Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

파지 - 표시 합성 항체 라이브러리의 확장 성 높은 처리량 선택

doi: 10.3791/51492 Published: January 17, 2015

Summary

방법은 항원 동시에 수백 대해 파지 디스플레이 조합 항체 라이브러리의 합성 확장, 고 스루풋 선택을 수행하기위한 시각적 반주하여 설명한다. 이 병렬 접근 방식을 사용하여, 우리는 표준 면역의 기능적인 다양한 항원에 대한 높은 친화력과 특이성을 나타내는 항체 단편을 격리했다.

Abstract

모두 기초 연구 및 임상 응용의 요구를 충족하는 항체에 대한 수요가 높고, 향후 대폭 증가 할 것이다. 그러나, 기존의 단일 클론 기술이 작업까지 혼자가 아니라는 것을 알 수있다. 이것은 프로테옴의 모든 요소들에 접근 고품질 재생 친 화성 시약에 대한 수요를 충족시키기 위해 대안적인 방법의 개발을 유도 하였다. 이를 위해, 파지 표시 합성 항체 라이브러리에서 선택을 수행하기위한 높은 처리량 방법은 다양한 항원을 포함하는 애플리케이션을 위해 고안되었으며, 빠른 처리 속도 및 성공에 최적화. 여기서, 프로토콜은 비디오 시연 수동 96 채널 액체 핸들러 또는 로봇 자동화 된 시스템을 사용하여 타겟의 수백에 대해 높은 다이버 시티의 Fab 라이브러리로부터 파지 클론의 선택을 도시 평행 상세하게 설명한다. 이 프로토콜을 이용하여, 사용자는 하나의 항원을 생성 할 수있는 수백,병렬로 항체를 선택 6-8 주 이내에 항체 결합을 확인합니다. 강조는 다음과 같습니다 ⅰ) 가능한 항원 형식, ⅱ) 사전 선택 항원의 특성, ⅲ) 중요한 특정 및 선호도가 높은 클론의 선택에 영향을 미치는 단계, 및 ⅳ) 모니터링 선택 효과와 초기 항체 클론 특성화 방법. 이 방식으로, 우리는 단일 막 통과 수용체, 단백질 분비 호르몬, 멀티 도메인, 세포 내 단백질을 포함하는 많은 타겟 클래스 합성 항체 단편 (Fab를)를 얻었다. 이 조각은 쉽게 전체 길이 항체로 변환하고 높은 친화력과 특이성을 나타내는 것으로 확인되었다. 또한, 그들은 웨스턴 블로 팅, ELISA, 세포 면역, 면역 및 관련 분석을 포함하여 표준 면역의 다양한 기능으로 입증되었다. 이 방법은 항체 발견을 촉진하고 궁극적으로 목표 O를 실현 가까이 우리를 가져올 것이다F 프로테옴에 재생 고품질 항체를 생성하는 단계를 포함한다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

포스트 게놈 시대의 시작과 함께, 특징 및 단백질을 조절하는 고품질의 결합 시약의 가용성은 새로운 연구 및 치료 길을 열 필수적이다. 항체는 기초 연구 및 진단 도구 및 잠재적 치료제로 모두 학문과 산업 연구원에 중요한 계속. 당연히, 사용자 정의 항체를 생성하기 위해 기존의 하이 브리 도마 기술에 의존하는 대부분의 계약 항체 개발 기업의 인상적인 성장이 있었다. 그럼에도 불구하고, 파지 디스플레이 항체 라이브러리를 사용하여 체외 선택은 기존의 기술 한계 1, 2에 직면 수있는 고유의 장점과 성공을 제공 할 수있는 강력한 대안 기술이되고있다.

연구 도구, 생성하는 두 가지 주요 과제로 높은 품질의 항체에 대한 상당한 수요에 비추어 신 재생 항체는 1) 선택 처리량과 2) 항원 유명하다ailability. 그룹 번호는 현재 처리량 및 항체 인식의 속도를 향상 목적 체외 선택 파이프 라인에서 설명 하였다. 이러한 설명 세부 전체 길이 중 하나에 선택 등이 가능한 다양한 접근 방식을 사용, 2, 3, 4 대상으로, 또는 구조적 도메인 5,6,7 관련 중 하나 비드 기반 6,8 또는 3,4 항원 고정화 방식을 기반 접시입니다. 또한, 유전자 합성 기술 (9)의 성장 채택 합리적 비용 효과적인 잠재적 정제, 전장 항원의 충분한 양을 얻는 데 어려움을 완화 할 수 특히 고립 도메인으로 체계적인 항원 생성을 만들었다. 나란히 두 기술을 사용함으로써, 자 급식 및 확장 항원 생성 및 항체 선택 파이프 라인 표현 항원 도메인 큰 세트 항체 평행 절연을 가능하게하고 차 시약의 개발을 촉진 것이라고 고안했다구조적으로 또는 기능적으로 관련 단백질의 전체 클래스를 racterizing.

이 목표, 표현할 수있는 항원 도메인, 유전자 합성, 항원과 확장 성을 파지 디스플레이 항체 선택의 높은 처리량 세균 표현의 실리 식별의 부부가 개발 한 통합 파이프 라인을 향해. 이 파이프 라인은 (라이센스 또는 물질 전달 계약을 통해 점점 사용할 수있는 항체 라이브러리 포함) 대부분의 생명 과학 실험실에서 사용할 기본적인 인프라가 필요합니다,뿐만 아니라 산업적인 규모에서 사용하기 위해를 자동화에서 쉽게 다룰 수있다. 이 프로토콜을 이용하면, 친 화성 태그 항원 수백 도메인을 생성 할 수 있고, 통상적으로 이들 중 많은 항원에 매우 특이 적 항체 단편을 분리.

파지 디스플레이 기술 된 Fab, scFv를, 자율 된 Fv 도메인과 재조합 포함한 친 화성 시약 다양한 포맷과의 호환성을 입증했다 도시작은 '대안 프레임 워크'(설계 ankyrin 반복 단백질 (DARPINS), 피브로넥틴 (FN), 리포 칼린 도메인과 10 개)의 성장 배열입니다. 그것은 이러한 방법은 다른 유형의 라이브러리에 적용 할 수있는 것으로 추정되지만 토론은 항체의 Fab 단편의 단리 본 예에서는 제한된다. 이 기술을 사용하면, 작은 낮은 나노 몰 친화 팹, 전장 단백질 결합과 같은 면역과 같은 면역 기능적 이는 많은 RNA 결합 단백질 등이 성공적으로 선정 된 전사 인자 도메인, SH2 도메인을 포함한 단백질 도메인 듣기 , 면역 및 면역 조직 화학. 중요한 것은, 재조합 바인딩 클론이 완전히 재생하고 표현에서 다시 생성 될 수있다, 따라서 엄격한 복제 검증의 비용을 정당화, 박테리아 생산 제공 일관성 향상, 재현성 및 비용 효율성을 통해 구성한다.

이 제자에ocol 및 첨부 동영상은, 고정 된 항원 도메인을 사용 파지 디스플레이 라이브러리의 항체 선택을위한 기본적인 방법은 입증된다. 다른 태그 11,12,13 및 선택 포맷이 성공적으로 사용되어왔다 13,14,2 있지만이 특정 방법은 마이크로 웰 플레이트에서 수동 흡착에 의해 고정 된 GST-태그 단백질 도메인을 사용합니다. 식별 및 검증을 위해 특별히 풍부한 클론 항체를 분리하기위한 선택 매개 변수의 병렬 모니터링 선택의 설정 및 행동에 중요한 고려 사항이 자세히 설명되어 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 항원 생성

주의 : 도메인은 항원 합성 적절한 IPTG 유도 가능한 발현 구조체에 상용 다양한 벤더에 의해 복제 될 수있다.

  1. 화학적으로 유능한, T1 파지로 발현 구조를 변형 저항, BL21 E. 화학적 적격 세포를 20 L을 첨가하여 96 웰 PCR 플레이트 얼음 위에 1X KCM 20 μL를 코딩 DNA에 10ng의 혼합함으로써 대장균 세포.
  2. 실온에서 10 분 동안, 20 분 동안 얼음에 세포 / DNA 혼합물을 품어 후 얼음에 다시 2 분 통기성 판 인감, 포도당 (SOC) 미디어 미리 예열 슈퍼 최적의 배지 100 ㎕로 구출 취재하기 전에 및 2.5 cm 진탕 기에서 200rpm으로 1 시간 동안 37 ° C에서 진탕.
  3. 루리아 - 베르 타니 (LB) 카르 베니 실린 보충 / 한천 플레이트 (100g / ㎖)에 사용되는 단일 콜로니를 얻기 위해 O / N 성장에 형질 전환 세포 접시 5 μL글리세롤 주식을 생성하는 단계를 포함한다.
  4. 5 μL 글리세롤 재고와 2YT / 수화물 매체의 1 ml에 접종하고 2.5 cm 진탕 기에서 200 rpm으로 진탕 96 웰 깊은 잘 블록에 37 ° C에서 12 시간 동안 성장한다.
  5. NZY의 media15 접종이 문화의 1:40 희석 (0.05 % 포도당, 2 % 유당, 100 ㎍ / ㎖ 카르 베니 실린 보충), 다음 2.5 cm 궤도에서 30 ° C, 200 rpm에서 6-8 시간 동안 흔들 셰이커.
  6. 박테리아 펠릿은 이전에 발행 protocols16,17 따라 니켈 NTA 수지 100 μl를 함유하는 96- 웰 필터 플레이트에서 높은 처리량의 항원 단백질을 정제하고.
  7. 브래드 포드 염료 결합 assay18로 정제 단백질의 농도를 결정하고 SDS-PAGE 젤에 분리 쿠마 얼룩 10 ~ 50 μg의 시각화에 의해 크기와 순도의 특성 (그림 2 참조).
    주 :이 단계에서 단백질은 상기 단백질 응집 (19)을 평가 방법에 의해 특성화 될 수있다 (20)을 접는.

파지 라이브러리 2. 준비 및 적정

  1. T1 파지 내성 E.의 단일 식민지를 선택 50 ㎍ / ㎖의 테트라 사이클린이 보충 된 2YT 미디어에 1 ㎖의 대장균 세포.
  2. 세포 성장이 시각적으로 설정되면, 감염 세포의 충분한 볼륨 확인하기 위해 50 ㎍ / ㎖의 테트라 사이클린 보충 2YT의 더 큰 볼륨의 문화를 희석 (라이브러리 희석 당 일반적으로 45 μl를 아래를 참조하십시오.).
  3. 30 분 및 펠렛 얼음 위에서 배양 멸균 20 %의 PEG-8000의 1 / 5 번째 볼륨, 2.5 M의 NaCl (PEG-의 NaCl)에 축적 버퍼로부터의 파지를 침전에 의한 사용을 위해 라이브러리를 준비 12,000 x g에서 원심 분리하여 파지를 침전.
  4. 뜨는을 취소하고 재현 탁은 t을 조정, 1X PBS 산도 7.4, 0.2 % BSA 및 0.05 % 트윈 (PBT)의 적절한 볼륨 파지를 침전O에 대한 적절한 선택 파지 농도가 필요한 경우 적절한 라이브러리 커버리지를 보장한다. 단계 2.9 및 토론을 참조하십시오.
  5. 멸균 멀티 웰 플레이트에 1X PBS의 pH 7.4의 45 μL에 5 ㎕를 파지 나누어지는을 희석 혼합, 같은 버퍼에 10 배 희석의 시리즈를 만들 수 있습니다.
  6. T1 파지에 강한 E의 45 μL 각 파지 희석의 5 μl를 추가합니다. 대장균 다른 멀티 웰 플레이트에서 로그 위상 성장 세포 (= 0.4 ~ 0.8 OD 600), 통기성 실 커버와 2.5 cm 진탕 기에서 30 분 동안 200 rpm으로 진탕 37 ° C에서 배양한다.
  7. 플레이트 5 ㎍ / ㎖ 카르 베니 실린 100 보충 미리 예열 한천 플레이트에 각 웰에서 감염된 세포의 μL 및 식민지가 표시 될 때까지 37 ℃에서 O / N 성장.
  8. 다음과 같이 총 파지 / ㎖를 계산합니다 :
    가장 희석 샘플 X 200 X 10 (어디 = 최대 NUM의 카르 베니 실린 접시에 식민지의 파지 / ㎖ = 수희석의 BER있는 식민지는) 명백한.
  9. 다음 라이브러리 다양성의 커버리지를 보장하기 위해 항원 코팅 된 웰의 수를 결정하는 계산 :
    코팅 된 항원 우물의 수는 필요 =
    원하는 배 범위 * 라이브러리 다양성
    100 μL 당 파지의 #

파지 디스플레이 라이브러리 3. 항체 선택

3.1) 항원 고정화

  1. 항원 품질에 영향을 미칠 수 있고, 희석을 용이하게하기 위해, 96 웰 플레이트를 비 결합하기 위해서는 100 × 작업 농도 (예를 들어, 500 g / ml) 및 분취 정규화 스톡 항원 단백질 판을 제조 동결 - 해동 사이클을 방지한다.
  2. PBS와 스톡 판에서 희석하여 선택의 각 라운드에 전날 스톡 단백질 솔루션에서 항원 - 코팅 된 플레이트를 준비합니다.
  3. 코트 96 웰 GST 태그가 항원 단백질 또는 음성 대조군 P 100 ㎕ 높은 단백질 결합 폴리스티렌 판rotein PBS에서 5 ㎍ / ㎖의에 (GST, BSA, 뉴트라 비딘, 등). 마이크로 통에 250 rpm으로 4 ° CO / N에서 흔들어.
  4. 마이크로 플레이트 코팅에서 단백질 용액을 제거 (1X PBS pH를 7.4에서 0.2 % BSA) 차단 버퍼 200 μL와 항원 코팅과 부정적인 선택 판을 차단하고 1-2 시간 동안 실온에서 250 rpm으로 흔들.
  5. 블로킹 후, 0.05 % 트윈 (PT) 수동으로 또는 자동화 된 마이크로 플레이트 세척기를 사용하여 1X PBS 완충액으로 pH를 7.4 200㎕를 함께 차단 단백질 코팅 된 플레이트 네 번 씻는다.

3.2) 라이브러리 사전 통관 및 항원 파지 배양

  1. 비의 라이브러리 공핍 (또는 태그 -) 대조군 단백질 또는 프리 친 화성 태그로 코팅 된 웰 번호 PBT 버퍼에 준비된 파지 라이브러리 100 ㎕ (1012 파지)의 전송을 통한 특이 적 결합 파아지 - 디스플레이 항체 단편 클론 단백질 (예, GST) 대상의 숫자와 같은 파지 부화250 rpm에서 진탕 실온에서 1-2 시간 동안 우물.
    주 : 대체 또는 음성 선별 추가적인 수단으로서, 인큐베이션은 상기 특정 대상의 회복 태그 - 결합 클론을 제거하고 강화하기 과량 (5-25 μM) 가용성 단백질의 친화도 태그 (예 : GST)의 존재하에 수행 될 수있다 클론을 결합.
  2. 항원 - 코팅 된 플레이트에 부정적인 선택에서 전송 파지 뜨는 특정 바인딩 클론의 캡처 250 rpm에서 진탕 실온에서 1-2 시간 동안 배양한다.
  3. 언 바운드 파지를 제거하고 마이크로의 우물을 씻어 8 ~ 15 번 PT 버퍼와 함께 수동으로 또는 마이크로 와셔를 사용하여. 용출 직전에 과도한 세척 버퍼를 제거합니다.

3.3) 용출, 감염 및 파지 증폭

  1. 초기 선택의 날, T1 파지 내성 E.의 단일 식민지를 선택 50 ㎍ / ㎖의 테트라 사이클린 보충 및 37 ° C 위스콘신 성장 2YT 미디어 1 ㎖에 대장균 세포2.5 cm 진탕 또는 동급에서 200 rpm으로 진탕 일.
  2. 세포 성장이 확립되고, 눈으로 볼 수있는 일단 2YT는 (일반적으로 선택 100㎕를 웰)를 감염 세포의 충분한 양을 확보하기 위해 50 UG / ㎖ 테트라 사이클린으로 보충 된 미디어의 볼륨을 증가시킨다.
  3. 다음 결합 파지가 30 분 동안 37 ° C에서 세척 항원 세포 플레이트에 100 ㎕를 추가하고 흔들어 용출, 0.4-0.8 600 도달 OD (약 5-7 시간)까지 세포 성장.
  4. 1 × 10 10 CFU / ml의 최종 농도로 M13K07 헬퍼 파지를 첨가하고, 200 rpm으로 진탕하면서 45 분 동안 37 ° C에서 배양한다.
  5. 2YT의 1.2 ml의 세포를 전송은 150 ㎍ / ml의 카르 베니 실린 75 μg의 보충 / ㎖ 카나마이신 2.5 cm에서 200 rpm으로 진탕 37 ° C에서 V-아래 성장 O / N과 96 웰 깊은 우물 블록 진탕.

3.4) 파지 준비 및 SELEC의 반복 라운드기

  1. 원심 분리하여 펠렛 박테리아 4 ℃에서 15 분 동안 4,000 XG에.
  2. 10X PBT의 1/10 볼륨으로 중화과 혼합, 미니 튜브 96 웰 멸균 마이크로 파란색 상자에 복제 판에서 파지 상층 액 같은 부피를 섞는다. 선택의 반복 라운드는 3-4 라운드를위한 (단계 3.1.1에서 시작) 또는 농축이 관찰 될 때까지 음성 대조군 단백질에 비해 (섹션 4, 7 참조).
    참고 : 선택의 초반 라운드에서 상당한 / 검출 농축이 예상되지 않는 경우 (즉, 1 라운드, 2), (그림 3과 7 절과 대표적인 결과에 설명) 입력 및 출력 파지 역가의 정량화 확보에 도움이 될 수 있습니다 최소 파지 (토론 참조) 성공적인 선택에 대한 농도 및 풀링 ELISA를보다 더 적합합니다.

풀링 ELISA 4. 특성

  1. 코트 96 웰 높은 단백질 바인딩3.1 절에 따라 2 ㎍ / ml의에서 항원 단백질 또는 음성 대조군 단백질 (GST, BSA, 뉴트라 비딘 등) GST 태그가 100 ㎕ 폴리스티렌 판을 보내고 4 ° CO / N에서 흔들.
  2. 과도한 항원을 제거 마이크로 통에 250 rpm에서 실온에서 1 ~ 2 시간 동안 진탕 차단 버퍼 200 μL와 접시를 차단하거나 손으로 또는 자동화 된 평 와셔를 200 μL의 PT 버퍼로 4 회 세척한다.
  3. (: 10-1 : 1 희석 PBT 버퍼 20) 파지 상층 액 100 μl를 적용, 200 μL의 PT 버퍼와 8 번 실온에서 15 분 동안 250 rpm으로 흔들어 판을 씻는다.
  4. (: PBT 버퍼에 5000 1) 100 항 M13-HRP의 μl를 추가합니다. 실온에서 30 분 동안 200 rpm으로 흔들어 후, PBS의 200 μL로 판을 두 번 여섯 200 μL의 PT 버퍼와 시간과 씻는다.
  5. 한 100 ㎕ 적용 : 1 TMB 기질을 5-15 분 동안 개발 (또는 실질적인 색상이 개발 될 때까지) 한 후 3 일 MH 100 ㎕ 첨가하여 반응을 정지 4, 450 nm에서의 판을 읽습니다.
  6. 일반적으로, 파아지 풀 증균> 2 (도 4 참조)의 비 - 특이 적 결합에 비해 특이 적 결합의 비율로서 발사 3-4에서 관찰 될 수있다
    참고 : 친 화성 태그 단백질에 그 높은 절대 결합 신호를주의하는 것이 유익 태그 고유 바인더 (오히려 대상 바인더 제외)의 농축을 표시하고, 음성 대조군 단백질에 그 높은 절대 결합 신호는 "비 특정 또는 농축을 나타냅니다 끈적 끈적한 "바인더.

5. 복제 선택, 시퀀싱 및 특성

단일 팹 파지 클론의 5.1) 분리

  1. 시퀀싱 및 특성에 대한 개별 클론을 분리 T1 파지 내성 E.에 증폭 된 파지 풀의 1/10 볼륨을 감염 대장균 둥근 바닥 마이크로 타이 터 플레이트에서 성장의 로그 단계에서 세포 (= 0.4 ~ 0.8 OD 600), breatha 커버BLE 시일 판 및 37 ° C에서 30 분 동안 200 rpm에서 진탕 배양한다.
  2. 2YT 미디어의 10 배 희석액을 준비하고 ㎍ / ㎖ 카르 베니 실린 100 보충 별도의 한천 플레이트에 판을 밖으로.
  3. 1 × 10 9 M13K07 파지 / ㎖로 보충 2YT / 수화물 미디어의 450 μL에 단일 식민지를 선택하고 200 rpm으로 진탕 37 ° C에서 배양 미니 튜브 96 웰 멸균 마이크로 파란색 상자에 O / N 성장.
  4. 4 ℃에서 10 분 동안 4,000 XG에서 회전하여 펠렛 박테리아.
  5. 이상의 경우 (5.4 절에서 설명한 바와 같이) 클론 파아지 상등액 팹 파아지 클론의 서열 분석에 사용할 수있는 클론 직접 결합 (섹션 5.3 및 21에 기재된 바와 같이)하는 대표적인 결과가도에 도시되어 고정화 항원에 대한 특이성을 결정하기 위해 한 ELISA를 5.

특성화 된 Fab 클론의 5.2) 식

  1. 다음 적절한 전자에 복제XPRESSION 벡터 (토론 참조), 단일 E.을 선택 대장균 발현 형질 전환 된 콜로니를 멸균 이쑤시개 또는 피펫 팁을 사용하여 200 rpm으로 진탕 37 ° C에서 12 ~ 16 시간 동안 성장을 96 웰 깊은 웰 플레이트에 2YT / 수화물 미디어 1 ㎖에 구성한다. 이 수동 또는 자동 식민지 피커 수행 할 수 있습니다.
  2. Studier 등의 방법에 따라 96 웰 deepwell 블록에 포도당 / 유당 / 글리세롤로 보충 NZY 미디어 1.5 ml의에 성장 문화의 40 μl를 전송. (15)
    참고 : 다른 방법으로, 세포는 1 mM의 IPTG의 첨가에 의해 유도 보충 비와 단백질 발현에 3-4 시간 (OD 0.8) 재배 할 수있다.
  3. 통기성 도장 문화 블록 (들)을 커버하고 200 rpm으로 진탕 30 ℃에서 6-8 시간 동안의 Fab 클론을 표현한다. 15 분 동안 4,000 XG에 스핀 플레이트, 박테리아 세포 펠릿 용해 될 때까지 -20 ° C에서 알약을 호일 씰 뜨는, 커버 플레이트를 제거하고 동결.
  4. 용해 버퍼 100 ㎕ (트리스 염산의 50 mM, 200 mM의 염화나트륨, 1.25 % 트리톤 X-100의 pH를 1 ㎎ / ㎖의 리소자임 10 U benzonase / ml의 문화와 단백질 분해 효소 억제제 8.0)에 수집 된 펠릿로부터 발현 된 Fab을 해방 2 진탕 4 ° C에서 시간.
  5. 4 ° C에서 15 분 동안 4,000 XG에서 원심 분리하여 세포 파편을 제거하고 ELISA 플레이트 (5.3 절)에 의한 특이성의 초기 특성 분석에 사용되는 원유 해물 뜨는를 수집합니다.

클론 팹 ELISA 바인딩 직접 5.3) 복제 특성

  1. 대신 384 웰 플레이트의 웰에 PBS에서 2 ㎍ / ㎖의 항원의 30 μl를 aliquotting 3.1 절에 설명 된대로 항원을 무력화. 96 채널 기반 분배 헤드를 사용할 때 접시 쿼드 기반 항원 레이아웃 시약 전달을 용이하게 할 수있다. 3.1 절에 따라 세척 및 블록 ELISA 플레이트.
  2. 에서 수집 해제 해물 5.2 절은 에바에 대한 고정 된 항원에 직접 적용 할 수 있습니다바인딩의 luation. 200 rpm으로 진탕하면서 실온에서 15 분 동안 웰 당 30 μl의 용 해물을 배양한다.
    주 : 정제 된 Fab 클론 단백질 교대 바와 동일하게 PBT 버퍼에 10 ㎍ / ml의 희석 항원 또는 음성 대조군 단백질 (GST, BSA 등)을 함유하는 차단 된 웰에 각 클론의 30 μL를 도포하고, 현상에 의해 사용될 수있다 아래. 이와 달리, 팹 파지 또한 파아지 상층 액 10㎕를 희석하여 사용될 수 20 μL의 PBT 버퍼 (5.1 절에서 설명) (1 : 3)로 (단계 4.4에 기재된 - 4.5) 항 M13-HRP 항체로 검출
  3. 초과 해물을 제거하고 수동 또는 자동 판 PT 버퍼의 8 배 100 μl를 세척하고 초과 버퍼를 제거하여 우물을 씻어.
  4. 200 rpm으로 진탕하면서 실온에서 30 분 동안 PBT 버퍼 보조 항 - FLAG 항체의 희석 5000 : 1의 30 μl를 부화.
  5. 워시, 개발 및 섹션 4.3에 따라 정량화 - 4.5.
    참고 : 대표 결과설명 특정 및 불특정 모두 결합 클론 그림 5에 표시됩니다.

5.4) 복제 시퀀싱

  1. 표 2에 나타낸 바와 같이, PCR 마스터 믹스를 준비한다.
  2. PCR 플레이트의 우물에서 적절한 프라이머 준비 PCR 마스터 믹스 20 μL에 적절한 PCR 템플릿 (파지 상층 액 또는 재 부유 한 파지 미드 함유 세균의 식민지 중 하나)의 2 μl를 추가합니다.
    참고 : 별도의 마스터 믹스가 모두 중쇄 및 경쇄 유전자의 염기 서열이 필요합니다.
  3. PCR 설정 - 표 2에 열거 된 파라미터를 이용하여 PCR 반응을 실행.
  4. 300 nm의 DNA에 transilluminator가 시각화 얼룩과 촬상 보충 1 % 아가 로스 겔에 로딩 염료와 반응 완료 5 μL를 혼합하여 PCR 반응의 성공 여부를 확인한다.
  5. 0.2을 함유하는 멸균 수로 10 μL PCR 생성물의 2 μL를 추가및 엑소 뉴 클레아 제 및 새우 알칼리성 포스파타제 각각 μL 시퀀싱에 대비 초과 프라이머를 제거하기 위해 10 분 동안 80 ° C에서 효소 불 활성화 한 다음 20 분 동안 37 ° C에서 배양한다.

자동 선택 6. 크기 조정

6.1) 피펫 기반 액체 처리

  1. 1 %를 준비 물 (w / v)의 브로 모 페놀 블루와 0.45 ml의 필터를 사용하여 이물질을 제거합니다.
  2. (16 희석액 총) 물에 1 % 브로 모 페놀 블루 용액 1000 희석, 및 2 배 희석액을 계속 : 플레이트 판독기에서 흡광도의 선형 범위를 결정하기 위해, 1을 제조 하였다.
  3. 평평한 바닥 96 웰 플레이트에 각 희석 100 μl를 전송하고 590 nm에서 흡광도를 참조하십시오. 플롯 절대 희석 배수 대 흡광도 및 후속 시험을위한 선형 범위의 하이 엔드 중반에 희석을 선택합니다.
  4. 물 또는 실제 용액에 브로 모 페놀 블루를 추가그 세 96 웰 플레이트에 피펫에 대한 충분한 볼륨의 이전 단계에서 선택한 희석 플러스 저수지에서 죽은 부피를 기준으로 피펫됩니다.
  5. 분석 저울에 물을 피펫 팅하여 테스트 볼륨을 제공하는 단일 채널 피펫 보정 (물 100 ㎕ 실온에서 100 mg의 무게.)
  6. 보정 피펫을 사용 중으로, 590 nm에서 그들의 흡광도를 평평한 바닥 96 웰 플레이트의 적어도 세 개의 웰에 염색 용액의 시험 체적을 전송하고 읽는다.
  7. 분석 저울에 세 개의 빈 평면 바닥 96 웰 플레이트의 무게를 측정하고 그 질량을 기록한다.
  8. 저수지에서 세 96 웰 플레이트의 각 및 중으로, 590 nm에서 그 흡광도를 측정 피펫 테스트 볼륨.
  9. 각 플레이트를 달아 질량의 차이를 계산한다.
  10. 먼저, (예., +/- 5 %) 각 웰의 흡광도가 공차의 범위 내에서 균일 여부를 평가 그들은 번째와 일치하는지교정 pipetman 손 피펫에 의해 얻어진 전자 흡광도. 특정 채널이 지속적으로 과다 또는 제공하는 경우 (예를 들어 그림 6 참조) 수리 절차를 준수하고 모든 채널이 균일 한 볼륨을 제공 할 때까지 평가 절차를 반복합니다.
  11. 둘째, 일단 모든 채널은 웰 당, 균일 한 양을 제공 평균 질량 차이를 계산하여 그 부피의 정확도를 확인하기 위해 확인된다. 예를 들어, 100 ㎕를위한 완벽하게 교정 액체 핸들러 세트는 접시 당 물 9.60 g, 물 0.10 g 당을 잘 제공 할 것입니다. 전달되는 실제 체적 일관 위에 또는 아래에 의도 된 볼륨의 경우, 보정 계수, 즉, 실제로는 100 μl를 제공하기 위해 110 μl를 프로그래밍에 적용될 수있다.
    참고 : 작은 볼륨의 경우, 예를 들어, 10 μl의, AB 있도록 손으로 96 웰 플레이트에 물을 90 μl를 염색 용액에서 더 브로 모 페놀 블루, 사전 나누어지는 열 배 사용sorbances 선형 범위에서 측정 가능한 가을입니다.

6.2) 자동 플레이트 세척

  1. 3.1 절에 설명 된대로 96의 별도 우물 우물 (각 조건에 대한 두 접시 테스트 할) 마이크로 양성 목표 및 음성 대조군 단백질을 고정.
  2. 실온에서 한 시간 동안 차단 솔루션과 배양에 의한 비특이적 결합 부위를 차단합니다.
  3. 10 13 CFU의 동일한 100 μL 씩 추가 / 모든 접시의 모든 우물에 PBT의 팹 파지 솔루션을 바인딩 대상으로 2 시간 동안 실온에서 교반과 함께 배양 ㎖로.
  4. 각 조건, 감염 및 적정 ELISA에 대해 하나의 판에 대해 하나의 판에 따라 2 판을 씻으십시오.
  5. (4 장에서 설명) 방지 M13 HRP 항체 및 비색 기판 또는 개발 ((M13K07 추가) 및 7.2.1없이 3.3 절에 설명 된대로) 박테리아와 적정에 직접 감염에 의한 세척의 효과를 평가합니다.
  6. 파지 역가의 FROM 특정 클론들은 클론에 대해 특이 적으로 결합하는 고정화 된 단백질 5 내지 10 7 -10 파지 / ㎖의 범위에서 수득된다. 음성 대조군 단백질 (예를 들어, BSA)에 일부 잔류 바인딩은을 손상시킬 수, 예상 할 수있는 일반적으로 (10)가 2 -10 5 파지 / ㎖가 관찰된다, 그러나 매우 낮은 역가 (즉., <10 1) 지나치게 엄격한 세척 신호를 보낼 수있다 선택.
  7. 파지 ELISA에 의해 결정 바인딩 로봇 세탁 설립 손 씻기 결과 (그림 7)과 동일한 경우는 양성과 음성 대조군 단백질 결정하기 위해, 절대 바인딩 신호를 비교한다.

6.3) 플레이트 세탁기 오염 제거

  1. 시작하려면, 테스트 할 수있는 오염 제거 프로토콜을 실행합니다.
    참고 : 적어도 두 총 라인 볼륨을 사용하고, 프라임 및 5 분에서 0.5 %의 차아 염소산 나트륨을위한 와셔 헤드 소크 추천 갓 희석 FROM 상업용 표백제 (전형적으로 6 % 차아 염소산 나트륨).
  2. 라인까지 총리 및 살균 (멸균) 물에 5 분 동안 세탁기 머리를 적시고 마지막으로, 주요 시스템은 공기로 가득합니다.
  3. 프라임 멸균 또는 세척 버퍼 라인.
  4. 한 번 멸균 96 웰 마이크로 플레이트를 세척 세탁기에서 제거하고 멸균 판 도장 인감. 이것은 사전 오염 제어 판이다.
  5. 분취 액 100 ㎕ O는 / N은 ​​96 웰 플레이트의 모든 웰에 파지 배양 상등액을 증폭.
  6. 한 번 파지 함유 플레이트를 세척 한 후 세탁기에서 제거하고 플라스틱 또는 호일 판 도장 인감. 이것은 오염 제어 판이다.
  7. 오염 제거 프로토콜을 수행하는 테스트되고. 이 예에서, 반복 6.3.1와 6.3.2 단계를 반복합니다.
  8. 한 번 멸균 마이크로 세탁 후 세탁기와 실에서 제거합니다. 이 오염 제거 테스트 플레이트이다.
  9. 로그 상 E. 접시 50 μL 적정 판에 대장균; 이것은 사전 인 감염이다기 제어 판.
  10. 사전 오염, 오염 및 오염 제거 96 웰 플레이트 봉인을 해제와 E의 100 μl를 추가 각 웰에 대한 새로운 정보를 사용하여 모든 우물에 로그 단계 성장 단계에서 대장균.
  11. 밀폐하고 200 rpm에서 30 분 동안 37 ° C에서 배양한다.
  12. 판 (50) 10cm 2YT / 수화물 판에 각 96 웰 플레이트의 세 가지 임의의 우물에서 감염된 세포의 μL, 37 ° CO / N 품어.
  13. 1 ml의 2YT 플러스 아니라 당 100g / ml의 카르 베니 실린을 포함하는 깊은 웰 플레이트에 각 판의 모든 우물에서 전송 감염된 세포의 50 μl를 37 ° C에서 O / N 성장.
  14. 오염 제거 프로토콜을 반복 선 건조 세탁기를 둡니다.
    참고 : 접시에 또는 액체 배지 없음 O / N 성장은 사전 감염 관리, 사전 오염 제어 또는 오염 제거 테스트 판에서 관찰되어야한다. 많은 식민지와 성장은 오염 제어 판에서 관찰되어야한다 의 효능에 대한하지 않을 경우, 어떤 결론 없습니다제염 프로토콜이 가능하다. 이상적으로는, 오염 제거 판은 식민지와 O / N 플레이트의 우물 만약 어떠한 O / N의 성장을 얻을 수 없습니다. 제염 프로토콜의 엄격함, 표백제 높은 농도 증가 회 이상 추가 소크 사이클 수있다.

7. 입 / 출력 적정

7.1) 입력 파지 적정

  1. 멸균 여과 PBS 50 μL에 파지의 5 μL 나누어지는을 희석하고 혼합한다.
  2. 멀티 채널 피펫 또는 96- 채널 피펫을 사용하여 10 (10)로 여과 멸균 PBS에 10 배 일련 희석을 준비한다.
  3. T1 파지 내성 E. 45 μL로 희석 파지의 5 μl를 접종 성장 (OD 0.6-0.8), 37 ° C에서 30 분 동안 숨 씰으로 덮여 품어의 로그인 단계에서 대장균 세포.
  4. 100 ㎍ / ml의 카르 베니 실린 및 O / N의 품어 보충 LB / 한천 플레이트에 감염된 세포 접시 5 μLt 37 ° C의.
  5. 파아지 콜로니 농도는 2.8 절에 설명 된 계산에 따라 나타나는 가장 묽은 샘플로부터 추정 될 수있다.

7.2) 출력 파지 Pitrations

  1. E. 첨가하여 플레이트 - 결합 파아지의 용출에 이어 대장균 세포는 멸균 2YT 미디어 50 μL 파아지 감염된 세포의 5 μL 분취 량을 희석
  2. 멀티 채널 피펫 또는 96 채널 피펫을 사용하여 106로 멸균 2YT 배지에서 10 배의 일련의 희석을 준비한다.
  3. 판 (5) 100 ㎍ / ml의 카르 베니 실린 보충 한천 플레이트에 감염된 세포의 μL, 37 ° C에서 O / N을 품어.
  4. 파아지 콜로니 농도는 2.8 절에 설명 된 계산에 따라 나타나는 가장 묽은 샘플로부터 추정 될 수있다.
    참고 : 두 경우 모두 (에서 즉, 입력 및 출력 파지 캡션, 모두 테트라 사이클린에 식민지 번호와 비교하여 (총 CELL 번호) 및 카나마이신 (헬퍼 파지 역가)도 정보가 될 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

본원에 기재된 프로토콜은 병렬 조합 된 Fab 파지 표시 라이브러리로부터 structurally- 기능적 관련 항원 도메인 모두의 다양한 항체 단편을 분리하는데 사용되어왔다. 가용성 항원과 관련된 문제는 항체의 선택 (23)에 적합한 항원 발현 도메인 실리 식별에 의해, 많은 경우에 회피 될 수있다. 실험실 내에서 동일한 항체 선택으로 (도 1) 항원의 발현을 연결함으로써 그 선택에 중요한 항원 파라미터들이 더 쉽게 제어 할 수있는 통합 된 파이프 라인을 구축하는 것이 가능해진다. 대부분의 경우, 도메인 경계의주의 결정은 항체 선택의 성공적인 사용에 대한 표현과 96 또는 24도 deepwell 판에 높은 처리량 표현에서 충분히 순수한 항원의 적절한 수량의 분리 (그림 2) 할 수 있습니다. 연속 동안선택 프로세스의 발사 속도는, 구체적으로는, 항원 농도 용출 된 파지 및 파지의 농축은 ELISA 분석에서 적정 어느 파지 (도 3) 또는 파지 풀이 (도 4)에 의해 모니터링 될 수있다. 결합 비율 (> 2) 일반적으로 특이 적 결합 클론의 존재를 나타냅니다. 반대로, 낮은 비율 (<2) 선택 실패의 원인을 확인하는 데 도움이 될 수 있습니다. 예를 들어, 높은 비특이적 OD와 비율 <2 비특이적 클론 (스티커 또는 결합제)의 제거 불량을 나타낼 수 있고, 선택 프로토콜의 최적화를 더욱 보장 할 수있다. 농축이 검출되면 그러나, 개별 높은 친화 클론은 시퀀싱 및 특성화를 위해 분리 될 수있다. 복제는 비색 면역 특징 및 농축의 측정을, 음성 대조군 단백질에 비해 고정 된 항원에 팹 파지 또는 팹의 결합 산출의 비교 (TA에 결합의 비율을 가능하게 할 수있다 바인딩음성 대조군 단백질 또는 친 화성 태그 단백질) (그림 5) 대 rget.

스케일링 및이 방법의 자동화를 수행하는 동안, 액체 핸들링 유닛의 주요 기능의 평가는 실제의 선택시 사용되는 것과 유사한 솔루션으로 적절하고 정확한 작동을 위해 도움이 될 수있다. 솔루션 흡수하는 발색단의 사용은 유체의 특정 채널 (흡인 또는 분배)이 하나 막혀 또는 그림에 나타낸 바와 같이 부분적인 볼륨 배달의 결과로 도장을 분실 한 때를 감지하는 데 도움이 될 수 있습니다 6. 자동 세척 장치는 또한 변화의 원인이 될 수 있습니다 과주의를 필요로 할 수 있습니다. 공지 된 결합 클론의 사용은 분배 속도, 세척 볼륨 및 세척의 수와 세척 파라미터가 최적화 될 때 배경 제거 바인딩 동안 유지하는 바인딩 대상 (도 7)을 보장하기 위해 목표 제어 단백질 사이의 결합 비교를 가능하게한다. 다음의파지 솔루션 자동화 접시 세척기의 사용은 효과적인 살균 프로토콜 선택 또는 다른 선택 프로 시저 및 문제 해결 / 통역 안내를 표 3에 제공된다 연속 라운드에서 교차 오염의 부재를 보장하기 위해 필요하다.

그림 1
그림 1. 개요 -. 높은 처리량 항원 및 항체 생산 선택 파이프 라인이 개요 대표적인 항원 항체 생성 및 선택 파이프 라인의 단계별 시각화를 나타낸다. 항원 도메인 경계에 실리 식별 저조한 특징으로 할 수있다 단백질 도메인에 따라 유전자 합성, 표현과 선택을 할 수 있습니다. 표현 항원 도메인은 고정 및 공동에서 특정 선호도가 높은 항체 클론의 풀을 분리하는데 사용하는mbinatorial 항체 라이브러리는 필라멘트 성 파지의 표면 상에 디스플레이. 개별 항원으로부터 용출 증폭 항체 - 파아지 풀 후. 종래 특성화 개별 결합 클론의 단리 음성 대조군 단백질에 비해 고정 된 타겟을 비교 ELISA 기반 분석에서 특이 적 결합 클론 라운드 투 라운드 보충을 모니터하는 데 사용될 수 주십시오 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
친 화성 태그가 항원 그림 2. SDS-PAGE 시각화. 표현과 정제 6X-HIS-GST 태그가 항원 도메인 (5 ~ 10 kDa의 도메인 + 26 kDa의 GST)는 원래 항원의 실리코 분석에 의해 식별의 대표 SDS-PAGE 도메인 경계. 단백질 도메인은 표현 affi에 의해 분리친화력 정화는 크기 기반의 정체성, 충분한 수율 및 파지 항체 선택의 사용을 가능하게하는 순도를 보장하기 위해 사전 선택에 SDS-PAGE에 의해 특징입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
도 3 파지 출력 역가 시각화. 파지 출력 역가가 낮은 희석을 결정하는 다양한 항생제 (테트라 사이클린, 카 베니 실린과 가나 마이신)로 보충 한천 매체에 10 배 희석 시리즈 위에 파지 감염 세포를 도금에 의해 결정되는 콜로니의 관찰 및 항원을 대상으로 용출 수 밖에 파지의 수를 추정 할 수있다. 큰를 보려면 여기를 클릭하십시오이 그림의 R 버전.

그림 4
풀 ELISA에 의한 음성 대조군 단백질 목표 그림 4. 바인딩 비율은. 농축의 진행은 특정 대상 및 음성 대조군 단백질 및 / 또는 격리 된 친 화성 태그 모두에 대해 각각의 증폭을 이동상을 선별하여 선택의 다음 라운드를 평가할 수있다. 플롯에 표시된 병렬 음성 대조군 단백질에 비해 96 개의 각각의 항원에 대해 96 개인 파지 항체 풀의 결합의 농축 비율입니다. 각각의 비율 값은 대상 또는 M13 파아지 코트 단백질에 특이 HRP - 융합 된 항체를 이용하여 음성 대조군으로 단백질 중 파아지 풀의 결합 재배 적 개의 흡광도 측정으로부터 유도된다. 이 이상 (적색에 도시 된 바와 같이 종종 2-10 이상의 이르기)의 비율이 임계치 농축 표시로서 사용특정 바인딩 클론의 가능성이 존재. 적은 비율의 고장 또는 프로토콜의 추가 최적화를 보장 할 수있다 선택에 특정 문제를 의미 할 수 있습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 5. 직접 바인딩 클론 팹 파지 또는 팹 ELISA. (FAB-파지 또는 팹 형식에 관계없이) 384 웰 플레이트에 고정 된 단백질 대 ELISA 기반 분석에 의해 평가 될 수있는 단일 클론의 결합. 팹 파지 또는 팹에 친 화성 태그에 M13 코트 단백질에 대해 보조 HRP-융합 항체를 이용하여 검출 바인딩. 항원 음성 대조군 단백질과 항원 선호도 태그 (GST)를 대상으로 클론의 Fab 파지의 결합에 대한 원시 흡광도 값은 특정 BI를 설명 그려져있다nders (A01, A04, A06), 및 접착 바인더 (A05).

그림 6
자동화 된 액체 핸들링 수단에 의해 분배 된 양의 평가도 6. 로봇 또는 수동 96- 웰 피펫 시스템 의도 볼륨의 일관되고 정확한 납기 염색 용액 및 플레이트 판독기를 사용하여 평가 될 수있다. 이 예에서, 용액을 함유하는 브롬 페놀 블루의 10 μl의 단일 팁 상자를 사용하여 96 개의 웰 플레이트의 모든 웰에 피펫으로 순차적이다. 각각의 잘 감염 E.에 헬퍼 파지의 추가 90 μL / 잘 dH보다 2 O, 유사 포함 대장균. 590 nm에서의 각 플레이트의 흡광도 중으로 판독되고, 볼륨은 표준 곡선으로부터 내삽 보정 pipetman 단일 채널을 사용하여 제조된다. 제 1 및 제 2 접시에 하나의 행에 전달 볼륨이 표시됩니다. 전나무 없다는 것을 기억하십시오t 판은 잘 E04에는 염색 용액을 수신하지 않고, 제 2 플레이트 상에, 그것은 이중 볼륨을 수신한다. 이 팁 터치 일관성 전달을위한 충분한 수 없음을 나타냅니다, 그리고 더 최적화가 필요합니다. 삼중 흡광도 측정에 대한 95 % 신뢰 구간을 나타낸다.

그림 7
자동화 된 플레이트 세척 그림 7. 평가. 언 바운드 파지의 효과적인 제거는 세척 조건을 변화시키면서 고정 된 양 (항 FLAG 항체)과 음극 (BSA) 제어 단백질에 결합 팹 파지를 측정하는 ELISA를 사용하여 평가 될 수있다. 이 예에서, 나이브 라이브러리 (PBT 10 13 CFU / ㎖)과 유사한 입력 파지 손으로, 여덟 개 또는 16을 사용하여 세척 또는 로봇을 이용하여 제거된다. 고정 방지 FLAG 항체에 특이 적으로 결합 그대로 BSA에 결합 잔류 파지, 모든 조건에서 동일, 인도이 낮은 유량 것을 조작 해, 두 방법은 동일 충분히 엄격하다. 중복 웰에서 95 % 신뢰 구간이 도시되어있다.

솔루션
2YT 미디어 - 7.0 오토 클레이브에 적응, 1 L에 pH가 물을 추가합니다. 효모 추출물 10g
트립 16g
염화나트륨 5g
NZY 미디어 (1 L) NZ 아민 10g
효모 추출물 5g
50X ZYM-5052 20 ㎖
20 소금 stock 50 ㎖
50 배 ZYM-5052의 설탕 stock (1 L) 포도당 25g
유당 100g
글리세린 250 ml의
20 배의 소금 stock (1 L) 2 HPO 4 500 mM의
KH 2 PO 4 500 mM의
NH 4 CL 1 M
2 SO 4 100 mM의
카르 베니 실린 (탄수화물) : 100 ㎎ / ㎖의 물에. 필터 소독.
카나마이신 (칸) : 25 ㎎ / ㎖의 물에. 필터 소독.
테트라 사이클린 (구정) : 10 ㎎ / ㎖의 물에. 필터 소독.
PEG-NaCl을 PEG
염화나트륨 2.5 M
1X PBS (pH7.2) 염화나트륨 137 mM의
의 KCl 3 mM의
2 HPO 4 8 mM의
KH 2 PO 4 1.5 mM의
1X KCM 의 KCl 500 mM의
염화칼슘 2 150 mM의
의 MgCl 2 250 mM의
SOC 미디어 효모 추출물 5g / L
트립 20g / L
염화나트륨 10 mM의
의 KCl 2.5 mM의
황산 20 mM의
포도당 20 mM의
버퍼를 차단 PBS 1 배
BSA 0.20 %
PBT 버퍼 PBS 1 배
BSA 0.20 %
트윈 0.05 %
PT 버퍼 PBS 1 배
트윈 0.05 %
인산 H 3 P0 4 1 M

표 1. 미디어 및 솔루션.

PCR MASTER-MIX의 SET-UP <> / 강해
구성 요소 반응 당 μL
19.45
10 배의 Taq 버퍼 2.5
의 dNTPs (10 mM의 주식) 0.675
DMSO 0.75
DNA 형성 촉매 효소 0.125
앞으로 프라이머 (100 μM의 주식) 0.25
역방향 프라이머 (100 μM의 주식) 0.25
중쇄 시퀀싱 프라이머
M13 앞으로 프라이머 GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC
M13 역방향 프라이머 CAGGAAACAGCTATGACGGGAAGTGTCCTTGACCA
라이트 체인 시퀀싱 프라이머
M13 앞으로 프라이머 TGTAAAACGACGGCCAGTCTGTCATAAAGTTGTCACGG
M13 역방향 프라이머 CAGGAAACAGCTATGACCCCTTGGTACCCTGTCCG
PCR의 설정
1 단계. 3시 분 동안 94 ° C
2 단계. 0시 반 분 동안 94 ° C
3 단계. 0시 반 분 동안 55 ° C
4 단계. 1시 분 동안 72 ° C
2 단계와 24 배를 반복로 돌아 가기 2 단계로 이동
5 단계. (72) 7시 분 동안 C를 °
6 단계.

표 2. PCR 마스터 믹스 및 설정.

오염 제거 결과의 해석
예상 카르 베니 실린 역가 그렇지 않다면?
사전 감염 관리 0 세포를 사전 감염시켰다; 아무 것도 실험에서 결론을 할 수 없습니다.
오염 제어 잔디 부족 오염은 이후의 오염 제거의 효과를 평가 할 수 있어야합니다; 그것을 흡입보다는 파지 용액에서 매니 폴드를 잠수 고려한다.
오염 제거 테스트 0 오염 제거가 완료되지; 시간을 흡수 증가, 표백제 집중하고기 또는 시도 SDS와 EtOH로 세척 대신.

표 와셔 제염 3. 평가. 제염의 효능을 결정하기 위해, 그것은 그 세탁기 파지로 오염시켰다 보여줄 필요가 있고, 살균 프로토콜이 성공적으로 오염을 제거하는 것이있다. 저항 카르 베니 실린 부여 파지를 사용하여, 이러한 테스트에서 예상되는 결과는 실제 결과가 예상 결과와 다를한다 제안과 함께 나열됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

시험 관내 항체 선택에서 수행 할 때, 선택 성공의 두 가지 주요 결정 요인에 따라 선택하는 선택) 잘 접혀진 표적 항원의 분리 (1)이며, 2) 높은 다이버 시티 기능성 항체 라이브러리의 이용. 많은 경우에, 잘 접혀, 전체 길이 단백질의 충분한 양의 가용성은 제한 될 수있다. 이러한 제한을 극복하는 한 가지 방법은 적당한 친 화성 태그 박테리아 발현 벡터에 삽입 생물 정보 학적 분석 (22)로부터 식별되고 합성 된 도메인을 사용하는 것이다.

용해도를 증가 정제를 용이 불안정 도메인을 안정화. (11)에게 원하는 삽입 서열은 매우 다양한 항원 생성 플랫폼 있도록 가상적 합성하는 기능을하는 생명 공학 분야에 사용되는 태그로 다양하다. GST-태그 형식이 공통이지만, 이전에 성공적인 결과왔다헥사 히스티딘, 된 Fc, 할로, 말 토스 결합 단백질과 부위 - 특이 적 바이오 틸 태그를 사용하여 수득하고이를 무수 다른 친 화성 태그 유사한 플랫폼에 최적화 될 수 있다고 여겨진다. 그러나, 친화도 태그는 다운 스트림 애플리케이션 (11)에 유익하고 의도하지 않은 부정적인 결과 모두를 가질 수 있고 충분히 특정 포맷에 기초하여 파이프 라인을 설립하기 전에 조사되어야한다.

종종 새로운 사용자 항체 라이브러리의 품질을 평가하는 방법에 대한 의문을 제기한다 더 간단 응답이 없을지라도, 하나의 전체 다이버 시티, 상대 디스플레이 수준의 성질을 포함하여 (천연 또는 합성 여부) 몇 가지 주요 기능을 평가하기 위해 노력해야 무작위 배정의 범위 (즉, 순서에 의해 결정 라이브러리 콘텐츠 대 도서관 디자인) 의도 된 응용 프로그램에 비해 항체의 물리 화학적 특성. 이 프로토콜의 범위를 넘어,보다 상세한 금속 표면 처리하지만이러한 기능의 NT와 그들이 어떻게 항체의 선택에 영향을 미칠 수는 여기에 2,23 찾을 수 있습니다. 도서관 다양성의 지식은, 특히, 중요한 선택 중 다양성의 적절한 범위를 보장하는 것입니다. 전형적으로, 라이브러리 내의 각 파지 클론 100-1,000의 복사본을 제공 파지 농도가 바람직하고 라이브러리에 존재하는 임의의 양수에 해당 바인더가 복구 될 수 있도록한다. 그러나, 파지의 비 특이 적 결합이 극적으로 위의 10 (13) 파지 / ㎖, 매우 다양한 라이브러리에 대한 표면 증가 마이크로 플레이트, 항원 당 하나의 잘보다 더 충분한 커버리지를 보장하기 위해 필요할 수있다. 입력 라이브러리가 너무 희박한 한편, 진정한 포지티브 결합제의 절대 농도는 원경은 복구되지 않는다는 KD (전형적 ㎚) 미만이어야한다. 이러한 제한 조건을 감안할 때, 파지 라이브러리는 일반적으로 선택의 첫 번째 라운드 10월 12일부터 13일까지 파지 / ㎖에 재현 탁해야합니다.0; 이 농도에서, 파지의 100 L 나누어지는 10 9 -10 10 다양성 라이브러리의 1,000-100 배 범위를 나타내는 일상적으로 다양한 항원에 결합하는 클론을 생성 할 수있다. 더 낮은 농도, 또는 증가 된 다양성부터, (섹션 2.9 참조)에 대해 첫 번째 라운드에서 선택된 항원의 웰의 수를 증가시킬 필요가있을 수있다. 1 라운드에이어서, 그러나, 라이브러리의 구속력 다양성의 대부분이 제거되었다; 1 라운드 출력 다양성의 초과 범위는 하나의 잘을 사용하여 가장 자주 쉽게 달성 할 수있다. 96 웰 플레이트에서 병렬 선택 항목의 경우, 이는 첫 번째 라운드에 후속 한 항원에 필요한 선택 판의 수를 줄일 수있다.

농축가 충분하지 않은 경우, 특히 선택의 초기 라운드에서 관심의 영역을 식별하는 데 도움 동안 실제 선택시, 파지 적정, 특성화하고 진행 상황을 모니터링 할 객관적인 조치를 제공 할 수 있습니다검출 될 수있다. 이것은 프로토콜의 성능을 결정하는 선택 스케일링 동안 특히 유용 할 수있다. 일반적으로 입력 파지 역가 (즉, 순진 라이브러리 또는 용출 된 파지의 사후 증폭) 오염 가능성을 나타내는 가난한 세포 성장 / 낮은 파지 캡션과 함께, (10 12 -10 13 파지 / ㎖) 라운드 사이의 상대적으로 일정하게 유지해야합니다 및 / 또는 이전 라운드에서 가난한 출력. 출력 파지 역가가 선택 이후 라운드에서 농축 동안 증가 할 것으로 예상되지만, 처음 두 라운드에서 10 -10 5 CFU / ㎖의 범위가 예상된다. 이 범위에서 편차는 오염이나 과도한 세척 엄격 등의 선택에 잠재적 인 문제를 나타낼 수 있습니다. 선택 이후 라운드에서 (즉,도 3 및도 4 라운드), 구체적으로는 표적 항원에 결합 클론의 농축은 표적 항원에 대해 부정적이든 파아지 풀의 결합 ELISA를 통해 측정 값을 모으고 평가할 수있다제어 단백질 (제 4 장 참조).

선택 3-4 라운드 후 (2의 음성 대조군 단백질 신호 비율 또는 목적 단백질의 농축은 표적 항원에 이르면 배경 단백질에 비하여 하나 이상), 감염된 균체 시퀀싱 단일 파지 미드 콜로니를 분리 도금 초기 특성화 및 클로닝 필요. 이 때, 추가 특성 전에 팹을 확보하기 위해 팹 파지를 변환하는 것이 매우 좋습니다. 된 Fab 파지는 파지 상청액 10㎕를 희석하여 초기의 특성화를 위해 사용될 수 있지만 (단계 4.4에 기재된 - 4.5) 20 μL에 PBT 버퍼 및 항 M13-HRP 항체로 검출 (섹션 5.1 참조) 경험상, 파지 입자와 초기 변환 가양 문제를 미연에 방지 할 수 바인딩 속성 해방에 클론의 5~20% 어디에서 실질적으로 변경할 수 있습니다. 변환에 사용되는 특정 방법론은 uniqu에 따라 달라집니다전자 파지 미드의 구조 따라서는 여기에 명시 적으로 처리되지 않습니다. 그러나, 가장 널리 사용되는 벡터의, 이것은 일반적 유능한 비 억제 E.에 정제 된 파지 미드 (또는 파지 미드 풀) 1) 형질 전환에 의해 달성 될 수있다 이러한 HB2151 또는 55244 황색 정지 (TAG)이 코돈 팹과 PIII 단백질, 팹과 PIII 단백질 사이의 황색 종결 코돈 2) 삽입 비 억제 변형에 용해 항체 단편의 발현을 허용을 개입하는 경우 또는 대장균 균주 3) 적절한 발현 벡터에 개별 파지 미드 또는 파지 미드 풀)에서 면역 글로불린 유전자를 (복제하여. 추가 선택 및 특성화를 간소화하기 위해 풀링 복제 방법도, 모두가 식 해물 초기 특성에 사용되는 팹 파지 입자와의 위양성 결합의 가능성을 제거 식 구조에 대거 결합 클론을 변환하기위한 효과적인 수단을 제공 할 수 있습니다 비용과 정화의 노력처음에 회피 할 수있다.

(24 참조) 도서관 F에서 직접 고립 클론 항체 가변 도메인은 (도서관 F-감독 프라이머 재료의 표 2 참조 영역 (CDR을)를 결정하는 상보성을 증폭 PCR에 템플릿으로 파지 상층 액의 1-2 μl를 이용하여 염기 서열을 할 수 있습니다 ). 이들 프라이머를 사용하여 중쇄 및 경쇄 가변 영역은 각각의 3 개의 CDR을 모두 덮고, ~ 700, 500 ~ BP의 제품을 수득 할 것이다. 프라이머는 대부분의 시퀀싱 핵심 시설에서 사용할 수있는 표준 프라이머를 사용하여 (5.4.5 절에 설명 된대로) 제품을 정리 한 후 염기 서열을 할 수 있도록 M13 프라이머에 대한 어닐링 사이트를 포함한다. 또는, E.에 직접 발현 벡터에 클로닝 및 형질 전환 된 팹 파지 풀에 대한 대장균 발현을 위해, 단일 콜로니를 단리 할 수 있고, 단일 C위한 주형으로서 직접 사용될 2YT 15 μL 및 세포 현탁액 1-2 μL에 재현 탁적절한 프라이머를 사용하여 PCR olony.

자동화 선택은 몇 가지 주요 로봇 기능의 최적화 및 검증이 필요합니다. 일반적으로, 피펫 기반의 액체 처리는 모든 96 채널에서 정확하고 일관성이 있어야합니다, 접시 세척은 선택 접시에서 흡착 된 항원 또는 결합 팹 파지를 제거하지 않고 효율적으로 결합되지 않은 파지를 제거해야합니다. 라운드 농축하고 효과적인 카운터 선택 및 후속 간의 선택은 교차 오염을 방지 할 수 있도록 상기 플레이트 사이의 효과적인 오염 제거 와셔도 필요하다. 높은 처리량 선택 과정을 최적화하기 위해 이러한 기능을 평가하기위한 간단한 방법은 이전에 사용되었으며 프로토콜 내에서 아래의 상세한 설명되어 있습니다.

유동체 토출 / 흡입 헤드의 모든 채널에 의해 전달 된 볼륨의 일관성을 평가하기 위해, 착색 용액 평저 96 웰 플레이트에 피펫 팅한다 absorban각 CE 잘 플레이트 리더로 ​​측정. 예컨대 브로 모 페놀 블루 등 발색단 전달 볼륨 상이한 표면 장력 및 응집 특성의 효과를 평가하기 위해 실제 선택을 위해 사용 된 것과 유사한 염색 용액에 유용하다. 모든 채널이 일관 볼륨 분배되는 것을 확인한 후, 전체 전달 된 볼륨의 정확도는 각각의 플레이트에 전사 액의 질량을 측정함으로써 결정될 수있다.

비 결합 클론을 제거하는 세정 접시 자동화 주로 버퍼 분배 할 및 세척의 개수가 이용 될 세척하는 비율의 최적화를 필요로한다. 이 매개 변수를 평가하는 합리적인 방법은 긍정적 인 컨트롤 (특정 팹 - 파지 클론을 결합) 1) 항원 또는 결합 된 파지를 흡착 여부를 결정하기 위해 분배 속도 및 / 또는 세척의 수를 변화의 효과를 평가하기 위해 지나치게 엄격한 세척에 의해 제거되고 사용 동족 또는 비 단백질에 결합하는 2) 비 - 특이 과도한 D입니다UE는 충분히 엄격하지 않은 조건을 씻어. 잔류 / 결합 파지는 세균에 감염에 의해 단일 ​​집락을 위해 도금, 또는 ELISA 항체 친 화성 태그 또는 파지 코트 단백질에 대한 특정 차 항체를 사용하여 하나를 감지 및 정량화 할 수있다. 음성 대조군은 세척이 충분히 엄격하지 않은 경우 높은 수 있습니다 비 동족 / 배경 단백질로 단백질이나 특이 적 결합 팹 파지를 대상으로 구속력이 팹 파지의 잔류 수준을 평가하는 데 사용됩니다. 이 경우, 우리는 제본 및 양성 대조군으로 파지의 Fab에 FLAG 에피토프 태그를 인식하는 항 - FLAG 항체에 대한 비특이적 대조군으로서 BSA를 고정화 사용. 우리는 이러한 기술 당량이라고 보여, 매체의 유량으로, 손 세척 대 로봇 팔을 사용하여 세척하고 여섯 사이클을 비교 하​​였다. 또는, 지속적인 선택시 입력 및 출력 파지 역가 (7 항 참조) 측정도 세척 매개 변수의 미세 조정하는 데 도움이 될 수 있습니다. 마지막으로, 선택에 사용되는 판 와셔의 오염 제거는 이전 제품들 파지의 이월을 제거하기 위해 효과가 있어야합니다. 우리의 경험에 의하면, 갓 희석 0.5 % 차아 염소산 나트륨은 빠르고, 효과적이고 저렴합니다. 이러한 SDS와 같은 세제는 효과가 있지만 시스템에서 제거하는 것이 훨씬 더 광범위한 세척이 필요합니다. 어떤 테스트를하기 전에 시스템에 대한 시약의 호환성을 확인합니다. 오염 제거를 평가하기 위해, 표 3에 따른 결과를 유체 시스템에 의해 처리 용액 잔류 파지의 존재를 테스트하고 해석한다.

요약하면,이 프로토콜은 단백질 도메인에 대한 체외 선택에 병렬로 조합 라이브러리에서 팹을 분리하기위한 확장 가능한 방법을 제공하고 자동화 된 파지 선택 시스템의 유효성을 확인하는 기술을 제공합니다. 이 방법은 다시하지 않기 때문에 다양한 동물 시설 포즈 수 있습니다 비용 및 인프라 장벽 완화동물의 예방 접종시 LY. 또한, 항체 - 파아지 선택과 항원 생성을 통합하여, 선택 성공 인자 품질에 영향을보다 쉽게​​ 감시되고 조절된다. 초기 선택 및 특성화 항원 발​​현에서 기간 6-8 주 정도 있으면 생산 시스템 응답 성이 실현 될 수있다. 체외 선택에서 분리 된 항체는 모두 쉽게 반복 재현성 항체를 다시 생성하는 식 구조 만 저장 DNA를 필요로하는, (의한 유전자형 - 표현형 연계에) 수정 및 신 재생입니다. 마지막으로이 프로토콜은 맞춤 설계, 로봇 선택 시스템을 사용 준 수동 또는 완전 자동화 된 접근 방식을 사용하여 수행 할 수 있다는 것을 보여줌으로써, 처리량은 모두 작은 학문과 산업 연구소에 확장 가능하고 액세스 할 수 있습니다.

상술 높은 처리량 방법 및 라이브러리 합성 F 항체 라이브러리 (24)를 사용하여 체외의 면역을 포함한 면역 응용 프로그램의 다양한 기능적 할 수 있습니다 - 그리고 현장 -expressed 단백질. 임의의 주어진 선택에 대한 성공률이 항원 타겟들의 품질 (순도, foldedness, 모노 - 분산 등)뿐만 아니라, 항체 라이브러리의 질과 다양성 모두에 의존 하겠지만, 이는 25-80 어딘가에 것이 관찰되었다 항원 %는 높은 처리량 선택에 결합제를 산출한다. 중요한 것은 타겟 기능을 조절하는 능력을 가진 클론 종종 선택 될 수 있음을 주목할 필요가있다. 이 라이브러리는 이렇게 광범위한 친 화성 시약의 생성을위한 대안적인 접근법이 파이프 라인으로의 중요성을 강조하고, 잠재적 인 치료 응용 (25)이 항체는 순종하게 완전한 인간 프레임 워크를 이용하여 구성되고값.

요약하면, 강건성 및이 프로토콜에서 제시된 방법의 다양성은 거의 모든 멤버 친 화성 시약을 생성 장기 목표를 달성하기위한 실행 가능한 수단으로 최적화 산업화 및이 기술의 궁극적 광범위한 사용에 도움이 계속 인간 프로테옴.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자가 공개하는 게 없다.

Acknowledgments

우리는 NIH 일반 기금을 감사드립니다 - 단백질 캡처 시약 프로그램 재조합 항체 네트워크 항체 선택 및 특성화 파이프 라인 및 로봇 선택 플랫폼의 자금 조달 구매 혁신에 대한 캐나다 재단의 개발 자금을 지원합니다.

Materials

Name Company Catalog Number Comments
MATERIALS
New Brunswick Innova44 stackable incubator shaker Eppendorf M1282-0004
Liquidator 96 channel manual benchtop pipetting system Anachem Ltd LIQ-96-200
Microplate shaker VWR 12620-926
ThermoScientific Sorvall ST-40 benchtop centrifuge Thermo Product 75004525
ELx405 Select Deep Well Microplate Washer Biotek ELX405USD
Custom High Throughput Automated Phage Selection Robot S&P Robotics
Plastic conical Falcon tube: 50 ml VWR 21008-178
Plastic conical Falcon tube: 15 ml VWR 89039-668
Axygen 1.7 ml microcentrifuge tubes Corning MCT-175-L-C
96-well/384-well Maxisorp plate Sigma M9410-1CS
Corning 96-well V-bottom deep-well block Corning 3960
Axygen Mini-tube 96-well sterile microplate blue box Corning AXY-MTS-06-C-R-S
Breathable adhesive plate sealing film VWR 60941-084
REAGENTS
Name Company Catalog Number
polyethylene glycol Bioshop PEG800.1
yeast extract Bioshop YEX401.1
bio-tryptone Bioshop TRP402.1
N-Z amine Sigma C7290
glucose Sigma G8270-1KG
lactose Bioshop LAC234
glycerol Bioshop GLY001.500
carbenicillin  Bioshop CAR544.10
kanamycin Bioshop KAN201.25
tetracycline  Bioshop TET701.25
Tween 20 Bioshop TWN510.500
monobasic potassium phophate Bioshop PPM302.1
dibasic sodium phosphate Anachemia 84486-440
sodium chloride Bioshop SOD001.10
potassium chloride Bioshop POC308.1
calcium chloride Bioshop CCL302.500
magnesium sulphate EMD MX0070-1
magnesium chloride Bioshop MAG510.500
NH4Cl Amresco 0621-1KG
Na2SO4 Bioshop SOS513.500
agar Bioshop AGR001.500
SybrSafe DNA gel stain Invitrogen S33102
phosphoric acid Acros Organics 201140010
lysozyme Bioshop LYS702.25
benzonase Novagen 71205
Triton X-100 Bioshop TRX506.500
protease inhibitor cocktail tablets Roche 11 836 170 001
Ni-NTA resin  Qiagen 1018240
1,000x helper phage (M13K07) stock (1013 phage per ml) NEB N0315S
HRP conjugated M13-specific antibody (anti-M13-HRP). GE Healthcare 27-9241-01
TMB substrate: mix equal volumes of TMB and H2O2 peroxidase substrate  KPL 50-76-00
dNTPs Biobasic DD0056
Taq polymerase Genscript E00007
Exonuclease GE Healthcare  EZ0073X-EZ
Shrimp alkaline phosphatase GE Healthcare E70092Z-EZ

DOWNLOAD MATERIALS LIST

References

  1. Winter, G., Milstein, C. Man-made antibodies. Nature. 349, 293-299 (1991).
  2. Miersch, S., Sidhu, S. S. Synthetic antibodies: concepts, potential and practical considerations. Methods. 57, 486-498 (2012).
  3. Schofield, D. J., et al. Application of phage display to high throughput antibody generation and characterization. Genome Biol. 8, R254 (2007).
  4. Hust, M., et al. A human scFv antibody generation pipeline for proteome research. J. Biotechnol. 152, 159-170 (2011).
  5. Colwill, K., Graslund, S. A roadmap to generate renewable protein binders to the human proteome. Nat. Methods. 8, 551-558 (2011).
  6. Mersmann, M., et al. Towards proteome scale antibody selections using phage display. Nat. Biotechnol. 27, 118-128 (2010).
  7. Pershad, K., et al. Generating a panel of highly specific antibodies to 20 human SH2 domains by phage display. Protein Eng. Des. Sel. 23, 279-288 (2010).
  8. Turunen, L., Takkinen, K., Soderlund, H., Pulli, T. Automated panning and screening procedure on microplates for antibody generation from phage display libraries. J Biomol. Screen. 14, 282-293 (2009).
  9. Hughes, R. A., Miklos, A. E., Ellington, A. D. Gene synthesis: methods and applications. Methods Enzymol. 498, 277-309 (2011).
  10. Boersma, Y. L., Pluckthun, A. DARPins and other repeat protein scaffolds: advances in engineering and applications. 22, 849-857 (2011).
  11. Terpe, K. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60, 523-533 (2003).
  12. Lichty, J. J., Malecki, J. L., Agnew, H. D., Michelson-Horowitz, D. J., Tan, S. Comparison of affinity tags for protein purification. Protein Expr. Purif. 41, 98-105 (2005).
  13. Fellouse, F. A., et al. High-throughput generation of synthetic antibodies from highly functional minimalist phage-displayed libraries. J. Mol. Biol. 373, 924-940 (2007).
  14. Paduch, M., et al. Generating conformation-specific synthetic antibodies to trap proteins in selected functional states. Methods. 60, 3-14 (2013).
  15. Studier, F. W. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41, 207-234 (2005).
  16. Huang, H., Sidhu, S. S. Studying binding specificities of peptide recognition modules by high-throughput phage display selections. Methods Mol. Biol. 781, 87-97 (2011).
  17. McLaughlin, M. E., Sidhu, S. S. Engineering and analysis of peptide-recognition domain specificities by phage display and deep Sequencing. Methods Enzymol. 523, 327-349 (2013).
  18. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254 (1976).
  19. den Engelsman, J., et al. Strategies for the assessment of protein aggregates in pharmaceutical biotech product development. Pharm. Res. 28, 920-933 (2011).
  20. Lavinder, J. J., Hari, S. B., Sullivan, B. J., Magliery, T. J. High-throughput thermal scanning: a general, rapid dye-binding thermal shift screen for protein engineering. J. Am. Chem. Soc. 131, 3794-3795 (2009).
  21. Fellouse, F. A., Sidhu, S. S. Making antibodies in bacteria. in Making and Using Antibodies: A Practical Handbook. Howard, G. C., MR, K. aser CRC Press. Boca Raton, Florida. 151-172 (2013).
  22. Acton, T. B., et al. Preparation of protein samples for NMR structure, function, and small-molecule screening studies. Methods in Enzymology. 483, 23-47 (2011).
  23. Mahon, C. M., et al. Comprehensive interrogation of a minimalist synthetic CDR-H3 library and its ability to generate antibodies with therapeutic potential. J. Mol. Biol. 425, 1712-1730 (2013).
  24. Persson, H., et al. CDR-H3 diversity is not required for antigen recognition by synthetic antibodies. J. Mol. Biol. 425, 803-811 (2013).
  25. Bradbury, A. R., Sidhu, S., Dubel, S., McCafferty, J. Beyond natural antibodies: the power of in vitro display technologies. Nat. Biotechnol. 29, 245-254 (2011).
파지 - 표시 합성 항체 라이브러리의 확장 성 높은 처리량 선택
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miersch, S., Li, Z., Hanna, R., McLaughlin, M. E., Hornsby, M., Matsuguchi, T., Paduch, M., Sääf, A., Wells, J., Koide, S., Kossiakoff, A., Sidhu, S. S. Scalable High Throughput Selection From Phage-displayed Synthetic Antibody Libraries. J. Vis. Exp. (95), e51492, doi:10.3791/51492 (2015).More

Miersch, S., Li, Z., Hanna, R., McLaughlin, M. E., Hornsby, M., Matsuguchi, T., Paduch, M., Sääf, A., Wells, J., Koide, S., Kossiakoff, A., Sidhu, S. S. Scalable High Throughput Selection From Phage-displayed Synthetic Antibody Libraries. J. Vis. Exp. (95), e51492, doi:10.3791/51492 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter