantes qui est influencée par les racines et les micro-organismes symbiotiques.

Pour recueillir la rhizosphère, tout d’abord soigneusement extrait de la plante d’intérêt par rapport au sol et frappez-le à supprimer comme beaucoup excédent du sol que possible. L’usine pour un traitement ultérieur dans le laboratoire de l’emballage.

Après avoir porté les échantillons au laboratoire, utilisez une spatule stérile à la ferraille le sol souhaité dans un récipient de collecte. Ensuite, recueillir le virus dans le sol et extraire l’ARN.

Une fois l’échantillon prélevé RNA, convertir en complémentaire ou ADNc par transcription inverse. Veuillez vous référer à la SciEd JoVE vidéo sur reverse transcription-PCR pour plus de détails de cette procédure.

Lorsque vous êtes prêt à effectuer le qPCR, décongeler les réactifs congelés à la température ambiante à l’intérieur d’une hotte à flux laminaire dédié et mettre sur la glace une fois décongelé. Composants de réactif contenant l’enzyme ADN polymérase doivent toujours être bien sur la glace.

Décongeler le cDNA de l’échantillon et un témoin positif ADN, tel qu’un morceau circulaire d’ADN appelée un plasmide qui a l’amplicon d’intérêt cloné dedans.

Avant d’assembler les réactions dans une plaque à 96 puits qPCR, préparer un modèle de tableau de 96 cellules sur papier et étiquette chaque cellule avec la réaction qui sera chargée dans la plaque. Comprendre les réactions pour chaque échantillon et de la norme en trois exemplaires, ainsi que pour le contrôle positif et un témoin négatif, comme par exemple une réaction non-ADN.

Calculer les volumes de réactifs nécessaires à une réaction « master mix », qui comprend tous les réactifs qui sont constants parmi les réactions. Préparer suffisamment mélange principal pour les réactions en triple pour tous les échantillons plus de contrôles et une majoration de 10 % pour tenir compte de l’erreur de pipettage.

Une fois que les réactifs sont décongelés, assembler le mélange maître dans un tube à centrifuger de 1,5 mL basse-adsorption. Pour ce faire, vortex brièvement chaque réactif à mélanger soigneusement, recueillir tout liquide sur le côté les tubes à l’aide d’une centrifugeuse mini et Pipeter le réactif dans le tube à centrifuger. N’oubliez pas d’utiliser de nouvelles pointes de pipette pour chaque composant de la réaction. Après tous les réactifs ont été ajoutés, vortex pour mélanger et centrifuger. Puis, partie aliquote la quantité appropriée de mélange principal dans les puits désignés sur la plaque de la PCR.

Ensuite, vortex et centrifuger chaque tube échantillon et contrôle ADN et Pipeter le montant approprié dans les puits respectifs sur la plaque de la PCR. Une fois que les échantillons ont été ajoutés, sceller la plaque avec une feuille d’étanchéité et utiliser l’outil étanchéité à pleinement s’aplatir le sceau et faire sortir les bulles d’air. Déchirez soigneusement les onglets non adhésifs aux extrémités du joint.

Pour collecter complètement le mélange réactionnel dans le fond des puits, placer la plaque dans une centrifugeuse avec un porte-plaque et d’équilibrer correctement le rotor avec une plaque de contrepoids. Impulsion-centrifugeuse la plaque jusqu'à 1 000 tr/min, puis laissez la centrifugeuse lentement s’arrête sans freins.

Placer la plaque de réaction dans la machine de qPCR. Configurer le programme PCR selon les spécifications du constructeur, réglage de la température de fusion selon la paire d’amorces utilisée. Définir le programme de réaction à exécuter.

Une fois que le programme de qPCR est terminé, le logiciel sera en mesure d’utiliser les concentrations connues du contrôle positif pour calculer la quantité de l’ADNc dans chaque réaction. La quantité de virus dans l’échantillon initial peut ensuite être calculée.

Une fois que le programme de qPCR est terminé, le logiciel sera en mesure d’utiliser les concentrations connues du contrôle positif pour calculer la quantité de l’ADNc dans chaque réaction.

Avec les résultats de la qPCR, le volume transféré dans les puits, l’extraction du sol et le facteur de la transcriptase inverse, le nombre de virus dans l’échantillon initial du sol peut être calculé.

Maintenant que vous savez comment qPCR est effectué, nous allons étudier comment il peut être utilisé pour analyser des échantillons environnementaux différents.

qPCR permet de quantifier la quantité de virus provenant de nombreux types d’échantillons. Dans cette application, deux types différents d’adénovirus étaient concentrés provenant d’échantillons de l’eau par un certain nombre de différentes méthodes. ADN a été ensuite extraite des virus et soumis à qPCR, afin d’évaluer l’efficacité relative des méthodes de concentration.

Une autre application pour dénombrement microbien qPCR-basé est de quantifier la concentration bactérienne dans les aliments et les échantillons agricoles - dans cet exemple, fécal et échantillons provenant des élevages de poulets de la litière. Plutôt que de cibler les espèces individuelles, les scientifiques ont effectué qPCR en utilisant des amorces contre un gène hautement conservé dans toutes les bactéries et quantifié la communauté bactérienne totale trouvée dans les échantillons.

Enfin, comme mentionné précédemment, l’un des inconvénients de la méthodologie traditionnelle qPCR est que les microbes vivants et morts ne peuvent être distingués. Cependant, en ajoutant un produit chimique appelé propidium monoazide ou PMA, qui ne peut entrer des cellules mortes, où il se lie à l’ADN pour inhiber les réactions enzymatiques comme la PCR, chercheurs ici étaient capables de distinguer entre les cultures vivantes et mortes d’e. coli O157 : H7, une souche pathogène commune trouvée dans l’eau et les aliments contaminés.

Vous avez juste regardé introduction de Jupiter à la quantification des microorganismes environnementales et les virus à l’aide de qPCR. Vous devez maintenant comprendre comment fonctionne le qPCR, comment utiliser qPCR pour mesurer la quantité d’un microbe dans un échantillon environnemental et certaines applications de cette technique. Merci de regarder !

A subscription to JoVE is required to view this article.
You will only be able to see the first 20 seconds.

RECOMMEND JoVE