HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Bestemme både vært og virale karakteristika, der påvirker HIV-1 patogenese og sygdomsudviklingen er altafgørende for en rationel vaccine design. Det cellulære immunrespons er et centralt element i indsatsen mod hiv-1-infektion menneskelige immunsystem. Cytotoksiske T-lymfocytter (CTL) er nødvendige i den indledende kontrol af akut viræmi og tillade værten at etablere en stabil tilstand (setpunkt) virusbelastning 1,2. Eksperimentel udtømning af disse effektorcellerne resulterer i tab af viral kontrol 3,4. På trods af dette, flygte mutationer opstår i det virale genom, der undergrave CTL anerkendelse af virusinficerede celler 5-9.
Visse HLA-alleler er blevet forbundet med lavere virale belastninger og langsommere sygdomsprogression, herunder B * 57 B * 27 og B * 81 10-15. En del af den beskyttende fordel af HLA klasse I alleler kan tilskrives det faktum, at de er målrettet mod funktionelt begrænsede områder af genomet, såsom Gagog vælge efter escape mutationer, der reducerer evnen af virusset til at replikere in vitro 16-21. Selv flygte fra det cellulære immunsystem er gavnlig for virus i forbindelse med valg HLA klasse I allel, kan virkningen af disse mutationer har differentierede konsekvenser for værten ved overførsel til en HLA-mismatchede individuel 22,23. Derfor vil forstå effekten af transmitterede HLA-associerede escape mutationer på viral replikation kapacitet være vigtigt at fremme vores forståelse af tidlig hiv-1 patogenese.
Selvom der er gjort store fremskridt for at identificere og karakterisere fitness defekter af enkelte kvitterede mutationer forbundet med specifikke HLA klasse I-alleler 24-29, naturligt forekommende HIV-1-isolater har unikke og komplekse fodspor af HLA-associeret polymorfier, sandsynligvis som følge af HLA medieret immun tryk forskellige immunogenetisk baggrunde 30. APorrige analyse Goepfert et al. viste, at en akkumulering af HLA-associerede mutationer i de transmitterede Gag sekvenser afledt fra 88 akut inficerede Zambianerne blev associeret med en reduktion i setpunkt viral belastning 31. Dette antydede, at overførslen af skadelige kvitterede mutationer, specielt i Gag, at HLA-uoverensstemmende modtagere giver en klinisk fordel, og kan skyldes svækket viral replikation. Bevæger sig fremad, er det bydende nødvendigt at undersøge, hvordan komplekse kombinationer af Gag polymorfier indenfor naturligt forekommende isolater arbejder i fællesskab for at definere karakteristika for den transmitterede virus såsom replikation kapacitet, og hvor tidligt replikation kan til gengæld påvirke HIV-1 kliniske parametre og sen-fase patogenese.
Brockman et al. Først påvist en sammenhæng mellem replikation kapacitet gag-Pro sekvenser isoleret under kronisk fase infektion og viral belastning i både subtype C og B-infektioner32-35. Den eksperimentelle tilgang, der præsenteres i disse undersøgelser, selv om det er relevant for behandlingen af in vitro-replikation kapacitet sekvenser afledt af kronisk inficerede individer, har flere tekniske forbehold og begrænsninger, der gør studerer HIV-1 replikationskapacitet i undertype C akut inficerede individer vanskelig. Denne metode bygger på rekombination af befolkningen baserede PCR-amplificerede sekvenser i undertype B NL4-3 proviruset, der blev afledt dels fra LAV, et laboratorium tilpasset virus lager 36. Virus generation blev opnået ved co-transfektion af en CEM-baserede T-celle linie 37 med PCR amplikoner og fordøjet deltace- gag-pro NL4-3 DNA. Denne metode kræver, at udvækst af virus over en periode på uger til måneder, hvilket potentielt skråstilling arten af det udvundne virus lager i forhold til den virale quasispecies in vivo og derfor ændring af måling af replikation kapacitet in vitro. Denne metode Ier mere egnet til at studere kronisk inficerede individer, hvor det effektivt vælges for virus med den højeste replikative kapacitet, og hvor kloning mange forskellige virusvarianter fra et stort antal af kronisk inficerede individer er ganske arbejdskrævende og derfor ikke er mulig. Men inden for en akut inficeret individ, der generelt 1-2 varianter til stede, og dermed eliminere risikoen for skråstilling arten af det udvundne virus lager gennem in vitro selektionstryk, giver mulighed for en mere nøjagtig vurdering af in vitro-replikation kapacitet. For det andet kræver denne metode rekombinerer subtype C gag-Pro sekvenser i en undertype B afledt rygrad, og kunne indføre backbone uforenelighed bias i analysen. På grund af disse begrænsninger, må et stort antal sekvenser analyseres med henblik på at overvinde eventuelle fordomme indført.
Her beskriver vi en alternativ eksperimenterende hensigtsver egnet til at studere sekvenser afledt fra subtype C akut inficerede individer. Vi bruger et restriktionsenzym baseret kloning strategi om at introducere gag-gen afledt af akut infektion tidspunkter af HIV-1 subtype C inficerede individer i subtype C provirale rygrad, MJ4. Anvendelsen af MJ4 som en fælles rygrad til at klone gag generne er afgørende for analysen af subtype C afledte sekvenser. MJ4 er afledt fra et primært isolat 38, og således ville være mindre tilbøjelige til at indføre bias som følge af undertype inkompatibilitet mellem rygraden og gag-genet. Hertil kommer, at tilgang til brug baseret begrænsning kloning enzym tillader den provirale konstruktioner, der skal transficeres direkte ind i 293T-celler og til genopretning af en klonal virusstamme identisk med den klonede gag-sekvensen.
Den præsenteres nedenfor metoden er en high throughput metode til at vurdere replikation kapacitet af subtype C afledt Gag-MJ4kimæriske vira. Transfektion i 293T-celler er ligetil og inddrivelse af virus tager kun tre dage. In vitro-replikation kapacitet analyseres på samme CEM-CCR5 baseret T-celle linie skabt af Brockman et al. 37, men ved hjælp af vigtige protokol ændringer er nødvendige for en vellykket replikation subtype, K MJ4 kimære virus. Brugen af et passende T-celle linie snarere end PBMC'er giver mulighed for et stort antal subtype C MJ4-kimære virus, der skal testes med høj analyse reproducerbarhed. Endelig, ved hjælp af et radioaktivt mærket revers transkriptase-assay til kvantificering af virus i supernatanten er mere omkostningseffektiv end ved anvendelse af kommercielt tilgængelige p24 ELISA kits. Det giver også en højere dynamikområde, som var vigtigt for at detektere både dårligt og stærkt replikerende virus inden for samme analyse og til påvisning af subtile forskelle i replikation mellem isolater.
Konklusionen er, at den metode, der præsenteres her tilladt forden grundige undersøgelse af replikation kapacitet gag-sekvenser afledt fra HIV-1 subtype C akut inficerede individer fra Zambia, og som skrevet, kan også udvides til at studere andre undertype C inficerede befolkninger. Blev observeret en høj grad af variation i replikation kapacitet mellem forskellige Gag isolater. Desuden var vi i stand til at vise en statistisk sammenhæng mellem replikation kapacitet transmitterede Gag og indstille punkt viral belastning samt med CD4 + tilbagegang over en tre-årig periode 39. Sådanne resultater understreger vigtigheden af at studere, hvordan transmitterede virale egenskaber, såsom replikation kapacitet, interagere med værtens immunsystem til at påvirke patogenese under tidlig infektion og vil være integreret for at udvikle effektiv vaccine indgreb samt behandling.
På grund af længde og tekniske karakter af denne protokol, der er flere trin, der er afgørende for både en vellykket opførelse af kimære Gag-MJ4 plasmider samt til kvantificering af viral replikation kapacitet. Selvom restriktionsenzym baseret kloning strategi for indførelsen af udenlandske gag generne i MJ4 skitseret i denne protokol har mange fordele i forhold til tidligere anvendte rekombination baserede metoder, kan protokollen være teknisk udfordrende, hvis kritiske trin ikke følges nøjagtigt. </…
The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |