HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Bestimmung sowohl der Host und viralen Eigenschaften, die Einfluss auf HIV-1-Pathogenese und Progression der Erkrankung ist von größter Bedeutung für eine rationelle Impfstoff-Design. Die zelluläre Immunantwort ist eine Schlüsselkomponente der menschlichen Immunantwort auf HIV-1-Infektion. Zytotoxische T-Lymphozyten (CTL) sind für die erste Kontrolle der akuten Virämie notwendig und erlauben dem Host, einen stabilen Zustand (Sollwert) die Viruslast 1,2 etablieren. Experimentelle Erschöpfung dieser Effektor-Zellen führt zu einem Verlust der viralen Steuer 3,4. Trotzdem entkommen Mutationen entstehen innerhalb des viralen Genoms, die CTL-Erkennung von virusinfizierten Zellen 5-9 zu untergraben.
Bestimmte HLA-Allele wurden mit niedriger Viruslast und langsamer Fortschreiten der Krankheit, einschließlich B * 57, B * 27 und B * 81 10-15 in Verbindung gebracht. Teil der Schutzwirkung von HLA Klasse I-Allele können, daß sie funktional eingeschränkten Regionen des Genoms, wie Gag Ziel zurückzuführenund wählen Flucht Mutationen, die die Fähigkeit des Virus zur Replikation in vitro 16-21 abnehmen. Obwohl Flucht aus dem zellulären Immunsystems ist vorteilhaft gegenüber dem Virus in Zusammenhang mit dem Auswahl HLA-Klasse-I-Allel kann die Wirkung dieser Mutationen Differenzfolgen für den Host bei der Übertragung zu einem HLA-übereinstimmende Einzel 22,23 aufweisen. Daher, das Verständnis der Auswirkungen von übertragenen HLA-assoziierten Mutationen Flucht auf die virale Replikation Kapazität wird wichtig sein, um unser Verständnis der frühen HIV-1-Pathogenese zu fördern.
Während viele Fortschritte gemacht worden, Identifizierung und Charakterisierung der Fitness der einzelnen Defekte mit bestimmten HLA-Klasse-I-Allele 24-29 verbunden Mutationen, natürlich vorkommende HIV-1-Isolate einzigartige und komplexe Spuren der HLA-assoziierten Polymorphismen, wahrscheinlich aus der HLA vermittelte Immun Druck von verschiedenen immungeneHinter 30. In aprevious Analyse, Goepfert et al. zeigten, dass eine Ansammlung von HLA-assoziierte Mutationen in den übertragenen Gag-Sequenzen von 88 akut infizierten Zambians abgeleitet wurde, mit einer Verringerung der Sollviruslast 31 verbunden. Dies legte nahe, dass die Übertragung von schädlichen Mutationen, insbesondere in Gag, an HLA-übereinstimmende Empfänger einen klinischen Nutzen und können durch virale Replikation gedämpft werden. Moving forward, ist es zwingend notwendig, zu untersuchen, wie komplexe Kombinationen von Gag-Polymorphismen in natürlich vorkommenden Isolate im Konzert arbeiten, um Eigenschaften des Virus übertragen wie Replikation Kapazität und wie früh Replikation kann wiederum HIV-1-klinischen Parametern und Spätstadium beeinflussen definieren Pathogenese.
Brockman et al. Eine Verbindung zwischen den Replikationskapazität von gag-pro-Sequenzen während der chronischen Phase der Infektion und Viruslast in beiden Subtyp C und B-Infektionen isoliert erstmals gezeigt32-35. Der experimentelle Ansatz in diesen Studien vorgestellt, obwohl geeignete für die Prüfung der in vitro Replikation Kapazität von Sequenzen aus chronisch infizierten Personen stammen, hat mehrere technische Vorbehalte und Einschränkungen, die das Studium machen HIV-1-Replikationskapazität in Subtyp C akut infizierten Personen schwierig. Dieses Verfahren beruht auf der Rekombination von Bevölkerungs basierten PCR-amplifizierten Sequenzen in den Subtyp B NL4-3 Provirus, die teilweise von LAV, abgeleitet wurde, angepasst, ein Laborvirusvorrat 36. Viruserzeugung wurde durch Co-Transfektion einer CEM-basierte T-Zelllinie mit 37 PCR-Produkte durchgeführt und aufgeschlossen Delta-gag-pro NL4-3 DNA. Dieses Verfahren erfordert das Auswachsen von Virus über einen Zeitraum von Wochen bis Monate, möglicherweise Neigen der Art des gewonnenen Virus Lager in Bezug auf die virale Quasi-Spezies in vivo und somit zur Änderung der Messung der Replikationsfähigkeit in vitro. Diese Methode, die ichist mehr für die Untersuchung chronisch infizierten Individuen, wenn sie tatsächlich selektiert Virus mit der höchsten Replikationsfähigkeit, und wo die Klonierung zahlreichen verschiedenen Virusvarianten aus einer großen Anzahl von chronisch infizierten Personen angemessen ist sehr arbeitsintensiv und daher nicht durchführbar ist. Jedoch in einer akut infizierten Individuum gibt es im allgemeinen ein zwei Varianten vor, und wodurch das Risiko einer Schrägstellung der Art des gewonnenen Virus-Stock, durch in vitro Selektionsdruck erlaubt eine bessere Beurteilung der in vitro-Replikationskapazität. Zweitens erfordert dieses Verfahren Rekombination Subtyp C-Gag-pro-Sequenzen in einem Subtyp B abgeleitet Rückgrat und könnte Rückgrat Inkompatibilität Vorurteile in die Analyse einzuführen. Aufgrund dieser Einschränkungen ist eine große Anzahl von Sequenzen, um mögliche Verzerrungen eingeführt überwinden analysiert werden.
Hier beschreiben wir eine alternative Versuchs approach für das Studium Sequenzen aus Subtyp C akut infizierten Individuen abgeleitet angemessen. Wir verwenden eine Restriktionsenzym-basierte Klonen Strategie, um die gag-Gen von einer akuten Infektion Zeitpunkte der HIV-1 Subtyp C infizierten Personen in den Subtyp C proviraler Rückgrat, MJ4 abgeleitet einzuführen. Die Verwendung von MJ4 als gemeinsames Grundgerüst, in dem gag-Gene zu klonieren ist für die Analyse von Subtyp C abgeleitete Sequenzen. MJ4 ist aus einem primären Isolat 38 abgeleitet, und somit wäre weniger wahrscheinlich, Verzerrung durch Subtyp Inkompatibilität zwischen dem Backbone und gag-Gen einzuführen. Darüber hinaus ist die Ansatz der Verwendung von Enzym-basierte Klonen Einschränkung erlaubt die proviralen Konstrukte direkt in 293T-Zellen transfiziert werden, und für die Wiederherstellung eines klonalen Virus-Stamm identisch mit dem geklonten gag-Sequenz.
Die nachstehenden Verfahren ein Hochdurchsatzverfahren zur Bewertung der Replikationsfähigkeit des Subtyps C abgeleitet Gag-MJ4chimären Viren. Transfektion in 293T-Zellen ist einfach und Virusgewinnung erfolgt nur drei Tage. In vitro Replikationskapazität auf demselben CEM-CCR5 basierend T-Zell-Linie, die durch Brockman et al untersucht. 37, aber unter Verwendung von für die erfolgreiche Replikation notwendig wichtiges Protokoll Modifikationen des Subtyps C MJ4 chimären Viren. Die Verwendung einer geeigneten T-Zell-Linie anstatt PBMCs ermöglicht eine große Anzahl von Subtyp C MJ4-chimären Viren mit hoher Reproduzierbarkeit Assay getestet werden. Schließlich, unter Verwendung einer radioaktiv markierten Reverse-Transkriptase-Assay zur Quantifizierung von Virus im Überstand ist kostengünstiger als die Verwendung von kommerziell erhältlichen p24-ELISA-Kits. Es gibt auch einen höheren Dynamikumfang, die wichtig zur Erkennung beide schlecht und sehr replizierende Viren innerhalb der gleichen Assay zum Nachweis und feine Unterschiede in der Replikation zwischen Isolaten war.
Im Ergebnis hat das hier vorgestellte Verfahren zur gestattetDie eingehende Untersuchung der Replikationskapazität von gag-Sequenzen von HIV-1 Subtyp C abgeleitet akut infizierten Personen aus Sambia und wie geschrieben, könnte auch erweitert werden, um andere Subtyp C infiziert Populationen zu untersuchen. Ein hohes Maß an Variation in der Replikation zwischen verschiedenen Kapazitäten Gag Isolate beobachtet. Darüber hinaus waren wir in der Lage, eine statistische Assoziation zwischen der Kapazität der Replikation übertragen Gag und Sollwert der Viruslast als auch mit CD4 + Rückgang über einen Zeitraum von drei Jahren 39 zeigen. Solche Ergebnisse unterstreichen die Bedeutung der Untersuchung, wie tragene Viruseigenschaften, wie Replikationskapazität, die Interaktion mit dem Immunsystem des Wirts zu Pathogenese während der frühen Infektion beeinflussen und Integral für die Entwicklung wirksamer Impfstoff Interventionen als auch die Behandlung sein.
Aufgrund der Länge und die Art der diesem Protokoll gibt es mehrere Schritte, die für die sowohl die erfolgreiche Konstruktion von chimären Gag-MJ4 Plasmide als auch für die Quantifizierung der viralen Replikationskapazität sind. Obwohl das Restriktionsenzym basierte Klonen Strategie für die Einführung von Fremdgenen in MJ4 Gag in diesem Protokoll beschriebenen hat zahlreiche Vorteile gegenüber bisher verwendeten Rekombination basierte Methoden, kann das Protokoll technisch eine Herausforderung sein, we…
The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |