Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Масштабируемость Высокая пропускная Выбор фага-дисплее синтетических библиотек антител

doi: 10.3791/51492 Published: January 17, 2015

Summary

Метод описан с визуальным сопровождением для проведения масштабируемых, выбор пропускной способности от фаговых дисплеев комбинаторных синтетических библиотек антител против сотен антигенов одновременно. С помощью этого параллельного подхода, мы выделили фрагменты антител, которые обладают высоким сродством и специфичностью в отношении различных антигенов, которые являются функциональными в стандартных иммунологических.

Abstract

Спрос на антитела, которые отвечают потребностям обоих фундаментальных и клинических исследований применения является высоким, и резко возрастет в будущем. Тем не менее, очевидно, что традиционные технологии моноклональные не одни до этой задачи. Это привело к развитию альтернативных методов для удовлетворения спроса на высокое качество и возобновляемых аффинных реагентов на всех доступных элементов протеоме. С этой целью, высокие методы пропускную способность для проведения отрывки из синтетических библиотек антител фагов отображается были разработаны для приложений, связанных разнообразные антигены и оптимизирован для быстрого пропускной способности и успеха. При этом протокол описан подробно, иллюстрирующий с видео демонстрации параллельный выбор Fab-фаговых клонов из библиотеки высоких разнообразия от сотен мишеней с использованием либо ручного обработчик жидкости 96 канала или автоматизированной системы робототехники. Используя этот протокол, один пользователь может генерировать сотни антигенов,выберите антител к ним в параллельных и проверки связывания антитела в течение 6-8 недель. Выделенные: я) жизнеспособным формат антиген, II) предварительный отбор антиген характеристика, III) важные шаги, которые влияют на выбор конкретных и высокое сродство клонов, и IV) пути повышения эффективности отбора мониторинга и раннего этапа антитела клона характеристики. При таком подходе, мы получили синтетические фрагменты антител (Fab-фрагменты) многих целевых классов, включая однопроходных мембранных рецепторов, секретируемого белка гормонов, и нескольких доменов внутриклеточных белков. Эти фрагменты могут быть легко преобразованы в полноразмерные антитела и были проверены на демонстрируют высокое сродство и специфичность. Кроме того, они были продемонстрированы, чтобы быть функциональным в различных стандартных иммунологических включая Вестерн-блоттинга, ELISA, клеточного иммунофлуоресценции, иммунопреципитации и связанных с ними анализов. Эта методика позволит ускорить открытие антител и, в конечном счете приблизить нас к реализации цели OF генерации возобновляемой, высококачественные антитела к протеоме.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

С наступлением постгеномная возраста, наличие высококачественных связывающих реагентов для характеристики и модулировать белки важно, чтобы открыть новое исследование и терапевтические направления. Антитела продолжать иметь решающее значение для академических и промышленных исследователей как основной исследовательских и диагностических средств и потенциальных терапии. Не удивительно, что уже впечатляющий рост фирм по разработке договора антител, большинство из которых полагаются на традиционных технологий гибридом для получения пользовательских антитела. Тем не менее, выбор в пробирке с использованием фаговых дисплеев, библиотек антител становится мощной альтернативой технологии, что может предложить уникальные преимущества и успеха там, где обычные технологии могут столкнуться ограничения 1, 2.

В свете значительного спроса на высококачественные антител в качестве научно-исследовательских инструментов, двух основных проблем для генерации возобновляемой антитела являются: 1) выбор пропускной способности и 2) антиген А. В.ailability. Количество групп уже описаны в пробирке отбора трубопроводов, направленных на повышение пропускной способности и скорости идентификации антител. Эти подробные описания различных жизнеспособных подходов, которые включают выбор на любой полной длины цели 3,4 или структурно связаны домены 5,6,7, используя либо шарик на основе 6,8 или пластины на основе 3,4 схемы антиген иммобилизации. Кроме того, растет применение технологий синтеза генов 9 составил систематический генерацию антиген, в частности, из изолированных областей, достаточно рентабельным и потенциально может облегчить трудности в получении достаточных количеств очищенного, полноразмерного антигена. С помощью этих двух технологий в тандеме, самодостаточным и масштабируемой поколение антиген и выбор антитело трубопровод был разработан, что позволит параллельно выделения антител для больших наборов выраженных антигенных доменов и способствовать развитию реагентов для чаracterizing целые классы структурно или функционально родственных белков.

С этой целью, с интегрированной трубопровода, которая соединяет в идентификации силикомарганца экспрессируемой доменов антиген, синтез гена с высокой пропускной бактериальной экспрессии антигенов и масштабируемых антител выборов фаговых дисплеев была разработана. Этот трубопровод требуется только базовую инфраструктуру доступной для большинства жизнь научных лабораторий (в том числе библиотек антител, которые более доступны через лицензии или соглашение о передаче материала), но также поддается автоматизации для использования в промышленных масштабах. Используя этот протокол, можно генерировать сотни сродства с метками антиген домены, и обычно изолируют высокой конкретных фрагментов антител на многие из этих антигенов.

Технологии фагового дисплея показан продемонстрировали совместимость с широким спектром форматов рекомбинантных сродством реагентов, включая Fab, ScFv и автономных областей Fv и Арастет массив малых "альтернативных схем» (по проекту анкириновых повторных белков (белков DARP), фибронектин (FN), Липокалин доменов и более 10). Обсуждение ограничивается в этом примере к выделению фрагментов Fab антитела, хотя предполагается, эти методы могут быть адаптированы к другим типам библиотек. Используя эту технологию, заводы с низкой наномолярном сродством к небольшой, меченый белок домены, включая фактор транскрипции доменов, SH2 доменов, РНК-связывающие белки и другие были успешно выбранных, многие из которых связывают полноразмерного белка и являются функциональными в иммунологических, таких как иммунофлюоресценции , иммунопреципитация и иммуногистохимия. Важно отметить, что рекомбинантные обязательные клоны полностью возобновляемых источников и может быть повторно генерируется из выражения строит с помощью бактериальная продукция размещения большего единообразия, воспроизводимости и экономической эффективности, тем самым оправдывая расходы строгой проверки клона.

В этом протocol и сопровождающие видео, основные методы отбора антител из фаговых дисплеев библиотек, использующих иммобилизованным антигеном домены продемонстрированы. Данный метод использует GST-меченый белок доменов в неподвижном пассивной адсорбции в Планшетный, хотя другие теги 11,12,13 и форматы выбора 13,14,2 также успешно используется. Критические соображения для установки и проведения выборов с параллельным мониторинга параметров отбора, направленного на выявление и выделение специально обогащенные клоновых антитела для проверки подробно.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Антиген поколения

Примечание: антиген домены могут быть синтезированы и клонировали с помощью различных коммерческих поставщиков в соответствующий IPTG-индуцируемого экспрессионной конструкции.

  1. Преобразование выражений конструкции в химически компетентных, T1-фага устойчивы, BL21 E. палочки клетки путем смешивания 10 нг ДНК, кодирующей в 20 мкл 1X КСМ на льду в 96-луночный ПЦР пластины с последующим добавлением 20 мкл химически компетентных клеток.
  2. Выдержите смесь клеток / ДНК на льду в течение 20 мин, при комнатной температуре в течение 10 мин, а затем снова на льду в течение 2 мин до спасения 100 мкл подогретого супер оптимального бульона с глюкозой (SOC) информации, охватывающий с воздухопроницаемой пластиной уплотнение и перемешиванием при 37 ° С в течение 1 ч при 200 оборотах в минуту в 2,5 см орбитальном шейкере.
  3. Пластина 5 мкл трансформированных клеток к Лурии-Бертани (LB) / чашках с агаром с добавлением карбенициллина (100 мкг / мл) и выращивают O / N, чтобы получить одиночные колонии, используемые длясоздания запасов глицерина.
  4. Посев 1 мл 2 х УТ / карбоната сред с 5 мкл глицерина наличии и расти в течение 12 ч при 37 ° С в блоке 96 также глубоких скважин при встряхивании при 200 оборотах в минуту в 2,5 см орбитальном шейкере.
  5. Посев NZY media15 (с добавлением 0,05% глюкозы, 2% лактозы и 100 г / мл карбенициллина) с разбавлением этой культуры 1:40, затем встряхивают в течение 6-8 ч при 30 ° С и 200 оборотах в минуту в 2,5 см орбитального шейкер.
  6. Гранул бактерий и очищают антигенных белков в высокой пропускной фильтра в 96-луночного планшета, содержащего 100 мкл Ni-NTA смолы в соответствии с ранее опубликованной protocols16,17.
  7. Определить концентрацию очищенных белков связывание красителя assay18 Брэдфорд и характеризуют по размеру и чистоты путем отделения и визуализации 10-50 мкг Кумасси пятно на ДСН-ПААГ (рис 2).
    ПРИМЕЧАНИЕ: На этом этапе белки могут быть дополнительно охарактеризованы с помощью методов, оценки агрегация белков 19 20 в зависимости от природы антигена и требованиям трубопровода отбора.

2. Подготовка и Титрование библиотеки фагов

  1. Выберите одну колонию T1 фагоустойчивые Е. палочки клеток в 1 мл 2 х УТ среде с 50 мкг / мл тетрациклина.
  2. После того, как рост клеток визуально установлено, разбавленной культуры в большем объеме 2 YT, дополненной 50 мкг / мл тетрациклина, чтобы обеспечить достаточный объем клеток для инфекции (обычно 45 мкл каждого разбавления библиотеки, см. Ниже).
  3. Подготовка библиотеку для использования путем осаждения фага из буфера хранения с 1 / пятого объема автоклавного 20% ПЭГ-8000, 2,5 М NaCl (ПЭГ-NaCl) инкубирование на льду в течение 30 мин и гранулирования осаждают фаг центрифугированием при 12000 х г.
  4. Жидкость над осадком сливают и ресуспендируют осаждают фаг в соответствующем объеме 1X PBS, рН 7,4, 0,2% BSA и 0,05% твина (PBT), регулируя то необходимости концентрации фага для выбора (при необходимости) для обеспечения адекватного охвата библиотеки. См Шаг 2,9 и обсуждения.
  5. Развести 5 мкл аликвоты фагового в 45 мкл 1X PBS, рН 7,4, в стерильной нескольких луночный планшет, смешивают и создать ряд 10 кратных разведений в том же буфере.
  6. Добавить 5 мкл каждого разбавления фага с 45 мкл фага Т1-стойкие E. палочка клеток в фазе роста LOG (OD 600 = 0,4-0,8) в другом многоямного пластины, крышка с прокладкой воздухопроницаемой и инкубировать при 37 ° С при встряхивании при 200 оборотах в минуту в течение 30 мин в 2,5 см орбитальном шейкере.
  7. Пластина 5 мкл инфицированных клеток от каждой из скважин на к подогретого агаром с добавлением 100 мкг / мл карбенициллина и растут O / N при 37 ° С, пока колонии не видны.
  8. Расчет общей фага / мл следующим образом:
    Фага / мл = число колоний на карбенициллину пластины в более разбавленного образца х 200 х 10 я (где я = максимальной питBER разведений, в котором колонии очевидны).
  9. Чтобы определить количество покрытых антигеном скважин, чтобы обеспечить охват библиотеки разнообразия, рассчитать следующим образом:
    Количество покрытых антигеном скважин обязательно =
    Желаемый охват раза * библиотека разнообразие
    # Фага в 100 мкл

3. Антитела Выбор из фаговых дисплеев библиотек

3.1) антигена Иммобилизация

  1. Чтобы избежать циклов замораживания-размораживания, которые могут повлиять на антиген качества и облегчения разведения, подготовить подвой белкового антигена пластину нормированная на 100x рабочих концентрациях (например, 500 г / мл) и аликвоту и необязательных 96-луночных планшетах.
  2. Подготовка пластинок, покрытых антигеном на складе белковых растворов за один день до каждого раунда выборов путем разбавления на складе пластин с PBS.
  3. Шерсть 96-луночных высоким содержанием белка-связывающий полистирола пластины с 100 мкл GST-меченого белка антигена или отрицательного контроля рrotein (GST, БСА, neutravidin и т.д.) при 5 мкг / мл в PBS. Встряхнуть в 250 оборотов в минуту 4 ° CO / N на микропланшет шейкере.
  4. Удалить белкового раствора с покрытой микропланшетов, блокировать антиген-покрытием и негативной селекции пластин с 200 мкл блокирующего буфера (0,2% BSA в 1X PBS, рН 7,4) и встряхивают при 250 оборотах в минуту при комнатной температуре в течение 1-2 ч.
  5. После блокирования мыть блокированного пластины белка покрытием четыре раза 200 мкл 1X PBS, рН 7,4 с 0,05% Tween (PT) буфере либо вручную, либо с использованием автоматизированного микропланшет шайбы.

3.2) библиотека предварительного оформления и антиген-фаг Инкубационный

  1. Разрушающим библиотеку не (или отве) специфического связывания фаге клона фрагмент антитела путем перечисления 100 мкл (10 12 фаговых) готовых фаговой библиотеки в PBT буфера ряда скважин, покрытых с отрицательным контрольным белком или свободного аффинной метки белок (например, GST) эквивалентно числу целей и инкубировать фагав скважинах в течение 1-2 ч при комнатной температуре при встряхивании на 250 оборотов в минуту.
    Примечание: В качестве альтернативы или дополнительно посредством негативной селекции, инкубирование может быть также проведена в присутствии избытка (5-25 мкМ) растворимого белка аффинной метки (например, GST) для дополнительного удаления тегов связывания клонов и повысить извлечение конкретной задачи связывание клонов.
  2. Передача фага супернатант из негативной селекции с пластинок, покрытых антигеном и инкубировали в течение 1-2 ч при комнатной температуре при встряхивании при 250 оборотах в минуту для захвата специфических связывающих клонов.
  3. Удаления несвязанного фага и мыть лунки микропланшета 8-15 раз буфером PT вручную или с помощью микропланшет шайбы. Удалите излишки промывочный буфер непосредственно перед элюирования.

3.3) элюирования, инфекции и фага Усиление

  1. Рано день выборов, выбрать одну колонию T1 фагоустойчивые Е. палочки клеток в 1 мл 2 х УТ среде с 50 мкг / мл тетрациклина, и выращивают при 37 ° С Wiго встряхивании при 200 оборотах в минуту в 2,5 см орбитальный шейкер или эквивалент.
  2. После того, как рост клеток установлено, и можно увидеть невооруженным глазом, увеличить объем среды с 2 х УТ, дополненной 50 мкг / мл тетрациклина, чтобы обеспечить достаточный объем клеток для инфекции (как правило, 100 мкл на выбор также).
  3. растут клетки до оптической плотности 0,4-0,8 600 будет достигнута (примерно 5-7 ч), то для элюирования связанного фага добавить 100 мкл клеток к антиген промывают пластины и встряхивают при 37 ° С в течение 30 мин.
  4. Добавить вспомогательный фаг М13К07 до конечной концентрации 1 х 10 10 КОЕ / мл и инкубируют при 37 ° С в течение 45 мин с перемешиванием при 200 оборотах в минуту.
  5. Передача клетки в 1,2 мл 2 х УТ, дополненной 150 мкг / мл карбенициллина и 75 мкг / мл канамицина в 96-луночного глубокого блока также с V-образным дном и расти O / N при 37 ° С при встряхивании при 200 оборотах в минуту в течение 2,5 см орбитальный шейкер.

3.4) фага Подготовка и неоднократные вспышки SELECния

  1. Гранул бактерий центрифугированием при 4000 х г в течение 15 мин при 4 ° С.
  2. Смешайте равные объемы фаговых супернатанатах повторных пластин в мини-трубки 96-луночного стерильной микропланшетов синей коробке, нейтрализуют 1/10 объема 10Х PBT и перемешать. Повторите раундов отбора (начиная с шага 3.1.1) в течение 3-4 раундов или пока не наблюдается обогащение (Смотрите разделы 4. и 7.) по сравнению с отрицательным контрольным белком.
    ПРИМЕЧАНИЕ: В начале раунда отбора, когда значительная / обнаружить обогащение не ожидается (то есть, туры 1 и 2), количественное определение входных и выходных фаговых титров (описанных в разделе 7 и представительств результатами, представленными на рисунке 3), может быть полезным в обеспечении минимальные концентрации фагов для успешных выборов (описанные в обсуждение) и являются более подходящими, чем объединенных ИФА.

4. Характеристика счет объединенных ELISA

  1. Пальто 96-а с высоким содержанием белка-связываниечисле полистироловых планшетах с 100 мкл GST-меченого антигена белок или белок, отрицательный контроль (GST, БСА, neutravidin и т.д.) при 2 мкг / мл в соответствии с разделом 3.1 и встряхивают при 4 ° CO / N.
  2. Удалить избыток антигена, блокировать пластину с 200 мкл блокирующего буфера при встряхивании в течение 1-2 ч при комнатной температуре при 250 оборотах в минуту на микропланшет-шейкере и мыть четыре раза 200 мкл буфера PT либо вручную, либо с помощью автоматизированного пластины шайбой.
  3. Применение 100 мкл супернатанта фага (разбавленного 1: 10-1: 20 в PBT) буфера, встряхнуть при 250 оборотах в минуту в течение 15 мин при комнатной температуре, и мыть пластины восемь раз с 200 мкл буфера PT.
  4. Добавить 100 мкл анти-М13-HRP (1: 5000 в PBT буфера). Встряхнуть при 200 оборотах в минуту в течение 30 мин при комнатной температуре, затем промыть пластины шесть раз 200 мкл буфера PT и дважды 200 мкл PBS.
  5. Применение 100 мкл 1: 1 субстрата ТМВ и развивать течение 5-15 мин (или до тех пор, пока существенное цвет разработал), то остановить реакцию добавлением 100 мкл 1 М H 3 4 и читать планшет при 450 нм.
  6. В общем, обогащение фага бассейнов можно наблюдать в раундах 3-4 в соотношении специфического связывания по сравнению с не-специфического связывания> 2 (см рисунок 4)
    ПРИМЕЧАНИЕ: Это интересно отметить, что высокие абсолютные связывания сигнал на белок аффинной метки указывает обогащение тегов конкретных связующих веществ (а не целевые связующие), и что высокие абсолютные связывание сигнал на отрицательной контрольного белка указывает обогащение неспецифического или " липкие "связующие.

5. Клон Выбор, Секвенирование и характеристика

5.1) Выделение односпальными Fab-фаговых клонов

  1. Для выделения отдельных клонов для секвенирования и характеристики, заразить 1/10 объема усиленного фага бассейн и T1 фагоустойчивые Е. палочка клетки в логарифмической фазе роста (OD 600 = 0,4-0,8) в круглым дном планшета для микротитрования, накрыть breathaBLE уплотнительной пластины и инкубировать при встряхивании при 200 оборотах в минуту в течение 30 мин при 37 ° С.
  2. Подготовка 10-кратных серийных разведений в 2 х УТ сред и пластины на отдельных чашках с агаром с добавлением 100 мкг / мл карбенициллина.
  3. Выбор отдельных колоний в 450 мкл 2 х УТ / карбоната среде с 1 х 10 9 М13К07 фаговой / мл и расти O / N в мини-трубки 96 и стерильную микропланшет-синий коробки инкубации при 37 ° C при встряхивании при 200 оборотах в минуту.
  4. Гранул бактерий центрифугированием при 4000 х г в течение 10 мин при 4 ° С.
  5. Клонального фага супернатант может быть использован для секвенирования Fab-фаговых клонов (как описано в разделе 5.4) или клональной прямым связывания ELISA, чтобы определить специфичность в отношении иммобилизованными антигенами (как описано в разделах 5.3 и 21), для которых представительные результаты показаны на фиг 5.

5.2) Выражение Fab клонов для характеризации

  1. После клонирования к соответствующему еXpression вектор (см обсуждения), выбрать одну Е. палочка колонии, трансформированные экспрессионных конструкций и 1 мл 2 х УТ / карбоната сред в 96 и глубиной-луночного планшета с использованием стерильной зубочисткой или пипетки и расти в течение 12-16 ч при 37 ° С при встряхивании при 200 оборотах в минуту. Это может быть сделано вручную или с автоматизированной колонии палитры.
  2. Передача 40 мкл растущей культуры до 1,5 мл NZY среде с добавлением глюкозы / лактозы / глицерина в 96 и шахтах блока в соответствии с методикой Studier и др. 15
    Примечание: В качестве альтернативы, клетки могут быть выращены в течение 3-4 ч (OD 0,8-1,0) в не-дополняться и Экспрессия белка индуцировали добавлением 1 мМ IPTG.
  3. Крышка блока (ов) культуры с воздухопроницаемой прокладкой и выразить Fab клонов на 6-8 часа при 30 ° C при встряхивании при 200 оборотах в минуту. Побочные пластины на 4000 мкг в течение 15 мин для осаждения бактериальных клеток, пока Удалить супернатант, накладок с печатью фольги и заморозить гранул при температуре от -20 ° С до лизиса.
  4. Освободить выраженные FABS из собранных гранул с 100 мкл буфера для лизиса (трис-HCl 50 мМ, 200 мМ NaCl, 1,25% Тритона Х-100, рН 8,0 с 1 мг / мл лизоцима и 10 U Benzonase / мл культуры и ингибиторы протеазы) и встряхивания в течение 2 ч при 4 ° С.
  5. Удалить клеточного дебриса центрифугированием при 4000 х г в течение 15 мин при 4 ° С и собирают сырой лизата супернатант для применения в начальной характеристики специфичности по ELISA пластины (см раздел 5.3).

5.3) Clone Характеристика по прямой обязательной Клональный Fab ELISA

  1. Зафиксировать антигены, как описано в разделе 3.1, а aliquotting 30 мкл 2 мкг / мл антигена в PBS в лунки 384-луночного планшета. Quad на базе антигена макеты в пластине может способствовать передаче реагентов при использовании 96 каналов на основе дозирующих головок. Вымойте и блок ELISA пластины в соответствии с разделом 3.1.
  2. Очищенные лизаты, полученные от Раздел 5.2 может применяться непосредственно к иммобилизованным антигеном Евыподведения итогов связывания. Инкубируют 30 мкл лизата на лунку в течение 15 мин при комнатной температуре при встряхивании при 200 оборотах в минуту.
    Примечание: Очищенный белок Fab-клонов, альтернативно, может быть использован путем разбавления 10 мкг / мл в буфере PBT и применение 30 мкл каждого клона с заблокированных скважин, содержащий антиген или отрицательный контрольный белок (GST, BSA и т.д.) и развивается в том же образом, как описано ниже. С другой стороны, Fab-фага и могут быть использованы при разбавлении 10 мкл супернатанта фага (описано в разделе 5.1) в 20 мкл буфера PBT (1: 3) и обнаруживать анти-М13-HRP антител (описано в шагах 4,4 - 4,5)
  3. Удалить избыток лизата и мыть скважин вручную или с использованием автоматического пластины промывают 8x с 100 мкл буфера PT и удалить избыточный буфер.
  4. Инкубируют 30 мкл разведении 1: 5000 вторичных анти-FLAG антителами в PBT буфере в течение 30 мин при комнатной температуре при встряхивании при 200 оборотах в минуту.
  5. Wash, развивать и количественно, как в разделах 4.3 - 4.5.
    ПРИМЕЧАНИЕ: Представитель результатыиллюстрирующие как специфические и неспецифические связывающие клоны показаны на рисунке 5.

5.4) Clone Секвенирование

  1. Подготовка основной смеси ПЦР, как указано в таблице 2.
  2. Добавить 2 мкл соответствующей матрицы для ПЦР (либо фаговой супернатанта или ресуспендировали одной фагемидный содержащих бактериальной колонии) в 20 мкл ПЦР-смеси, подготовленной мастер с соответствующими праймерами в лунки пластины ПЦР.
    Примечание: Отдельные мастер смеси необходимы для секвенирования обеих тяжелой и легкой цепей генов.
  3. Запуск реакции ПЦР с использованием параметров, перечисленных в таблице 2 - Параметры PCR.
  4. Проверка успех ПЦР путем смешивания 5 мкл завершенной реакции с красителем на 1% -ном агарозном геле с добавлением визуализации ДНК красителем и изображений на 300 нм просвечивания.
  5. Добавить 2 мкл ПЦР-продукта 10 мкл стерильной воды, содержащей 0,2; Мкл каждого из экзонуклеазной и щелочной фосфатазы креветки и инкубировать при 37 ° С в течение 20 мин с последующим инактивации фермента при температуре 80 ° С в течение 10 мин, чтобы удалить избыток праймеров в подготовке для секвенирования.

6. Масштабирование для автоматизированных выбранных параметров

6.1) Внесите на основе Гидравлическое оборудование

  1. Подготовка 1% (вес / объем) бромфенолового синего в воде и нерастворимых частиц с использованием 0,45 мл фильтр.
  2. Чтобы определить линейный диапазон оптической плотности на ридере, подготовить в разведении 1: 1000 в 1% для бромофенолового синий раствор в воде, и продолжить серию двукратных разведений (всего 16 разведения).
  3. Передача 100 мкл каждого разбавления с плоским дном 96-луночного планшета и читать оптическую плотность при 590 нм. Участок абсолютное поглощение в сравнении коэффициент разбавления и выбрать разбавление в средней до высокой конце линейного диапазона для последующих испытаний.
  4. Добавить бромфенола голубого к воде или к фактическому растворакоторые будут пипеткой на основе разбавления, выбранного в предыдущем шаге в достаточном объеме для пипетки до трех 96-луночных планшетах, а также мертвого объема в резервуаре.
  5. Калибровка пипетки одноканальный доставить испытательного объема воды с помощью пипетки на аналитических весах (100 мкл воды весит 100 мг при комнатной температуре.)
  6. Использование калиброванный пипетки, передавать объем тест окрашенного раствора, по крайней мере, три лунки с плоским дном 96-луночного планшета и читать их абсорбцию при 590 нм, в трех экземплярах.
  7. Взвесьте три пустых плоским дном 96-луночных на аналитических весах и записывать их массы.
  8. Объем пипетки теста из резервуара к каждой из трех 96-луночных планшетах и ​​измерить их абсорбцию при 590 нм, в трех экземплярах.
  9. Взвешивание каждой пластины и рассчитать разницу в массе.
  10. Во-первых, оценивают ли поглощение в каждой лунке однородны в пределах допуска (например., +/- 5%) и являются ли они в соответствии с гое поглощение, полученные при помощи ручной пипетки с калиброванным Pipetman. Если отдельные каналы последовательно избыточного или недостаточного предоставления (например, см рис 6), выполните процедуры ремонта и повторите процедуру оценки, пока все каналы не поставить единые тома.
  11. Во-вторых, когда все каналы подтвердил, обеспечивающие равномерность объемов, проверить точность этого объема путем расчета средней массы разницу, на лунку. Например, идеально откалиброван множество жидкости обработчик 100 мкл доставит 9,60 г воды на пластины, или 0,10 г воды на лунку. Если реальный объем поставляется последовательно над или под предполагаемый объем, то поправочный коэффициент может быть применен, т.е., программирование 110 мкл для того, чтобы действительно принесла 100 мкл.
    Примечание: Для небольших объемов, например, 10 мкл, использовать в десять раз больше бромфенолового синего в окрашенных раствором, и пре-аликвоту 90 мкл воды к 96-луночных планшетах вручную, чтобы гарантировать, что ABsorbances являются измеримыми и падение в линейном диапазоне.

6.2) автоматической мойки Plate

  1. Остановите положительный цель и отрицательные белки контроля в отдельных скважинах 96 и микроплит (две пластины для каждого условия для тестирования), как описано в разделе 3.1.
  2. Блок неспецифические сайты связывания путем инкубации с блокирующим раствором в течение одного часа при комнатной температуре.
  3. Добавить идентичные 100 мкл аликвоты в 10 13 КОЕ / мл целевой связывания Fab-фага раствор в PBT во все лунки в всех пластин и инкубировать при осторожном перемешивании при комнатной температуре в течение 2 часов.
  4. Промыть две пластины в соответствии с каждым условием, одной пластины для инфекции и титрования и одной пластины для ELISA.
  5. Оценка эффективности стирки путем прямого заражения в бактерии и титрования (как описано в разделе 3.3 (без М13К07 того) и 7.2.1) или развития с анти-М13 HRP антитела и колориметрического субстрата (как описано в разделе 4).
  6. Фаговые титры FROM-специфических клонов часто дают в диапазоне от 10 5 -10 7 фага / мл с иммобилизованным белком, против которого клон специфически связывается. Некоторые остаточные связывания с отрицательного контрольного белка (например, BSA) следует ожидать и в целом 10 2 -10 5 фага / мл наблюдается, однако, очень низкие титры (т.е.., <10 1) может сигнализировать слишком жесткими стирки, которые могут поставить под угрозу Выбор.
  7. Для фага связывание определяли иммуноферментным методом, сравнить абсолютные обязательные сигналы для положительных и отрицательных белки управлять, чтобы определить, робот стиральная эквивалентно установленных результатов мытья рук (Рисунок 7).

6.3) для промывки планшетов Обеззараживание

  1. Для начала, запустите протокол дезактивации быть проверены.
    ПРИМЕЧАНИЕ: Мы рекомендуем использовать как минимум удвоить общий объем строки и простое, замочить с шайбой в течение 5 мин в 0,5% раствора гипохлорита натрия, недавно разведенный FRом коммерческий отбеливатель (обычно 6% гипохлорит натрия).
  2. Премьер и замочить с шайбой в течение 5 мин в стерильной (автоклавного) водой и, наконец, премьер системе до тех пор линий полны воздуха.
  3. Премьер-линии с стерильной водой или промывочным буфером.
  4. Вымойте стерильный планшет 96 а однажды, удалить из стиральной машины и печать с стерильную чашку печатью. Это управление пластины предварительно загрязнения.
  5. Аликвоты по 100 мкл O / N усиливается фага культурального супернатанта во все лунки 96-луночного планшета.
  6. Вымойте фага, содержащего пластину раз, а затем удалить из стиральной машины и печать с пластиковой или фольги пластины уплотнения. Это контроль загрязнения пластины.
  7. Провести протокол дезактивации проходят испытания. В этом примере, повторите шаги 6.3.1 и 6.3.2.
  8. Вымойте стерильный планшет раз, а затем удалить из стиральной машины и печатью. Это испытание дезактивации пластины.
  9. Пластина 50 мкл в лог-фазе E. палочки для титрования пластин; это предварительно Infecции управления пластина.
  10. Распечатайте заранее загрязнения, засорения и дезактивации 96-луночных планшетах и добавить 100 мкл E. палочки в стадии роста лог-фазы во все лунки, используя новые наконечники для каждого хорошо.
  11. Уплотнение и инкубировать при 37 ° С в течение 30 мин при 200 оборотах в минуту.
  12. Пластина 50 мкл инфицированных клеток из трех случайных лунки каждого 96-луночного планшета на 10 см 2 х УТ / карбоната пластин и инкубировать при 37 ° CO / N.
  13. Передача 50 мкл инфицированных клеток из всех лунок каждого планшета с пластинами глубоких скважин, содержащих 1 мл 2 х УТ плюс 100 мкг / мл карбенициллина на лунку и расти O / N при 37 ° С.
  14. Повторите протокол дезактивации и оставить шайбу линии высохнуть.
    ПРИМЕЧАНИЕ: Нет O / N рост на пластинах или в жидкой среде должны соблюдаться на предпродажный контроль инфекции, предпродажный контроль загрязнения или испытаний дезактивации пластин. Многие колонии и рост должен наблюдаться на контрольной загрязнение пластины; Если бы не, никаких выводов об эффективностиПротокол обеззараживания могут быть сделаны. В идеале, для очистки от пластины не даст никаких колоний и не o / n рост в любом из скважин в O / N пластин. Строгость протокола дезактивации может быть увеличена с более высокими концентрациями отбеливателя, больше впитать раз и дополнительные циклы.

7. ввода / вывода титрование

7,1) Входное Фаговые титрование

  1. Развести 5 мкл аликвоты фагов до 50 мкл стерильной PBS-отфильтровывают и перемешивают.
  2. Подготовка серийное разведение в 10 раз стерильной PBS-фильтрации с 10 10 с помощью пипетки многоканальный или пипетки 96 канала.
  3. Привить 5 мкл разбавленного фага до 45 мкл T1 фагоустойчивые Е. палочки клетки в логарифмической фазе роста (OD 0,6-0,8) и инкубируют покрытого воздухопроницаемым уплотнением в течение 30 мин при 37 ° С.
  4. Пластинчатые 5 мкл инфицированных клеток на на LB / агаром с добавлением 100 мкг / мл карбенициллина и инкубировать O / N Aт 37 ° C.
  5. Концентрация фага может быть оценена из самых разбавленной образца, в котором колоний в соответствии с расчетами, описанных в разделе 2.8.

7.2) Выход фага Pitrations

  1. После элюирования пластины связаны фага путем добавления Е. палочка клетки, разбавленные в 5 мкл аликвоты инфицированных фагом клеток до 50 мкл с автоклаве 2 х УТ сред
  2. Подготовка серийного 10-кратного разведения в автоклаве 2 х УТ СМИ 10 6 с помощью пипетки многоканальный или 96 канала пипетки.
  3. Пластина 5 мкл инфицированных клеток на на чашки с агаром с добавлением 100 мкг / мл карбенициллина и инкубировать O / N при 37 ° С.
  4. Концентрация фага может быть оценена из самых разбавленной образца, в котором колоний в соответствии с расчетами, описанных в разделе 2.8.
    ПРИМЕЧАНИЕ: В обоих случаях (например, входных и выходных фаговых титров, сравнение с номерами колонии как на тетрациклин (всего челл номер) и канамицин (фаг-хелпер титр), также может быть информативным.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Протокол, описанный здесь, был использован для выделения фрагментов антител к различным обоих structurally- и функционально связанных с антиген домены из комбинаторных фаговых дисплеев Fab библиотек параллельно. Вопросы, связанные с наличием антигена можно обойти, во многих случаях, в идентификации силикомарганца экспрессируемой доменов антиген, которые подходят для выбора антител 23. Объединяя экспрессии антигена с антителом выбора пределах одной и той же лаборатории (рисунок 1) становится возможным построить интегрированный трубопровод, в котором параметры антиген критические к выбору могут быть более легко контролировать. В большинстве случаев, осторожно определение границ области позволяет экспрессию и выделение адекватных количествах достаточно чистого антигена из выражения высокой пропускной в 96 или 24 и в шахтах пластин (рис 2) для успешного использования в антител выборов. В последующийраундов процесса отбора, Элюированные концентрации фагов и обогащение фага, которые специфически связываются с антигеном может контролироваться либо фага титрования (рис 3) или фаговыми бассейны в анализе ELISA (рисунок 4). Связывание отношение (> 2), как правило, указывает на наличие специфических связывающих клонов. С другой стороны, низкий коэффициент (<2), может помочь определить причину сбоя выбора. Например, отношение <2 с высокой неспецифической OD может указывать на недостаточное удаление неспецифических клонов (или липкие связующих) и, возможно, потребуют дальнейшей оптимизации протокола отбора. Тем не менее, когда обогащение обнаружено, отдельные высокой аффинности клоны затем может быть выделено для секвенирования и характеристики. Клон связывание может быть охарактеризована в колориметрического иммунологического и позволяет сравнивать связывание Fab-фага или Fab с иммобилизованными антигена по сравнению с отрицательной контрольной белка, что дает меру обогащения (отношение связывания с таrget против отрицательного контрольного белка или аффинная метка белка) (рисунок 5).

Во время масштабирования и автоматизации этого метода, оценка основных функций устройства наливных может быть полезным для обеспечения надлежащего и точную работу с решениями аналогичных тем, которые используются во время фактических выборов. Использование поглощающих хромофоров в растворах может помочь определить, когда конкретные каналы в струйной (аспирация или отказа) либо забиты или потеряли печать в результате частичной поставки объема, как показано на рисунке 6. Автоматизированные установки для мойки также может быть источником изменчивости и может потребовать внимания. Использование известных обязательных клонов позволяет сравнение связывания между белком цель управления, чтобы гарантировать, что мишень-связывающий поддерживается в то время как фон связывание удален (рисунок 7), когда параметры стирки, таких, как выдача скорости, объемов стирки и количество стирок оптимизируются. ПослеИспользование автоматизированной пластины шайбы с фагов решений, эффективные протоколы очистки от загрязнений необходимо обеспечить отсутствие перекрестного загрязнения от последовательных раундов выборов или различных процедур отбора и устранение неисправностей / интерпретация представлена ​​в таблице 3.

Рисунок 1
Рисунок 1. Обзор -. Высокая пропускная способность производства антигена и отбор антител трубопровод Этот обзор показывает, шаг за шагом, визуализацию представитель поколения антиген и выбора антитела трубопровода. Идентификация в силикомарганца доменных границ антиген позволяет синтез генов, экспрессия и выбор на домены для белков, которые могут быть плохо охарактеризованы. Выраженные антигенные домены обездвижены и используется для изоляции пулов определенных клонов высокое сродство антител из сотрудничестваБиблиотека mbinatorial антитела отображается на поверхности нитевидного фага. Пулы антитела, элюированные-фага и амплифицировали из индивидуальных антигенов могут быть использованы для мониторинга круглый-к-тура обогащение специфических связывающих клонов в анализе ELISA на основе сопоставления иммобилизованного целевого белка по сравнению с отрицательной контрольной перед выделением отдельных связывающих клонов для характеризации. Пожалуйста, Нажмите здесь, чтобы посмотреть большую версию этой цифры.

Фиг.2
Рисунок 2. SDS-PAGE визуализация сродства с метками антигенов. Представитель ДСН-ПААГ экспрессировали и очищали 6X-His-GST-меченый антиген домены (5-10 кДа домен + 26 кДа GST), первоначально определены в силикомарганца анализа антигена доменные границы. Белковых доменов выражены и выделяют Affiочистка щества характеризуются SDS-PAGE до выборов, чтобы обеспечить размер на основе идентичности, адекватные выходы и чистоту, чтобы разрешить использование в фаг-антитело выборов. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Рисунок 3
Рисунок 3. Визуализация выходных фага титров. Выходные фага титры определяются покрытие из клеток, инфицированных фагом в течение 10-кратным серии разведений на агаре с добавлением различных антибиотиков (тетрациклин, карбенициллина и канамицина), чтобы определить самую низкую разбавление в котором колонии можно наблюдать и оценивать количество фага, связанного с антигеном-мишенью и элюировали. Пожалуйста, нажмите здесь, чтобы посмотреть большойR версии этой фигуры.

Рисунок 4
Рисунок 4. Связывание соотношение цели к отрицательному контрольного белка за счет объединенных ELISA. Прогресс обогащения могут быть оценены следующие раундов отбора путем скрининга отдельных усиленные элюенты как против конкретных задач и негативных белков управления и / или изолированной аффинной метки. Показанный в сюжете являются отношения по обогащению для связывания 96 отдельных фаговых антител бассейнов против своих 96 соответствующих антигенов по сравнению с отрицательным контрольным белком параллельно. Каждое значение соотношение получено из двух измерений оптической плотности, которые количественно связывание фага бассейн либо цели или отрицательного контрольного белка с использованием HRP-слитый антитела, специфичные для фага М13 белка оболочки. Соотношение порог 2 или более (часто в пределах от 2-10 или более, как показано на красный) используется в качестве показателя обогащенияи, вероятно, наличием специфических связывающих клонов. Меньшие показатели могут означать провал или конкретные вопросы с выбором, который может служить основанием для дальнейшей оптимизации протокола. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Рисунок 5
Рисунок 5. прямого связывания клональной Fab-фага или Fab-ELISA. Связывание отдельных клонов (будь то в Fab-фага или в формате FAB) может быть оценена с помощью ELISA-анализа на основе по сравнению с иммобилизованным белком в 384-луночных планшетах. Связывание обнаружен с помощью вторичного HRP-антитела, слитый с белком оболочки М13 на Fab-фага или теге аффинной на Fab. Сырье значения абсорбции для связывания клонального Fab-фага к антиген-мишень, отрицательный контрольный белок и антиген сродства тег (GST) изображены иллюстрирующая конкретную биnders (A01, A04, A06), и липкие связующих (A05).

Рисунок 6
Рисунок 6. Оценка отпущенных объемов с помощью автоматизированных агрегата жидкость. Последовательное и точная доставка, предназначенных объемах роботов или ручных систем пипеток 96-а можно оценить с помощью окрашенных растворов и планшет-ридер. В этом примере, 10 мкл раствора, содержащего бромофенола голубого пипеткой последовательно во все лунки два 96-луночных планшетах с использованием одного окна наконечника. Каждый также содержит 90 мкл / лунку дН 2 O, аналогично добавлением вспомогательный фаг к инфицированным Е. палочка. поглощение каждой пластины в при 590 нм считываются в трех экземплярах, а объемы интерполируются из стандартной кривой, полученной с использованием калиброванного одного Pipetman канала. Объемы поставленной к одной строке на первой и второй пластины показаны. Обратите внимание, что на елейт пластины, а E04 не получает окрашенные раствор, а на второй пластине, он получает двойной объем. Это указывает на то, что наконечник сенсорного недостаточно для последовательной доставки, и требует дальнейшей оптимизации. 95% доверительные интервалы для трех измерений оптической плотности показаны.

Рисунок 7
Рисунок 7. Оценка автоматизированной пластины стирки. Эффективное удаление несвязанного фага может быть оценена с помощью ELISA для измерения Fab-фага связывания с иммобилизованным положительный (анти-FLAG антитела) и отрицательные (BSA) управления белков при изменении условий стирки. В этом примере, ввод фага аналогично наивной библиотеки (10 13 КОЕ / мл в PBT) удаляется с помощью восьми или шестнадцати моет, вручную или с помощью робота. Остаточный фага связывания с БСА и то же во всех условиях, как это специфическое связывание с иммобилизованным анти-FLAG антителом, индийскаяОтопительный что на этом низком расходе, оба метода эквивалентны и достаточно жесткими. 95% доверительные интервалы от дубликатов скважин показано на рисунке.

РЕШЕНИЯ
2 х УТ СМИ - Добавьте воду до 1 л, довести рН до 7,0, и автоклав. дрожжевой экстракт 10 г
триптон 16 г
NaCl 5 г
NZY среде (1 л) NZ амина 10 г
дрожжевой экстракт 5 г
50X ZYM-5052 20 мл
20 соль складе 50 мл
50x ZYM-5052 сахар наличии (1 л) глюкоза 25 г
лактоза 100 г
глицерин 250 мл
20x соль состава (1 л) Na 2 HPO 4 500 мм
KH 2 PO 4 500 мм
NH 4 Cl 1 М
Na 2 SO 4 100 мМ
Карбенициллин (Carb): 100 мг / мл в воде. Фильтр-стерилизовать.
Канамицин (Кан): 25 мг / мл в воде. Фильтр-стерилизовать.
Тетрациклин (Tet): 10 мг / мл в воде. Фильтр стерилизуют.
PEG-NaCl PEG
NaCl 2,5 М
1x PBS (рН 7,2) NaCl 137 мм
KCl 3 мм
Na 2 HPO 4 8 мм
KH 2 PO 4 1,5 мм
1X КСМ KCl 500 мм
CaCl 2 150 мм
MgCl 2 250 мм
SOC СМИ дрожжевой экстракт 5 г / л
триптон 20 г / л
NaCl 10 мм
KCl 2,5 мм
MgSO 4 20 мм
Глюкоза 20 мм
Блокирование буфер PBS 1x
BSA 0,20%
PBT буфер PBS 1x
BSA 0,20%
Твин 0,05%
Буфер PT PBS 1x
Твин 0,05%
Фосфорная кислота H 3 P0 4 1 М

Таблица 1. Среды и растворы.

ПЦР МАСТЕР-MIX SET-UP </ STRONG>
Компонент мкл на реакцию
Вода 19.45
10x Taq буфер 2,5
дНТФ (10 мМ исходный) 0,675
ДМСО 0,75
Taq-фермента 0,125
Прямой праймер (100 мкМ акций) 0,25
Обратный праймер (100 мкМ акций) 0,25
Тяжелой цепи праймеры для секвенирования
M13 Прямой праймер GTAAAACGACGGCCAGTACTCGAGGCTGAGCAAAGC
M13 Обратный праймер CAGGAAACAGCTATGACGGGAAGTGTCCTTGACCA
Легкой цепи праймеры для секвенирования
M13 Прямой праймер TGTAAAACGACGGCCAGTCTGTCATAAAGTTGTCACGG
M13 Обратный праймер CAGGAAACAGCTATGACCCCTTGGTACCCTGTCCG
ПЦР НАСТРОЙКИ
Шаг 1. 94 ° С в течение 3:00 мин
Шаг 2. 94 ° С в течение 0:30 мин
Шаг 3. 55 ° С в течение 0:30 мин
Шаг 4. 72 ° С в течение 1:00 мин
Вернитесь к шагу 2 и повторите 24х переходите к пункту 2
Шаг 5. 72 ° С в течение 7:00 мин
Шаг 6.

Таблица 2. ПЦР Master Mix и настройки.

Интерпретация результатов дезактивации
Пластина Ожидаемая карбенициллин титр Если бы и нет?
Предполетный контроль инфекции 0 Клетки предварительно-инфицированных; ничто не может быть заключен с экспериментом.
Контроль загрязнения газон На вашем загрязнение, чтобы иметь возможность оценить эффективность последующей дезинфекции; рассмотреть погружаясь многообразие в фага решения, а не аспирационных его.
Тест Обеззараживание 0 Дезактивация не завершена; увеличить время выдержки, отбеливатель ConcentraТион Или попробуйте SDS и EtOH моет вместо этого.

Таблица 3. Оценка омывателя обеззараживания. Для определения эффективности обеззараживания, необходимо показать, что машина была загрязнена фага, и что протокол обеззараживания успешно исключено, что загрязнения. Использование фагов, которые придают карбенициллин сопротивления, ожидаемые результаты от такого теста в списке, наряду с предложениями должны реальном результат отличается от ожидаемого результата.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

При проведении в пробирке выборов антител, два основных факторами успеха выбора являются: 1) изоляция хорошо сложенными антигенных мишеней для выбора на и 2) наличие высокой библиотеки функциональной разнообразие антител. Во многих случаях, наличие достаточных количествах хорошо сложенный, полноразмерного белка может быть ограничивающим. Один из подходов, чтобы преодолеть это ограничение, чтобы использовать домены, определенные из анализа биоинформатики 22 и синтезированные для вставки в бактериальный экспрессирующий вектор с соответствующим аффинной метки.

Существуют различные метки, которые используются в биотехнологических приложений для увеличения растворимости, облегчения очистки и стабилизации неустойчивых домены. 11 способность синтезировать практически любой необходимой последовательности вставка обеспечивает очень гибкое платформу генерации антиген. Хотя формат GST-меченый является обычным явлением, успешные результаты были ранееполученные с использованием гексагистидиновую, FC, галоген, св зывающий мальтозу белок и сайт-специфические метки биотинилирования и считается, что бесчисленные другие метки сродства могут быть оптимизированы для использования в аналогичной платформе. Тем не менее, аффинные метки могут иметь как положительные, так и непредвиденных негативных последствий в последующих применений 11 и должны быть тщательно расследованы до установления конвейера в зависимости от конкретного формата.

Часто новые пользователи будут ставить вопрос о том, как оценить качество библиотеки антител и, хотя нет однозначного ответа, следует попытаться оценить несколько ключевых особенностей (будь то природные или синтетические), включая общее разнообразие, относительные уровни отображения, характер и степень рандомизации (т.е. библиотека конструкции по сравнению с содержанием библиотеки, определенной секвенированием) и физико-химических свойств антитела против предполагаемого применения. Хотя за рамками данного протокола, более подробную очистныхNT этих возможностей и как они могут повлиять на выбор антител можно найти здесь 2,23. Знание библиотеки разнообразия, в частности, важно обеспечить адекватный охват разнообразия во выбора. Как правило, концентрация фага, что обеспечивает 100-1000 копий каждого клона фага в библиотеке желательно и должны обеспечить, чтобы любые истинные положительные связующие, присутствующие в библиотеке могут быть восстановлены. Тем не менее, неспецифическое связывание фага с микропланшета поверхностей резко возрастает выше 10 13 фага / мл, а для самых разнообразных библиотек, более одной скважины в антигена могут быть необходимы, чтобы обеспечить достаточный охват. С другой стороны, если входной библиотеки слишком разбавленных, абсолютная концентрация истинно положительных связующих будет настолько ниже KD (нМ), как правило, что они не будут восстановлены. Учитывая эти ограничения, фаговых библиотек, как правило, должны быть ресуспендировали в 10 12-13 фага / мл для первого раунда выборов.0; При этой концентрации 100 л аликвоты фагов представляет собой покрытие 1,000-100 раза из 10 9 -10 10 разнесения библиотеки в и может обычно дают связывания клонов с различными антигенами. В меньших концентрациях, или увеличение различий, может быть необходимо увеличить количество лунки антигена, выбранных против в первом раунде (см раздел 2.9). После 1-го раунда, однако, большинство из необязательных разнообразия библиотеки был удален; Избыток охват выходного разнообразия круглый 1 чаще всего легко достижимо с помощью одной скважины. В тех случаях, параллельных выборов в 96-луночных планшетах, это может уменьшить количество антигена отбора пластин, необходимых для одного, после первого раунда.

В реальных выборов, фага титрование может предложить объективные критерии для описания и мониторинга прогресса, помогая определить проблемные области в частности, в ранних раундах отбора, где обогащение не является достаточным длябыть обнаружены. Это может быть особенно полезно при масштабировании из вариантов, чтобы определить производительность протокола. В общем, вход фагов титры (т.е. наивно библиотека или после усиления вымываемого фага) должны оставаться относительно стабильным (10 12 -10 13 фага / мл) между раундами, с плохой рост клеток / низких титрах фагов с указанием потенциального заражения и / или бедных выход из предыдущего раунда. Хотя выход фага титры как ожидается, увеличится в течение обогащения в поздних раундах отбора, диапазон 10 3 -10 5 КОЕ / мл в течение первых двух раундов не ожидается. Отклонение от этого диапазона может указывать на потенциальные проблемы с выбором таких как загрязнение или избыток промывочного жесткости. В более поздних циклов отбора (т.е. раундов 3 и 4), обогащение клонов, которые специфически связываются с антигеном-мишенью может быть оценена с помощью ИФА, что объединенные измерения связывания фага бассейна и против антигена-мишени и отрицательнойконтроль белка (раздел 4).

После 3-4 циклов отбора (или один раз на обогащение белком-мишенью достигнет антиген-мишень: соотношение сигнал белок отрицательный контроль 2: 1 или выше по сравнению с фоном белка), инфицированных бактериальные клетки высевают для выделения отдельных колоний фагмидных для секвенирования , начальных характеристик и клонирование, если это необходимо. В это время, крайне желательно, чтобы преобразовать Fab-фага, чтобы освободить Fab перед дополнительной характеристики. Хотя Fab-фага можно использовать для первоначальной характеризации разбавлением 10 мкл супернатанта фага (описано в разделе 5.1) в 20 мкл буфера и PBT обнаружения анти-М13-HRP антител (описано в шагах 4,4 - 4,5), по нашему опыту, связывающие свойства могут существенно меняться в любом месте от 5-20% клонов на освобождение от фаговой частицы и рано преобразование может устранить проблемы с ложных срабатываний. Конкретная методология используется для преобразования будет зависеть от uniquе архитектура фагмиды и, таким образом, не будут рассматриваться здесь явно. Тем не менее, в наиболее часто используемых векторов, то это может вообще быть достигнуто путем: 1) превращения очищенной фагемид (или фагемидный бассейн) в к компетентными неправительственными подавитель Е. Штамм, таких как HB2151 или 55244, если янтарь остановка (TAG) кодон вмешивается в Fab и PIII белок, 2) введение янтарной стоп-кодона между белками Fab и PIII, чтобы позволить экспрессию растворимых фрагментов антител в штамме не супрессора или 3) путем клонирования гена иммуноглобулина (от отдельных фагемид или фагемидный бассейн) и подход щий экспрессирующий вектор. Для еще большей оптимизации Выбор и характеристика, объединенные методы клонирования могут предложить эффективные средства для преобразования обязательные клоны массово и экспрессии конструкций, как устранение потенциал для ложно-положительный связывание Fab-фаговых частиц и где выражение лизаты используются для раннего характеристики, даже затраты и усилия очисткиможет быть изначально избегать.

Для клонов, выделенных непосредственно из библиотеки F (описанного в 24), вариабельные домены антител может быть упорядочены с помощью 1-2 мкл фага супернатанта в качестве шаблона для ПЦР-амплификации определяющие комплементарность области (CDR) (см 2 материалов для библиотеки F-направленных праймеров ). С помощью этих праймеров, области тяжелой и легкой цепи переменной будет давать продукты ~ 700 и ~ 500 п.н., соответственно, охватывающий все три CDR. Грунтовки включают в себя сайты отжига для M13 праймеров таким образом, что продукты могут быть упорядочены после очистки (как описано в разделе 5.4.5) с использованием стандартных праймеров доступных в большинстве последовательность основных средств. С другой стороны, для Fab-фаговых бассейнов, которые были клонированы в экспрессирующий вектор, и трансформированные непосредственно в Е. палочки для экспрессии, единичные колонии могут быть выделены и ресуспендировали в 15 мкл 2 х УТ и 1-2 мкл клеточной суспензии непосредственно использовать в качестве шаблона для одного сolony ПЦР с использованием соответствующих праймеров.

Автоматизация выбора потребует оптимизации и проверки нескольких ключевых роботов функций. В общем, пипетки на основе обработки жидкость должна быть точным и последовательным во всех 96 каналов, плиты стиральная должен удаления несвязанного фага эффективно, не лишая адсорбированный антиген или связанный Fab-фага из выбора пластины. Эффективное обеззараживание пластины шайбой Необходимо также между раундами, чтобы позволить обогащению и эффективным против выбора, и между последующими выбор, чтобы предотвратить перекрестное загрязнение. Чтобы помочь оптимизировать процедуру выбора высокой пропускной простые подходы к оценке этих функций были использованы ранее, и описаны ниже и подробно в протоколе.

Для оценки согласованности объемов предоставляемых всем каналам жидкой головки дозирования / аспирации, окрашенный раствор пипеткой к плоским дном 96-луночного планшета и absorbanCE в каждой лунке измеряли на планшет-ридере. Хромофору бромофенола голубого полезно для крашения решения, аналогичные тем, которые используются для реальных вариантов, чтобы оценить влияние различных поверхностного натяжения и сплоченности свойств по объемам поставляемой. После подтверждения того, что все каналы выдачи в соответствии объемы, точность от общего объема поставляется может быть определена путем измерения массы жидкости передается каждой пластины.

Автоматизации пластины промывки для удаления несвязанного клонов, прежде всего, необходимо оптимизировать скорость, с которой Промывочный буфер можно обойтись и количество промывок, чтобы быть использованы. Разумный метод оценки этого параметра используется положительного контроля (конкретную Fab-фага связывания клонов), чтобы оценить влияние изменения скорости и / или количество стирок дозирования для определения 1) адсорбируется ли антиген или связанного фага удаляется чрезмерно строгим мытья или 2) неспецифического связывания с не-родственных белков является чрезмерным дUE мыть условия, которые не являются достаточно строгими. Остаточный / связан фага могут быть обнаружены и определены количественно либо инфекции в бактерии и покрытие для отдельных импульсов колонии, или с помощью ИФА с использованием вторичных антител, специфичных для аффинности антител тегов или фага белков. Отрицательные контроли используются для оценки остаточных количеств необязательного Fab-фага белки-мишени или специфического связывания Fab-фага, не родственных / фон белков, которые могут быть высокими, если мыть не достаточно жесткими. В этом случае мы использовали иммобилизованным БСА в качестве контроля для неспецифического связывания и анти-FLAG антителами, которые распознают тег FLAG эпитопом на Fab-фага в качестве положительного контроля. Мы сравнили восемь и шестнадцать циклов стирки с использованием робота в сравнении с мытья рук, при скорости потока среды, чтобы показать, что эти методы были эквивалентны. С другой стороны, измерения входных и выходных фаговых титров (раздел 7) в ходе текущих выборов также может помочь выполнить точную настройку в параметры стирки. Наконец, обеззараживание пластины шайбами ​​для выбора должны быть эффективными, чтобы устранить унос фага из предыдущих выборов. По нашему опыту, недавно разведенный 0,5% гипохлорит натрия быстрый, эффективный и дешевый. Моющие средства, такие как SDS также эффективны, но требуют гораздо более тщательного промывания для удаления из системы. Проверьте совместимость реагентов для системы предварительного к любым испытаниям. Для оценки обеззараживание, мы проверяем на наличие остаточного фага в растворах, обработанных гидросистемы и интерпретировать результаты в соответствии с таблицей 3.

В целом, этот протокол обеспечивает масштабируемую метод выделения FABs из комбинаторных библиотек параллельными в отборе пробирке против белковых доменов и предлагает методы для проверки автоматизированной системы выбора фага. Стоимость и инфраструктуры барьеры, которые широкие возможности животных могут представлять смягчаются, так как этот метод не восстанавливаетлы на иммунизации животных. Кроме того, за счет интеграции антиген поколения с выбором антитело-фага, качество факторы, влияющие на успех выбора более легко контролировать и регулировать. Когда срок от экспрессии антигенов для выбора и начальной характеристикой порядка 6-8 недель, более гибкая система производства может быть реализована. Антитела, выделенные из выборов в пробирке, также как легко изменены (из-за генотип-фенотип связи) и возобновляемых источников, требующих только сохраненную ДНК в конструкции экспрессии, чтобы повторно и воспроизводимо повторно генерировать антитела. Наконец, показывая, что этот протокол может быть проведена с использованием либо квази-ручной или полностью автоматизированный подход, который использует специально разработанные роботизированной системы отбора, пропускная способность может быть масштабируемым и доступным для малых академических и промышленных лабораторий, так.

Используя методы с высокой пропускной способностью, описанные выше, и библиотека F библиотеки синтетических антител 24 в пробирке - и в точке -expressed белков. Хотя процент успеха для любого данного выбора будет зависеть как от качества (чистоты, foldedness, моно-дисперсность и т.д.) из целевых антигенов, а также от качества и разнообразия библиотеки антител, было обнаружено, что где-то от 25-80 % антигенов даст связующие для высокой отбора пропускной способности. Важно отметить, что стоит отметить, что клоны с возможностью модулировать целевой функции может также часто быть выбран. Эта библиотека построена с использованием полностью человеческий каркас, что делает эти антитела поддаются потенциального терапевтического применения 25, что подчеркивает важность этого трубопровода в качестве альтернативного подхода для генерации аффинных реагентов с широкой основезначение.

Таким образом, надежность и универсальность подхода, представленного в данном протоколе будет продолжать помогать в оптимизации, индустриализации и конечной широкого использования этой технологии в качестве эффективного средства достижения долгосрочной цели генерации аффинных реагентов практически всех членов человек протеом.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgments

Мы хотели бы признать NIH Общий фонд - белка Захват Реагенты программы для финансирования развития рекомбинантного антитела выбор сети антитела и характеристика трубопровода и Канадского фонда инноваций для финансирования покупки роботизированной платформы выбора.

Materials

Name Company Catalog Number Comments
MATERIALS
New Brunswick Innova44 stackable incubator shaker Eppendorf M1282-0004
Liquidator 96 channel manual benchtop pipetting system Anachem Ltd LIQ-96-200
Microplate shaker VWR 12620-926
ThermoScientific Sorvall ST-40 benchtop centrifuge Thermo Product 75004525
ELx405 Select Deep Well Microplate Washer Biotek ELX405USD
Custom High Throughput Automated Phage Selection Robot S&P Robotics
Plastic conical Falcon tube: 50 ml VWR 21008-178
Plastic conical Falcon tube: 15 ml VWR 89039-668
Axygen 1.7 ml microcentrifuge tubes Corning MCT-175-L-C
96-well/384-well Maxisorp plate Sigma M9410-1CS
Corning 96-well V-bottom deep-well block Corning 3960
Axygen Mini-tube 96-well sterile microplate blue box Corning AXY-MTS-06-C-R-S
Breathable adhesive plate sealing film VWR 60941-084
REAGENTS
Name Company Catalog Number
polyethylene glycol Bioshop PEG800.1
yeast extract Bioshop YEX401.1
bio-tryptone Bioshop TRP402.1
N-Z amine Sigma C7290
glucose Sigma G8270-1KG
lactose Bioshop LAC234
glycerol Bioshop GLY001.500
carbenicillin  Bioshop CAR544.10
kanamycin Bioshop KAN201.25
tetracycline  Bioshop TET701.25
Tween 20 Bioshop TWN510.500
monobasic potassium phophate Bioshop PPM302.1
dibasic sodium phosphate Anachemia 84486-440
sodium chloride Bioshop SOD001.10
potassium chloride Bioshop POC308.1
calcium chloride Bioshop CCL302.500
magnesium sulphate EMD MX0070-1
magnesium chloride Bioshop MAG510.500
NH4Cl Amresco 0621-1KG
Na2SO4 Bioshop SOS513.500
agar Bioshop AGR001.500
SybrSafe DNA gel stain Invitrogen S33102
phosphoric acid Acros Organics 201140010
lysozyme Bioshop LYS702.25
benzonase Novagen 71205
Triton X-100 Bioshop TRX506.500
protease inhibitor cocktail tablets Roche 11 836 170 001
Ni-NTA resin  Qiagen 1018240
1,000x helper phage (M13K07) stock (1013 phage per ml) NEB N0315S
HRP conjugated M13-specific antibody (anti-M13-HRP). GE Healthcare 27-9241-01
TMB substrate: mix equal volumes of TMB and H2O2 peroxidase substrate  KPL 50-76-00
dNTPs Biobasic DD0056
Taq polymerase Genscript E00007
Exonuclease GE Healthcare  EZ0073X-EZ
Shrimp alkaline phosphatase GE Healthcare E70092Z-EZ

DOWNLOAD MATERIALS LIST

References

  1. Winter, G., Milstein, C. Man-made antibodies. Nature. 349, 293-299 (1991).
  2. Miersch, S., Sidhu, S. S. Synthetic antibodies: concepts, potential and practical considerations. Methods. 57, 486-498 (2012).
  3. Schofield, D. J., et al. Application of phage display to high throughput antibody generation and characterization. Genome Biol. 8, R254 (2007).
  4. Hust, M., et al. A human scFv antibody generation pipeline for proteome research. J. Biotechnol. 152, 159-170 (2011).
  5. Colwill, K., Graslund, S. A roadmap to generate renewable protein binders to the human proteome. Nat. Methods. 8, 551-558 (2011).
  6. Mersmann, M., et al. Towards proteome scale antibody selections using phage display. Nat. Biotechnol. 27, 118-128 (2010).
  7. Pershad, K., et al. Generating a panel of highly specific antibodies to 20 human SH2 domains by phage display. Protein Eng. Des. Sel. 23, 279-288 (2010).
  8. Turunen, L., Takkinen, K., Soderlund, H., Pulli, T. Automated panning and screening procedure on microplates for antibody generation from phage display libraries. J Biomol. Screen. 14, 282-293 (2009).
  9. Hughes, R. A., Miklos, A. E., Ellington, A. D. Gene synthesis: methods and applications. Methods Enzymol. 498, 277-309 (2011).
  10. Boersma, Y. L., Pluckthun, A. DARPins and other repeat protein scaffolds: advances in engineering and applications. 22, 849-857 (2011).
  11. Terpe, K. Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol. Biotechnol. 60, 523-533 (2003).
  12. Lichty, J. J., Malecki, J. L., Agnew, H. D., Michelson-Horowitz, D. J., Tan, S. Comparison of affinity tags for protein purification. Protein Expr. Purif. 41, 98-105 (2005).
  13. Fellouse, F. A., et al. High-throughput generation of synthetic antibodies from highly functional minimalist phage-displayed libraries. J. Mol. Biol. 373, 924-940 (2007).
  14. Paduch, M., et al. Generating conformation-specific synthetic antibodies to trap proteins in selected functional states. Methods. 60, 3-14 (2013).
  15. Studier, F. W. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41, 207-234 (2005).
  16. Huang, H., Sidhu, S. S. Studying binding specificities of peptide recognition modules by high-throughput phage display selections. Methods Mol. Biol. 781, 87-97 (2011).
  17. McLaughlin, M. E., Sidhu, S. S. Engineering and analysis of peptide-recognition domain specificities by phage display and deep Sequencing. Methods Enzymol. 523, 327-349 (2013).
  18. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254 (1976).
  19. den Engelsman, J., et al. Strategies for the assessment of protein aggregates in pharmaceutical biotech product development. Pharm. Res. 28, 920-933 (2011).
  20. Lavinder, J. J., Hari, S. B., Sullivan, B. J., Magliery, T. J. High-throughput thermal scanning: a general, rapid dye-binding thermal shift screen for protein engineering. J. Am. Chem. Soc. 131, 3794-3795 (2009).
  21. Fellouse, F. A., Sidhu, S. S. Making antibodies in bacteria. in Making and Using Antibodies: A Practical Handbook. Howard, G. C., MR, K. aser CRC Press. Boca Raton, Florida. 151-172 (2013).
  22. Acton, T. B., et al. Preparation of protein samples for NMR structure, function, and small-molecule screening studies. Methods in Enzymology. 483, 23-47 (2011).
  23. Mahon, C. M., et al. Comprehensive interrogation of a minimalist synthetic CDR-H3 library and its ability to generate antibodies with therapeutic potential. J. Mol. Biol. 425, 1712-1730 (2013).
  24. Persson, H., et al. CDR-H3 diversity is not required for antigen recognition by synthetic antibodies. J. Mol. Biol. 425, 803-811 (2013).
  25. Bradbury, A. R., Sidhu, S., Dubel, S., McCafferty, J. Beyond natural antibodies: the power of in vitro display technologies. Nat. Biotechnol. 29, 245-254 (2011).
Масштабируемость Высокая пропускная Выбор фага-дисплее синтетических библиотек антител
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miersch, S., Li, Z., Hanna, R., McLaughlin, M. E., Hornsby, M., Matsuguchi, T., Paduch, M., Sääf, A., Wells, J., Koide, S., Kossiakoff, A., Sidhu, S. S. Scalable High Throughput Selection From Phage-displayed Synthetic Antibody Libraries. J. Vis. Exp. (95), e51492, doi:10.3791/51492 (2015).More

Miersch, S., Li, Z., Hanna, R., McLaughlin, M. E., Hornsby, M., Matsuguchi, T., Paduch, M., Sääf, A., Wells, J., Koide, S., Kossiakoff, A., Sidhu, S. S. Scalable High Throughput Selection From Phage-displayed Synthetic Antibody Libraries. J. Vis. Exp. (95), e51492, doi:10.3791/51492 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter