HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
मेजबान और एचआईवी -1 रोगजनन और रोग प्रगति तर्कसंगत वैक्सीन डिजाइन के लिए सर्वोपरि है कि प्रभावित वायरल विशेषताओं दोनों निर्धारण. सेलुलर प्रतिरक्षा प्रतिक्रिया एचआईवी -1 संक्रमण के लिए मानव प्रतिरक्षा प्रतिक्रिया के एक प्रमुख घटक है. साइटोटोक्सिक टी लिम्फोसाइटों (सीटीएल) तीव्र viremia की प्रारंभिक नियंत्रण के लिए जरूरी हैं, और मेजबान एक स्थिर राज्य (सेट बिंदु) वायरल लोड 1,2 स्थापित करने के लिए अनुमति देते हैं. इन प्रेरक कोशिकाओं की प्रायोगिक कमी वायरल नियंत्रण 3,4 के नुकसान में परिणाम है. इस के बावजूद, म्यूटेशन virally संक्रमित कोशिकाओं 5-9 की सीटीएल मान्यता पलट कि वायरल जीनोम के भीतर उठता बच.
कुछ एचएलए alleles कम वायरल लोड और बी * 57, बी * 27 और बी * 81 10-15 सहित धीमी रोग प्रगति के साथ संबद्ध किया गया है. एचएलए वर्ग मैं alleles के सुरक्षात्मक लाभ का एक हिस्सा वे इस तरह के झूठ के रूप में जीनोम के कार्यात्मक विवश क्षेत्रों को लक्षित है कि इस तथ्य को जिम्मेदार ठहराया जा सकता हैऔर इन विट्रो 16-21 में दोहराने के लिए वायरस की क्षमता कम होती है कि भागने म्यूटेशन के लिए चयन करें. सेलुलर प्रतिरक्षा प्रणाली से बच मैं एलील चयन एचएलए वर्ग के संदर्भ में वायरस के लिए फायदेमंद है, इन उत्परिवर्तनों का प्रभाव एक एचएलए बेमेल 22,23 व्यक्ति को ट्रांसमिशन पर मेजबान के लिए अंतर परिणाम हो सकते हैं. इसलिए, वायरल प्रतिकृति क्षमता पर प्रेषित एचएलए जुड़े भागने परिवर्तन के प्रभाव को समझने जल्दी एचआईवी -1 रोगजनन के बारे में हमारी समझ को आगे करने के लिए महत्वपूर्ण होगा.
बहुत प्रगति मैं 24-29 alleles विशिष्ट एचएलए वर्ग के साथ जुड़े व्यक्ति भागने म्यूटेशन की फिटनेस दोषों की पहचान और चिह्नित करने के लिए बनाया गया है, स्वाभाविक रूप से एचआईवी -1 वियोजन एचएलए जुड़े बहुरूपताओं की अनोखी और जटिल पैरों के निशान होने की संभावना एचएलए से उत्पन्न होने वाली है घटनेवाला अलग immunogenetic पृष्ठभूमि 30 की मध्यस्थता प्रतिरक्षा दबाव. एपी मेंछला विश्लेषण, GOEPFERT एट अल. 88 तीव्रता से संक्रमित Zambians से व्युत्पन्न प्रेषित चुप दृश्यों में एचएलए जुड़े म्यूटेशन का एक संग्रह सेट बिंदु वायरल लोड 31 में कमी के साथ जुड़े थे कि पता चला है. इस एचएलए बेमेल प्राप्तकर्ताओं को विशेष रूप से चुप में हानिकारक बच म्यूटेशनों के संचरण, एक नैदानिक लाभ प्रदान करता है, और वायरल प्रतिकृति तनु के कारण हो सकता है कि सुझाव दिया. आगे चल रहा है, यह एक ऐसी प्रतिकृति क्षमता, और जल्दी प्रतिकृति बदले में एचआईवी -1 नैदानिक मानकों और देर चरण को प्रभावित कर सकता है कि कैसे के रूप में संचारित वायरस की विशेषताओं को परिभाषित करने के लिए मिलकर काम कैसे जटिल चुप बहुरूपताओं के संयोजन प्राकृतिक रूप से उत्पन्न वियोजन के भीतर अध्ययन करने के लिए जरूरी है रोगजनन.
Brockman एट अल. प्रथम उप प्रकार सी और बी संक्रमण दोनों में जीर्ण अवस्था संक्रमण और वायरल लोड दौरान पृथक झूठ समर्थक दृश्यों की प्रतिकृति क्षमता के बीच एक कड़ी का प्रदर्शन32-35. इन अध्ययनों में प्रस्तुत प्रयोगात्मक दृष्टिकोण, लंबे समय से संक्रमित व्यक्तियों से व्युत्पन्न दृश्यों की इन विट्रो प्रतिकृति क्षमता की जांच के लिए हालांकि उपयुक्त, तीव्रता से संक्रमित व्यक्तियों मुश्किल उप प्रकार सी में एचआईवी -1 replicative क्षमता का अध्ययन करना है कि कई तकनीकी निरंतर और सीमाएं हैं. इस विधि लव से भाग में निकाली थी जो उप प्रकार बी NL4-3 provirus, में जनसंख्या आधारित पीसीआर प्रवर्धित दृश्यों के पुनर्संयोजन पर निर्भर करता है, एक प्रयोगशाला वायरस शेयर 36 रूपांतरित किया. वायरस पीढ़ी पीसीआर amplicons साथ एक यूके आधारित टी सेल लाइन 37 के सह अभिकर्मक द्वारा पूरा किया और delta- झूठ समर्थक NL4-3 डीएनए पचा गया था. इस विधि संभावित विवो में वायरल quasispecies के संबंध में बरामद वायरस शेयर की प्रकृति skewing, और इसलिए इन विट्रो में प्रतिकृति क्षमता का मापन फेरबदल, महीने के लिए सप्ताह की अवधि में वायरस के परिणाम की आवश्यकता है. इस विधि मैंलंबे समय से संक्रमित व्यक्तियों की एक बड़ी संख्या से कई अलग वायरल वेरिएंट क्लोनिंग इसे प्रभावी ढंग से उच्चतम replicative क्षमता के साथ वायरस के लिए चुनता है, जहां लंबे समय से संक्रमित व्यक्तियों का अध्ययन, और जहां के लिए अधिक उपयुक्त है संभव इसलिए काफी श्रम गहन और नहीं है. हालांकि, एक तीव्रता से संक्रमित व्यक्ति के भीतर, आम तौर पर 1-2 वेरिएंट मौजूद हैं, और इस प्रकार, इन विट्रो चयन के दबाव के माध्यम से बरामद वायरस शेयर की प्रकृति skewing के जोखिम को नष्ट करने के लिए इन विट्रो प्रतिकृति क्षमता का एक और अधिक सटीक आकलन के लिए अनुमति देता है. दूसरे, इस पद्धति का एक उपप्रकार बी व्युत्पन्न रीढ़ में उप प्रकार सी झूठ समर्थक दृश्यों पुनर्संयोजन आवश्यकता है, और विश्लेषण में रीढ़ असंगति पूर्वाग्रहों मिलवा सकता है. कारण इन सीमाओं के कारण, दृश्यों की बड़ी संख्या की शुरुआत की किसी भी संभावित पूर्वाग्रहों को दूर करने के क्रम में विश्लेषण किया जाना चाहिए.
यहाँ हम एक वैकल्पिक प्रयोगात्मक appro वर्णनउप प्रकार सी तीव्रता से संक्रमित व्यक्तियों से व्युत्पन्न दृश्यों के अध्ययन के लिए उपयुक्त ACH. हम उप प्रकार सी proviral रीढ़, MJ4 में एचआईवी -1 उप प्रकार सी संक्रमित व्यक्तियों की तीव्र संक्रमण समय बिंदुओं से व्युत्पन्न झूठ जीन शुरू करने का प्रतिबंध एंजाइम आधारित क्लोनिंग रणनीति का उपयोग करें. झूठ जीन क्लोन करने के लिए, जिसमें एक आम रीढ़ के रूप में MJ4 का उपयोग उप प्रकार सी व्युत्पन्न दृश्यों के विश्लेषण के लिए महत्वपूर्ण है. MJ4 कारण रीढ़ की हड्डी और झूठ जीन के बीच उप प्रकार असंगति को पूर्वाग्रह को पेश करने की संभावना कम होगी और इस प्रकार एक प्राथमिक अलग 38 से व्युत्पन्न, और है. Proviral 293T कोशिकाओं में सीधे ट्रांसफ़ेक्ट हो constructs, और क्लोन झूठ अनुक्रम के समान एक प्रतिरूप वायरस शेयर की वसूली के लिए के लिए इसके अलावा, एंजाइम आधारित प्रतिबंध क्लोनिंग का उपयोग करने के दृष्टिकोण की अनुमति देता है.
नीचे प्रस्तुत विधि व्युत्पन्न चुप-MJ4 उप प्रकार सी की प्रतिकृति क्षमता का आकलन करने के लिए एक उच्च throughput विधि हैकाइमेरिक वायरस. 293T कोशिकाओं में अभिकर्मक सीधा है और वायरस की वसूली केवल तीन दिन लगते हैं. इन विट्रो प्रतिकृति क्षमता. Brockman एट अल द्वारा बनाई गई एक ही CEM-CCR5 आधारित टी सेल लाइन पर 37 assayed, लेकिन सफल प्रतिकृति के लिए आवश्यक महत्वपूर्ण प्रोटोकॉल संशोधनों उपयोग कर रहा है उप प्रकार सी MJ4 काइमेरिक वायरस की. बल्कि PBMCs से एक उपयुक्त टी सेल लाइन का उपयोग उच्च परख reproducibility के साथ परीक्षण किया जा उप प्रकार सी MJ4-काइमेरिक वायरस की बड़ी संख्या के लिए अनुमति देता है. अंत में, सतह पर तैरनेवाला में वायरस की मात्रा का ठहराव के लिए एक radiolabeled रिवर्स ट्रांसक्रिपटेस परख का उपयोग व्यावसायिक रूप से उपलब्ध पी 24 एलिसा किट का उपयोग कर से अधिक लागत प्रभावी है. यह भी एक ही परख के भीतर दोनों खराब और अत्यधिक नकल वायरस का पता लगाने के लिए और वियोजन के बीच प्रतिकृति में सूक्ष्म अंतर का पता लगाने के लिए महत्वपूर्ण था, जो एक उच्च गतिशील रेंज, देता है.
अंत में, यहाँ प्रस्तुत विधि के लिए अनुमति दी गई हैएचआईवी -1 उप प्रकार सी से व्युत्पन्न झूठ दृश्यों की प्रतिकृति क्षमता का गहराई से अध्ययन तीव्रता से जाम्बिया से व्यक्तियों संक्रमित, और लिखित रूप में भी सी आबादी संक्रमित अन्य उप प्रकार का अध्ययन करने के लिए विस्तारित किया जा सकता है. अलग चुप आइसोलेट्स के बीच प्रतिकृति क्षमता में भिन्नता के एक उच्च डिग्री मनाया गया. इसके अलावा, हम एक तीन साल की अवधि में 39 से अधिक सीडी 4 + गिरावट प्रेषित चुप की प्रतिकृति क्षमता और सेट बिंदु वायरल लोड के बीच और साथ ही साथ एक सांख्यिकीय संघ को दिखाने के लिए सक्षम थे. इस तरह के परिणाम, ऐसी प्रतिकृति क्षमता के रूप में कैसे संचारित वायरल विशेषताओं का अध्ययन करने के महत्व पर प्रकाश डाला जल्दी संक्रमण के दौरान रोगजनन प्रभावित करने के लिए मेजबान प्रतिरक्षा प्रणाली के साथ बातचीत और प्रभावी टीके के उपायों के साथ ही उपचार के विकास के लिए अभिन्न हो जाएगा.
कारण लंबाई और इस प्रोटोकॉल के तकनीकी प्रकृति के काइमेरिक चुप-MJ4 plasmids के सफल निर्माण दोनों के लिए महत्वपूर्ण है और साथ ही वायरल प्रतिकृति क्षमता की मात्रा का ठहराव के लिए कर रहे हैं कि कई कदम उठाए हैं. इस प्…
The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |