Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

تقييد أنزيم الاستنساخ القائم على أسلوب لتقييم doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تحديد كل من المضيف وخصائص الفيروسية التي تؤثر HIV-1 المرضية وتطور المرض هو الهدف الأسمى لتصميم لقاح عقلانية. الاستجابة المناعية الخلوية عنصرا أساسيا من الاستجابة المناعية للعدوى البشرية HIV-1. السامة للخلايا T الليمفاوية (CTL) ضرورية لمراقبة الأولية من افيروس الحاد، وتسمح المضيف لتأسيس حالة مستقرة (مجموعة نقطة) الحمل الفيروسي 1،2. نضوب التجريبية من هذه الخلايا المستجيب النتائج في فقدان السيطرة الفيروسية 3،4. على الرغم من هذا، والهروب تنشأ الطفرات داخل الجينوم الفيروسي أن تخريب الاعتراف CTL من الخلايا المصابة فيروسي 5-9.

وقد ارتبطت أليل HLA معينة مع انخفاض الأحمال الفيروسية وتباطؤ تطور المرض بما في ذلك B * 57، B * 27 و 81 * B 10-15. ويمكن أن يعزى جزء من فائدة وقائية من الدرجة HLA I الأليلات إلى حقيقة أنها مقيدة وظيفيا استهداف مناطق من الجينوم مثل الكمامةوحدد للطفرات الهروب التي تقلل من قدرة الفيروس على تكرار في المختبر 16-21. على الرغم من الهروب من نظام المناعة الخلوية هو مفيد للفيروس في سياق الطبقة اختيار أليل HLA I، وتأثير هذه الطفرات قد تكون له عواقب التفاضلية للمضيف على انتقال لHLA-متطابقة الفردية 22،23. ولذلك، فهم آثار الطفرات الهروب المرتبط HLA تنتقل القدرة على تكاثر الفيروس سيكون من المهم تعزيز فهمنا لأوائل HIV-1 المرضية.

بينما تم إحراز تقدم كبير في تحديد وتوصيف العيوب اللياقة البدنية من الطفرات الهروب الفردية المرتبطة الدرجة HLA محددة I الأليلات 24-29، تحدث بشكل طبيعي HIV-1 العزلات وآثار أقدام فريدة ومعقدة من الأشكال HLA المصاحب، من المحتمل الناشئة عن HLA ضغط المناعة بوساطة من مختلف الخلفيات مستمنع 30. في أبتحليل revious، Goepfert وآخرون. أظهرت أن تراكم HLA المصاحب الطفرات في تسلسل الكمامة تنتقل المستمدة من 88 الزامبيين المصابة تماما كان مرتبطا مع انخفاض في مجموعة الحمل الفيروسي نقطة 31. اقترح هذا أن نقل من الطفرات الضارة الهروب، وتحديدا في الكمامة، إلى المستلمين HLA-متطابقة يوفر فائدة سريرية، وربما يعود لتكاثر الفيروس الموهن. المضي قدما، لا بد من دراسة كيفية مجموعات من الأشكال الكمامة داخل مجمع العزلات التي تحدث بشكل طبيعي تعمل في تناسق لتحديد خصائص الفيروس ينتقل مثل القدرة تكرارها، وكيفية تكرارها في وقت مبكر قد يؤثر بدوره HIV-1 المعلمات السريرية والمراحل المتأخرة المرضية.

بروكمان وآخرون أظهرت لأول مرة وجود علاقة بين القدرة تكرار متواليات هفوة الموالية معزولة خلال مرحلة الإصابة المزمنة والحمل الفيروسي C في كل من فرعي والتهابات B32-35. المنهج التجريبي المقدم في هذه الدراسات، على الرغم المناسب لاختبار قدرة تكرارها في المختبر من متواليات المستمدة من الأشخاص المصابين بشكل مزمن، لديها العديد من المحاذير والقيود الفنية التي تجعل من دراسة HIV-1 قدرة تنسخي في النوع الفرعي C المصابين تماما صعوبة. ويعتمد هذا الأسلوب على إعادة التركيب من القائمة على السكان تسلسل PCR تضخيم في النوع الفرعي B NL4-3 طليعة الفيروس، والتي كانت مستمدة جزئيا من LAV، تكييف مختبر الفيروسات الأسهم 36. تم انجازه الجيل الفيروس عن طريق التعاون ترنسفكأيشن خط T-خلية مقرها CEM-37 مع amplicons PCR وهضمها delta--هفوة الموالية NL4-3 DNA. يتطلب هذا الأسلوب ثمرة من الفيروسات على مدى فترة من أسابيع إلى أشهر، وربما انحراف طبيعة الأسهم فيروس تعافى فيما يتعلق quasispecies الفيروسية في الجسم الحي، وبالتالي تغيير قياس قدرة تكرارها في المختبر. طريقة هذا طهو أكثر مناسبة لدراسة الأفراد المصابين المزمنين، حيث يختار بشكل فعال للفيروس وفقا لأعلى قدرة تنسخي، وحيث استنساخ العديد من المتغيرات الفيروسية مختلفة من عدد كبير من الأشخاص المصابين بشكل مزمن هو العمل المكثف تماما، وبالتالي لا جدوى. ومع ذلك، داخل الفرد المصاب تماما، وهناك عموما 1-2 متغيرات الحاضر، وبالتالي القضاء على خطر انحراف طبيعة الفيروس الأسهم المستردة، في المختبر من خلال الضغوط الاختيار، ويسمح لإجراء تقييم أكثر دقة للفي المختبر قدرة النسخ المتماثل. ثانيا، هذا الأسلوب يتطلب إعادة توحيد فرعي C-هفوة الموالية تسلسل إلى النمط الفرعي B العمود الفقري المشتقة، ويمكن إدخال العمود الفقري التحيزات عدم التوافق في التحليل. بسبب هذه القيود، يجب تحليل أعداد كبيرة من متواليات من أجل التغلب على أي التحيزات المحتملة قدم.

نحن هنا وصف لAPPRO التجريبي بديلمنظمة العمل ضد الجوع المناسب لدراسة تسلسل المستمدة من النوع الفرعي C الأفراد المصابين تماما. نحن نستخدم استراتيجية استنساخ انزيم التقييد استنادا إلى إدخال الجين هفوة المستمدة من النقاط الزمنية العدوى الحادة للHIV-1 النوع الفرعي C المصابين في العمود الفقري proviral النوع الفرعي C، MJ4. استخدام MJ4 بمثابة العمود الفقري شيوعا التي لاستنساخ الجينات أسكت أمر بالغ الأهمية لتحليل النوع الفرعي C تسلسل مشتقة. مشتق MJ4 من عزل الأساسي 38، وبالتالي سيكون أقل احتمالا لتقديم التحيز بسبب عدم التوافق بين فرعي العمود الفقري والجينات هفوة. وبالإضافة إلى ذلك، فإن النهج القائمة على استخدام انزيم تقييد الاستنساخ يسمح للproviral يبني أن transfected مباشرة إلى خلايا 293T، وانتعاش الأسهم فيروس النسيلي مطابقة للتسلسل هفوة المستنسخة.

طريقة الواردة أدناه هي طريقة إنتاجية عالية لتقييم قدرة تكرار النوع الفرعي C المستمدة الكمامة-MJ4الفيروسات خيالية. ترنسفكأيشن في الخلايا 293T واضح ومباشر والتعافي من الفيروس يأخذ ثلاثة أيام فقط. ويعاير في المختبر قدرة النسخ المتماثل على نفس أساس خط T-خلية CEM-CCR5 التي أنشأتها بروكمان وآخرون 37، ولكن باستخدام بروتوكول التعديلات الهامة اللازمة لتكرار النجاح من النوع الفرعي C MJ4 الفيروسات خيالية. استخدام خط T-خلية المناسب بدلا من PBMCs يسمح لأعداد كبيرة من النوع الفرعي C-MJ4 خيالية الفيروسات لفحصها مع فحص عالية التكاثر. أخيرا، وذلك باستخدام رديولبلد الناسخ العكسي لفحص الكمي للفيروس في طاف هو أكثر فعالية من استخدام P24 المتاحة تجاريا مجموعات ELISA التكلفة. كما انه يعطي مجموعة أعلى ديناميكية، وهذا أمر مهم للكشف عن الفيروسات على حد سواء سيئة للغاية وتكرار في نفس الفحص وللكشف عن الفروق الدقيقة في النسخ المتماثل بين العزلات.

في الختام، فإن الطريقة المعروضة هنا قد سمح لدراسة متعمقة لقدرات تكرار متواليات هفوة المستمدة من HIV-1 النوع الفرعي C إصابة حادة الأفراد من زامبيا، وكما هو مكتوب، ويمكن أيضا أن توسعت لدراسة النوع الفرعي الآخر C إصابة السكان. ولوحظ وجود درجة عالية من التباين في القدرات النسخ المتماثل بين العزلات الكمامة مختلفة. بالإضافة إلى ذلك، كنا قادرين على إظهار ارتباط إحصائية بين قدرة تكرار الكمامة تنتقل ووضع نقطة الحمل الفيروسي وكذلك مع CD4 + انخفاض على مدى فترة ثلاث سنوات 39. هذه النتائج تبرز أهمية دراسة الخصائص الفيروسية كيف تنتقل، مثل القدرة التكرار، تتفاعل مع الجهاز المناعي المضيفة للتأثير المرضية خلال العدوى في وقت مبكر، وسوف تكون متكاملة لتطوير لقاح التدخلات الفعالة وكذلك العلاج.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. التضخيم من هفوة جين HIV-1 من المصاب، البلازما المجمدة

  1. استخراج RNA الفيروسي من 140 ميكرولتر إذابة HIV-1 البلازما المصابين باستخدام عدة الاستخراج.
    1. عندما يكون ذلك ممكنا، الشروع فورا في التوليف [كدنا] بعد استخراج الحمض النووي الريبي RNA الفيروسي كما رفع التجميد تؤدي إلى أفضل النتائج التضخيم. إذا كان ذلك ممكنا، إعداد PCR مزيج الرئيسي لأول جولة تضخيم الحمض النووي وتخزينها في 4 درجات مئوية قبل استخراج الحمض النووي الريبي الفيروسي.
  2. العكسية تدوين [كدنا] من الحمض النووي الريبي DNA وتضخيم منتجات الجولة الأولى باستخدام العكسية الناسخ والبلمرة DNA بالحرارة في خطوة واحدة RT-PCR.
    1. اتخاذ RNA من -80 ° C الفريزر (إذا كان من الضروري تجميد)، وذوبان الجليد لفترة وجيزة في درجة حرارة الغرفة ثم ضع في كتلة البارد. نقل 5 ميكرولتر من الحمض النووي الريبي لكل أنبوب PCR يحتوي على 45 ميكرولتر من مزيج الرئيسي لإعطاء الحجم النهائي من 50 ميكرولتر. وضع على الفور المتبقية عينات الحمض النووي الريبي إلى -80 ° C الفريزر.
    2. بعد الانزيم هوdded إلى الدور الأول-PCR مزيج الرئيسي (الجدول 1A)، قسامة 45 ميكرولتر في كل التضخيم PCR رقيقة الجدران أنبوب لعدد من ردود الفعل المطلوب. تأكد من استخدام أنابيب PCR مع قبعات الفردية وليس تجريد مباراة دولية لضمان الحد الأدنى من انتقال التلوث بين العينات. وضع أنابيب PCR في كتلة البارد لحماية انزيم RNA القالب وRT حساس درجة الحرارة. ملاحظة: يجب تشغيل العينات في ثلاث نسخ من أجل أخذ عينات بشكل كاف quasispecies الفيروسية. من المهم أيضا للاستفادة من المنتج مع عالية الدقة إنزيم البلمرة DNA من أجل تقليل misincorporation قدم PCR. يرجى الرجوع إلى قائمة الكواشف للمنتج الموصى بها.
    3. بعد تمت إضافة قالب RNA لجميع أنابيب رد فعل، ونقل أنابيب PCR على thermocycler لتضخيم باستخدام برنامج cycler هو موضح في الجدول 1B. ملاحظة: سيتم استخدام المنتج من هذا التضخيم في الجولة الثانية متداخلة PCR.
  3. إجراء متداخلة حد ذاتهكوند جولة PCR التضخيم، وذلك باستخدام 1 ميكرولتر من أول جولة PCR التضخيم (1.2) كقالب DNA.
    1. قسامة 49 ميكرولتر من الجولة الثانية PCR مزيج الرئيسي (الجدول 2A) لكل أنبوب PCR رقيقة الجدران لعدد من ردود الفعل المطلوب. نقل 1 ميكرولتر من الدور الاول-PCR التضخيم لكل أنبوب رد فعل لإعطاء الحجم النهائي من 50 ميكرولتر. ملاحظة: ستكون هذه خدمة DNA القالب ك لتضخيم الدور الثاني. من المهم أيضا للاستفادة من البلمرة DNA مع قدرات الإخلاص وتصحيح التجارب المطبعية عالية جدا من أجل تقليل misincorporation قدم PCR. يرجى الرجوع إلى قائمة الكواشف للمنتج الموصى بها.
    2. نقل الجولة الثانية PCR مزيج رد فعل على thermocycler وتشغيل البرنامج المبين في الجدول 2B. ملاحظة: بعد الانتهاء من البرنامج، سيتم تشغيل منتجات هذا رد فعل على هلام الاغاروز لتأكيد إنتاج المنتج.
  4. إضافة 3 ميكرولتر من صبغ تحميل 5X إلى 5 & #181؛ ل 50 ميكرولتر من الدور الثاني حجم رد الفعل وتعمل في 120 V على 1٪ الاغاروز تاي هلام يحتوي على الحمض النووي وصمة عار للأشعة فوق البنفسجية الفلورسنت حتى يتم حل العصابات. تصور العصابات 1.6 كيلو بايت على ضوء إضاءة زرقاء (انظر الشكل 1A).
  5. تشغيل 45 ميكرولتر حجم رد الفعل المتبقية على 1٪ الاغاروز تاي هلام يحتوي على الحمض النووي وصمة عار، واستئصال العصابات المناسبة بشفرة حلاقة نظيفة.
    1. استخراج الحمض النووي من شريحة هلام باستخدام طقم تنقية هلام، أزل في nuclease خالية من المياه، والجمع بين ثلاثة ردود فعل إيجابية للفرد، وتجميد المنتج في -20 درجة مئوية لاستخدامها لاحقا.

2. إعداد Amplicons أسكت عن طريق الاستنساخ مقدمة من مواقع تقييد الضرورية

  1. تضخيم كرر محطة الطويلة (LTR) / 5 "UTR جزء من البلازميد MJ4 (انظر الجدول 3).
  2. تصور 1.3 كيلوبايت المنتجات PCR على إضاءة، amplicons إيجابية المكوس، هلام تنقية وتجميد كما في السابقوصف (1.4،1.5، انظر الشكل 1B).
  3. خلق تنصهر MJ4 LTR- amplicons هفوة عبر "لصق-التداخل تمديد" PCR (انظر الجدول 4).
  4. تصور، والمكوس، وتنقية، وتجميد amplicons 3.2 كيلو بايت كما في 1.4،1.5 (انظر الشكل 1C).

3. استنساخ الجينات هفوة أسهب في MJ4، النوع الفرعي C، استنساخ الجزيئية المعدية

  1. هضم 1.5 ميكروغرام من MJ4 البلازميد و 1.5 ميكروغرام من تنقية المنتج LTR- هفوة PCR مع BclI (مثيلة حساسة) نوكلياز داخلية تقييد مقابل 1.5 ساعة عند 50 درجة مئوية (انظر الجدول 5A).
  2. إضافة 1 ميكرولتر من NgoMIV إلى رد فعل الهضم واحتضان عند 37 درجة مئوية لمدة 1 ساعة.
  3. إضافة 5X صبغ تحميل لتقييد هضم ردود الفعل وelectrophorese ببطء الحجم الكلي على 1٪ الاغاروز تاي الجل تحتوي على هلام وصمة عار الحمض النووي لمدة 1-2 ساعة عند 100 V. تصور والمكوس، وتنقية العصابات أشار للاستنساخ كما سبق تنازلياribed (انظر الشكل 2).
  4. إعداد ردود الفعل ربط باستخدام النقي LTR- هفوة إدراج وDNA ناقلات MJ4 في 3: 1 تضاف إلى نسبة النواقل. احتضان ردود الفعل ربط بين عشية وضحاها في 4 درجات مئوية (انظر الجدول 5B).
  5. تحويل JM109 البكتيريا المختصة كيميائيا مع منتجات ربط ونشر على لوحات أجار LB مع 100 ميكروغرام / مل الأمبيسلين وتنمو عند 30 درجة مئوية لمدة ساعة 22+.
    1. ذوبان الجليد JM109 الخلايا المختصة على الجليد لمدة 15 دقيقة. تسمية 1.5 مل أنابيب microcentrifuge والبرد على الجليد.
    2. قسامة 50-100 ميكرولتر من الخلايا JM109 إلى ما قبل مبرد 1.5 مل أنابيب microcentrifuge. إضافة 2.5-5 ميكرولتر من رد فعل لربط JM109 الخلايا عبها الأنبوب برفق لمزج والعودة فورا إلى جليد. احتضان خلايا المختصة مع المنتج ربط على الجليد لمدة 30 دقيقة.
    3. الصدمة الحرارية 1.5 مل أنابيب microcentrifuge تحتوي JM109 الخلايا المختصة وربط رد فعل في 42 ° C كتلة الحرارة لمدة 45 ثانية والعودة إلى الجليد لمدة 3 دقائق على الأقل.
    4. إضافة 50 ميكرولتر من وسائل الاعلام SOC إلى كل أنبوب microcentrifuge ولوحة رد فعل التحول بأكمله على درجة حرارة الغرفة LB-أجار لوحات تستكمل مع 100 ميكروغرام / مل الأمبيسلين.
    5. لوحات نقل إلى 30 درجة مئوية الحاضنة وتترك لمدة 20 ساعة، أو حتى يتم تشكيل المستعمرات بشكل واضح.
  6. اختيار المستعمرات المعزولة وتنمو في 4 مل من LB مع 100 ميكروغرام / مل الأمبيسلين عند 30 درجة مئوية لمدة ساعة 22+.
  7. تدور باستمرار في الثقافات 3،200 x ج لمدة 15 دقيقة، صب من مرق، واستخراج DNA البلازميد.
  8. لتأكيد استنساخ الإخلاص، وقطع DNA miniprep مع NgoMIV انفلونزا الطيور وتقييد الانزيمات في ضعف الهضم عند 37 درجة مئوية لمدة 2 ساعة. تحليل على 1٪ الاغاروز تاي هلام (انظر الجدول 5C).
  9. تسلسل المنطقة إدراج LTR-أسكت كل البلازميد باستخدام بادئات التالية: GagInnerF1، GagF2، REV1، REV3، وGagR6 (الجدول 6) لتأكيد هوية التسلسل.
  10. مقارنة تسلسل المستنسخة التي تم الحصول عليها مع تسلسل سكان ديرived من amplicon النقي الأولي من 1.5.1. ملاحظة: من المهم لتقييم القدرة في نهاية المطاف تكرار اثنين من الحيوانات المستنسخة مستقلة من أجل ضمان أن أي تكرار في المختبر الظواهر ليست بسبب أخطاء العمود الفقري قدم أثناء عملية الاستنساخ.

4. الجيل وTitering من النسخ المتماثل المختصة الكمامة-MJ4 همي الفيروسات

  1. توليد تكاثر الفيروس المختصة عليها بنقل 1.5 ميكروغرام من الحمض النووي البلازميد miniprep MJ4 خيالية إلى خلايا 293T باستخدام نسبة 4: 1 من Fugene HD كما وصفها الأمير وآخرون 39.
  2. عيار تحصد مخزونات فيروس على خلايا TZM-BL كما هو موضح أدناه والأمير وآخرون 39.
    1. لوحة-TZM از خلايا 24 ساعة قبل الإصابة بفيروس في أجل الحصول على 30-40٪ أحادي الطبقة الخلية متكدسة في اليوم التالي. وعادة ما يمكن أن يتحقق هذا عن طريق إضافة 5 × 10 4 خلايا في إجمالي حجم 800 ميكرولتر لكل بئر في 24 لوحة جيدا.
    2. بعد إضافة خلايا إلى البئر، نقل بلطف 24 لوحة جيدا إلى الأمام والخلف، ثم جانب إلى آخر من أجل توزيعها بكفاءة الخلايا. دوامة أبدا - وهذا سوف يؤدي إلى تراكم الخلايا في وسط اللوحة.
    3. في اليوم التالي، وإعداد 1٪ FBS في DMEM. وسوف تستخدم هذه لتمييع دجلة-ديكستران وتمييع مخزونات فيروس. الأسهم دجلة-ديكستران هو 10 ملغ / مل أو 125x، وتركيز النهائي من 80 ميكروغرام / مل أو 1X هو المطلوب.
    4. إخراج الأسهم فيروس لفحصها من -80 ° C الفريزر ومكان على شاكر لذوبان الجليد في درجة حرارة الغرفة.
    5. باستخدام ماصة الأقنية، وتمييع متسلسل مخزونات فيروس في زراعة الأنسجة ذهابا والقاع 96 لوحة تعامل جيدا مع غطاء. هذا هو بروتوكول التخفيف 3 أضعاف. انظر الجدول رقم 7 لنظام التخفيف.
    6. إزالة وسائل الاعلام من المصنف 24 لوحات جيدا TZM از باستخدام الشافطة فراغ التأكد من عدم إزعاج أحادي الطبقة الخلية. فقط إزالة وسائل الإعلام من واحد 24 لوحة جيدا في وقت لذلك أن الخلايا تفعللا تجف.
    7. إضافة 150 ميكرولتر من 1X دجلة-ديكستران + 1٪ FBS في DMEM الخليط إلى كل بئر باستخدام ماصة 1،000 ميكرولتر. لا تستخدم تكرار ماصة لأن هذا يعطل أحادي الطبقة.
    8. إضافة 150 ميكرولتر من كل تخفيف الفيروس إلى البئر المناسب. إضافة الفيروس إلى مركز البئر ودوامة بلطف لتوزيع بالتساوي الفيروس عبر أحادي الطبقة الخلية. احتضان الخلايا المصابة لمدة 2 ساعة في حاضنة زراعة الأنسجة عند 37 درجة مئوية و 5٪ CO 2.
    9. بعد حضانة 2 ساعة، إضافة 0.5 مل 10٪ FBS في DMEM إلى كل بئر والعودة إلى الحاضنة لوحات ل48 ساعة إضافية.
    10. بعد 48 ساعة، وينبغي أن تكون خلايا متكدسة 100٪. لأن MJ4 هو فيروس المختصة التكرار، سيكون هناك بعض موت الخلايا، ولكن هذا أمر متوقع.
    11. إزالة وسائل الإعلام من كل بئر وإضافة 400 ميكرولتر / جيد من تحديد الحل (انظر الجدول 8A وصفة). إصلاح لوحة واحدة فقط في المرة الواحدة. إضافة تحديد الحل باستخدام ماصة 1،000 ميكرولتر، وترك الجلوس لمدة 5 دقائق فيدرجة حرارة الغرفة.
    12. إزالة تثبيت الحل وغسل 3X مع برنامج تلفزيوني مع الكالسيوم 2+ / المغنيسيوم 2+. استخدام زجاجة بخ لإضافة بلطف PBS إلى جانب البئر لتجنب تعطيل أحادي الطبقة. بعد غسل الثالث، وصمة عار لوحة جاف على ورق ماص.
    13. إضافة 400 ميكرولتر / جيد من حل تلطيخ (انظر الجدول 8B وصفة) إلى كل بئر من 24 لوحة جيدا، واحتضان عند 37 درجة مئوية لمدة لا تقل عن 2 ساعة. مرات حضانة أطول مقبولة، ولكن يجب أن تبقى مرات حضانة متناسقة بين التجارب titering.
    14. غسل 2X مع PBS مع الكالسيوم 2+ / المغنيسيوم 2+ ويسجل للعدوى، أو إضافة برنامج تلفزيوني وتخزينها في 4 درجة مئوية لمدة التهديف في وقت لاحق. يمكن أن تظل لوحات في 4 درجة مئوية لمدة تصل إلى أربعة أيام، طالما يتم الاحتفاظ أحادي الطبقة المائية.
    15. ليسجل للعدوى، استخدم علامة دائمة لتقسيم الآبار من 24 لوحة جيدا في الأرباع. عد جميع الخلايا الزرقاء ضمن مجال الرؤية، وذلك باستخدام التكبير الكلي لل200X، مرة واحدة فيكل من الأرباع الأربعة من بئر.
    16. حساب وحدات المعدية لكل ميكرولتر على النحو التالي: [(# خلايا الزرقاء / 4) × 67] / (ميكرولتر فيروس مضاف) = IU / ميكرولتر. الرجوع إلى الجدول لحجم 8C في ميكرولتر من فيروس تضاف إلى كل بئر. متوسط ​​عدة آبار معا. يجب أن تكون الأرقام مماثلة نسبيا لمعايرة دقيقة.

5. إعداد الثقافة وسائل الإعلام ونشر خلايا GXR25 لفي المختبر النسخ المتماثل الفحص

  1. إعداد كامل RPMI (cRPMI) لنشر خلايا GXR25. ملاحظة: من المهم للغاية بالنسبة خلايا الثقافة GXR25 قبل 4 أشهر على الأقل لتكرار التجارب المخطط لها (انظر الجدول 9).
  2. انقسام خلايا 1:10 مرتين في الأسبوع، والحفاظ على كثافة الخلية بين 1 × 05-02 أكتوبر × 10 6 خلية / مل.

6. النسخ المتماثل في المختبر من الكمامة-MJ4 الوهم في GXR25 (CEM-CCR5-GFP) الخلايا

  1. قبل يوم من طnfection، تقسيم الخلايا إلى تركيز بين 2-3 × 10 5 خلية / مل بحيث تكون في النمو اللوغاريتمي في يوم من العدوى.
  2. في يوم من العدوى، وإزالة مخزونات فيروس من -80 ° C الفريزر وذوبان الجليد. حساب حجم فيروس المطلوبة من كل الأوراق المالية على أساس وحدة دولية / عيار ميكرولتر من فحص الخلايا TZM-BL لكي تصيب 5 × 10 5 GXR25 خلايا في عدد وافر من العدوى من 0.05، وذلك باستخدام الصيغة:
    حجم الفيروس لعدوى (ميكرولتر) = 1 ميكرولتر / X IU س 0.05 س 500،000
    ملاحظة: لقد اخترنا وزارة الداخلية من 0.05 وهذه النتائج في مرحلة النمو لوغاريتمي لجميع الفيروسات التي اختبرناها. من المهم إجراء التجارب الأولية من أجل تحديد وزارة الداخلية المثلى لالتقاط النمو اللوغاريتمي للفيروس لفحصها.
  3. تمييع الفيروس في cRPMI إلى وحدة تخزين من 100 ميكرولتر (من أجل تحقيق 0.05 MOI) وإضافة إلى بئر لزراعة الأنسجة V-96 لوحة أسفل يعامل جيدا. ملاحظة: تشمل كلا من positiلقد التحكم (MJ4 WT المصابة) والسالب (الخلايا المصابة وهمية) في كل مجموعة من التجارب النسخ المتماثل. إعداد لوحة بحيث كل عمود آخر فارغ للحد من انتقال التلوث بين الآبار. السيطرة الإيجابية أمر حتمي، كما سيتم استخدامه في وقت لاحق كمعيار لتطبيع منحدرات التكرار، التي هي مقياس لمعدل تكرار مكررات التجريبية.
  4. عد الخلايا GXR25 باستخدام عداد خلية الآلي. حساب عدد الخلايا اللازمة في مجموع لجميع الإصابات (5 × 5 × 10 # العدوى). قسامة حجم المطلوب في أنبوب مخروطي 50 مل وأجهزة الطرد المركزي لتكوير الخلايا. حساب دائما ل25٪ أكثر من اللازم العدوى.
  5. وسائل الاعلام نضح بعناية وresuspend في cRPMI بتركيز 5 × 10 5 خلية / 100 ميكرولتر.
  6. خلايا ماصة في حوض معقم وتخلط جيدا. باستخدام ماصة متعدد القنوات، إضافة 100 ميكرولتر من الخلايا في كل بئر من 96 لوحة جيدا تحتوي على الفيروس المخفف. ميلس بدقة.
  7. إضافة 2 ميكرولتر من 5 ملغ / مل (100X) حل polybrene إلى كل بئر والخلايا تخلط جيدا.
  8. احتضان عند 37 درجة مئوية في نسيج الثقافة حاضنة مع CO 2 5٪ لمدة 3 ساعة.
  9. من أجل غسل الخلايا المصابة، الطرد المركزي 96-V-جيدا لوحة أسفل لتكوير الخلايا. ثم إزالة بعناية 150 ميكرولتر من المتوسطة واستبدالها مع 150 ميكرولتر جديدة من cRPMI دون إزعاج بيليه الخلية. كرر 2 مرات أكثر (بما في ذلك الطرد المركزي) بما فيه الكفاية لغسل الخلايا.
  10. بعد الطرد المركزي الماضي وإضافة 150 ميكرولتر cRPMI، resuspend الكرية خلية مع ماصة الأقنية وإضافة خليط كامل الخلية / فيروس (حوالي 200 ميكرولتر) من كل بئر مستقل إلى 800 ميكرولتر من cRPMI في بئر من نسيج 24 أيضا لوحة الثقافة.
  11. مكان لوحة في 5٪ CO 2 نسيج الثقافة الحاضنة عند 37 درجة مئوية.
  12. كل يومين، وإزالة 100 ميكرولتر من طاف من سطح الثقافة جيدا ونقل إلى 96 جيدا Uلوحة القاع ومخزن تجميد في -80 درجة مئوية حتى تشغيل فيروس الكميات الفحص. ملاحظة: الترتيب الدقيق لsupernatants في لوحات 96 بشكل جيد يسمح للنقل متعدد القنوات ماصة من supernatants الثقافة خلال الفيريون الكمي عبر رديولبلد الناسخ العكسي (RT) فحص. يجب أن تحتوي كل لوحة عينات من مستوى الإصابة من أجل تطبيع بين لوحة التباين في قراءات فحص RT.
  13. بعد إزالة كل عينة 100 ميكرولتر، وخلايا تقسيم 1: 2 بواسطة الخلايا إعادة التعليق بدقة وإزالة نصف حجم المتبقية (450 ميكرولتر). استعادة حجم الأصلي (1 مل) من خلال إضافة 550 ميكرولتر من cRPMI جديدة إلى كل بئر.

7. تحليل الناسخ العكسي (RT) في خلية ثقافة Supernatants

بروتوكول تكييفها من اوستروفسكي وآخرون 40.

  1. إنشاء غطاء السلامة البيولوجية في منشأة BSL-3 للاستخدام مع المواد المشعة.
    1. وضع ورقة ماصة في هوود واستبدال الشافطة لالشافطة المخصصة لاستخدام الإشعاعي. ملاحظة: يجب أن يتم التخلص منها بطريقة صحيحة جميع النفايات المشعة مع فقا للوائح السلامة.
  2. إضافة 1-2 ميكرولتر من 10 ميلي كوري / مل من [α- 33 P] dTTP و 4 ميكرولتر من 1 M dithiothreitol (DTT) لكل 1 مل قسامة من مزيج الرئيسي RT (انظر الجدول 10 واوستروفسكي وآخرون 40).
  3. مزيج بعناية كل أنبوب microcentrifuge 1.5 مل من مزيج الرئيسي RT، DTT، و[α- 33 P] dTTP مع ماصة 1،000 ميكرولتر ونقل إلى حوض العقيمة.
  4. الاستغناء عن 25 ميكرولتر من مزيج المسمى RT في كل بئر من 96 جيدا رقيقة الجدران لوحة PCR. ملاحظة: تشمل مساحة لمراقبة إيجابية (MJ4 العدوى WT) والسيطرة السلبية (العدوى وهمية).
  5. إضافة 5 ميكرولتر من كل طاف لوحة PCR يحتوي على مزيج الرئيسي RT.
  6. ختم PCR لوحة مع غطاء احباط لاصقة واحتضان لمدة 2 ساعة على 37 درجة مئوية في thermocycler. لأسباب تتعلق بالسلامة، رينحد ذاتها نصائح ماصة مع Amphyl والتخلص من النصائح في حاوية صغيرة تحتوي النفايات Amphyl، والتي سوف يتم التخلص منها في وقت لاحق في النفايات المشعة.
  7. بعد الحضانة، وجعل ثقوب صغيرة في غلاف احباط باستخدام 200 ميكرولتر متعدد القنوات ماصة. ملاحظة: إذا نصائح ماصة لمس السائل بشكل جيد، واستبدال نصائح قبل أن ينتقل إلى العمود أو الصف التالي.
  8. مزيج عينات 5X ونقل 5 ميكرولتر من كل عينة إلى ورقة DE-81. الهواء الجاف 10 دقيقة.
  9. البقع غسل 5X مع 1X SSC (كلوريد الصوديوم، سيترات الصوديوم)، ثم 2X مع 90٪ من الإيثانول في 5 دقائق لكل يغسل. السماح للهواء الجاف.
    1. وضع كل وصمة عار في وعاء الغسيل منفصلة، ​​مثل مربع تخزين شطيرة، إضافة ما يكفي من غسل العازلة (1X SSC أو 90٪ ETOH) لتغطية وصمة عار، ويهز لمدة 5 دقائق.
    2. تخلصي غسل العازلة في حاوية منفصلة، ​​وتكرار. ملاحظة: وتعتبر يغسل 3 الأولى المشعة ويجب التخلص منها بشكل صحيح. 2 يغسل مشاركة يمكن التخلص منها بشكل منتظم.
  10. مرة واحدة جافة، سيارةالتفاف efully صمة عار في ساران التفاف وتعرض إلى phosphoscreen في شريط مغلقة بإحكام بين عشية وضحاها في درجة حرارة الغرفة.
  11. تحليل phosphoscreens مع phosphorimager وتحديد النصوص المشعة.
  12. رسم دائرة حول كل إشارة المشعة باستخدام برنامج OptiQuant. الرسم البياني قيم الوحدة الرقمية الخفيفة (DLU) لتوليد منحنيات النسخ المتماثل.
  13. من أجل توليد القدرة عشرات النسخ المتماثل كانت قيم DLU سجل 10 -transformed وحسبت المنحدرات باستخدام يوم 2 و 4 و 6 نقاط الوقت. ثم تنقسم منحدرات التكرار من قبل المنحدر من WT MJ4 من أجل توليد تكرار عشرات القدرات. من المهم لتطبيع على أساس القيم MJ4 WT تم الحصول عليها من نفس RT لوحة للحد من تقلب داخل الفحص.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

من أجل تنفيذ هذا البروتوكول بشكل صحيح، مما يخلق البلازميد proviral قادرة على تجميع وظيفية بالكامل، المعدية الوهم الكمامة-MJ4، يجب توخي الحذر الشديد لتوليد amplicons PCR المناسبة. تحديد ما إذا كان PCR ولدت في amplicon هفوة بحجم مناسب أمر بالغ الأهمية. يجب أن تكون المنتجات ضمن 100 زوج قاعدي (بي بي) من amplicon حوالي 1،700 بي بي مبين في الشكل 1A. وطول هذا الجزء الدقيق تختلف تبعا الجين هفوة قيد الدراسة. المقبل، يجب تضخيمه 5 'طويلة تكرار محطة (LTR) جزء من استنساخ الجزيئية MJ4 وتقسم إلى amplicon هفوة من أجل جعلها ملائمة لاستنساخ لاحق. يجب أن يكون amplicon MJ4 LTR 1،474 نقطة أساس في الطول. الشكل 1B يظهر صورة هلام التمثيلية التي يشار الأحجام الفرقة الصحيحة. بعد لصق-التداخل تمديد PCR 41، ينبغي أن تكون مجتمعة المنتجات هفوة LTR-ما يقرب من 3،200 شركة بريتيش بتروليوم في الطول، كما هو مبين في الشكل 1C.

مرة واحدة أحرز الجين هفوة مناسبة لاستنساخ بواسطة الانصهار إلى "LTR 5 من MJ4، الذي يحتوي الموقع NgoMIV الضروري تقييد، سواء النواقل وإدراج هفوة يجب أن يتفاعل مع NgoMIV وBclI تقييد الانزيمات ورفعه من agarose هلام بعد الكهربي الانفصال. لا بد من استئصال النواقل وإدراج العصابات المناسبة. ويرد جل تمثيلي في الشكل 2. يجب أن يكون جزء من ناقلات البلازميد MJ4 حوالي 10،000 BP في الطول، في حين أن أسكت إدراج LTR- ينبغي أن تظل في حوالي 3،000 بي بي في الطول، كما توجد مواقع التقييد في أقصى الغايات من وamplicon. فإن أي انخفاض كبير في حجم تشير إضافي الموقع المعالم داخل الجين هفوة قيد الدراسة.

بعد ربط شظايا اثنين، والتحول البكتيري، والثانية عزل DNA البلازميد، يجب التحقق من الوهم الكمامة-MJ4 عن الحجم المناسب عن طريق إجراء الهضم مزدوجة مع NgoMIV وانفلونزا الطيور الانزيمات قيود. كامل طول الوهم-MJ4 الكمامة التي لم تكبد أي أحداث الحذف أثناء النسخ المتماثل البكتيرية ينبغي أن يكون لها نمط قيود مماثلة لتلك التي صورت في الشكل (3)، مع شريطين من حوالي 8،700 و 4،300 نقطة أساس.

تمييز مهم من هذا البروتوكول بالمقارنة مع النهج السابقة، هو استخدام استنساخ الجزيئية HIV-1 النوع الفرعي C المعدية، MJ4، بدلا من الفيروس أكثر شيوعا NL4-3-تكييفها المختبر. ومع ذلك، فإن النهج هو موضح في المقطع السابق يمكن تعديلها لاستنساخ تسلسل النوع الفرعي B هفوة في pNL4-3.

وقد أجريت لتعظيم الاستفادة من تعدد العدوى (وزارة الداخلية) لاستخدامها في تجارب لاحقة من أجل تحديد وزارة الداخلية المثالية التي أظهرت نموا لوغاريتمي من غالبية الفيروسات التي تم اختبارها.يصور الشكل 4 منحنيات تمثيلية النسخ المتماثل من ثلاثة موييس مختلفة (0.01، 0.05، و 0.25) للMJ4 (الشكل 4A) فضلا عن NL4.3 (الشكل 4B). MJ4 يعيد أقل بكثير بكفاءة في الخلايا GXR25 من NL4-3، وهو أمر مهم لتأخذ في الاعتبار، حسب الاقتضاء وزارة الداخلية لNL4-3 تكرار من المرجح أن تكون منخفضة للغاية للكشف عن تكرار MJ4 كفاءة. كما رأينا في الشكل 4A، وزارة الداخلية من 0.05 بدلا من 0.01 أو 0.25، كان الخيار الأمثل، لوحظ نمو وغاريتمي بين 2-6 أيام للMJ4. لأقل زارة الداخلية، 0.01، يوم 6 DLU القيم هي بالكاد يمكن كشفها، وتوقعنا توليد الكمامة-MJ4 الفيروسات خيالية أن تكرارها أقل من MJ4. ولذلك هذا ليس وزارة الداخلية القبض على نمو أكثر الموهنة الوهم الكمامة-MJ4، والتي قد تكون أيضا الأكثر أهمية من الناحية البيولوجية. بالإضافة إلى ذلك، كانت وزارة الداخلية من 0.25 يست مثالية، لأن حركية السريعة من تكاثر الفيروس قتلت عمو كبيرالإقليم الشمالي الخلايا حتى بعد يوم 4. يؤدي هذا المنحنى النسخ المتماثل إلى الهضبة، وسوف حساب منحدر على أساس منحنى مثل هذا نقلل من قدرة النسخ المتماثل. على أساس منحنيات المتولدة عن NL4-3، حتى في وزارة الداخلية من 0.01 والأهداف خلية المتاحة قد استنفدت بشكل ملحوظ بعد يوم 6 العدوى آخر. في الختام، تم العثور على وزارة الداخلية من 0.05 ليكون الأمثل لوحة كبيرة من الكمامة-MJ4 الفيروسات خيالية، والتي كان تسلسل الكمامة متنوعة وبدرجات متفاوتة من النسخ المتماثل.

وقد تم اختبار ما مجموعه 149 الكمامة-MJ4 الفيروسات خيالية مشتقة من النوع الفرعي الحاد تسلسل C الكمامة لتكرارها في المختبر باستخدام هذا الاختبار. وتراوحت القيم RC تطبيع من 0.01 إلى أكثر من 3.5 مع بعض الفيروسات تكرار أكثر من 100 مرة أكثر كفاءة من النوع البري MJ4 ويبين الشكل 5 منحنيات النسخ المتماثل من تسعة تمثيلية-الكمامة MJ4 الفيروسات خيالية، مع من النوع البري MJ4 يصور باللون الأحمر، ويدل على مجموعة واسعة من تكرار جولاحظ apacities. وهكذا، فإن التنوع ضمن تسلسل الجين هفوة وحدها يمكن أن تؤثر بشكل كبير على قدرة الفيروس على تكرار في المختبر. في حين أن هذا هو ممثل الكمامة-MJ4 الفيروسات خيالية مستمدة من الزامبيين المصابة تماما، لم يتم اختبارها على نطاق واسع أخرى متواليات النوع الفرعي C، و قد يحمل تكرار حركية مختلفة. ولذلك، يجب توخي الحذر الشديد لتحسين وزارة الداخلية لتتناسب مع تكرار معين من الفيروسات من دراسة معينة، لأنه لا يمكن أن تكون هناك مجموعة واسعة في مستويات مختلفة النسخ المتماثل بين HIV-1 العمود الفقرى والكمامة يعزل.

واحدة من مزايا استخدام خط T-خلية مثل خط خلية GXR25، التي تدعم تكرار MJ4، لوحظ مستوى استنساخ النسبي لتكرار التجارب باستخدام حفز خلايا الدم وحيدات النوى المحيطية كأهداف. في التجارب الأولية الأمثل، MJ4 النوع البري عرضت على التباين داخل الفحص من 8.7٪، واحاستنساخ الإقليم الشمالي من نفس الفيروس خيالية الكمامة-MJ4 عرضت التباين في تكرار 8.5٪. لأن يمزج رئيسية مختلفة والتعرض phosphoscreen قد يعطي القيم DLU التي تختلف قليلا في الحجم، يمكن زيادة التحكم تقلب داخل الفحص عن طريق تشغيل مستوى الفيروس نفسه (في حالتنا البرية من نوع MJ4) في كل لوحة فحص RT الشكل 6 الرسوم البيانية و DLU القيم المستمدة من نفس الإصابة MJ4، كميا في ثماني لوحات RT مختلفة. تطبيع للفيروس التي هي مشتركة بين جميع المقايسات RT يمكن أن تساعد على التخفيف من الخطأ المحتملة الناجمة عن هذه التغييرات طفيفة في حجم إشارة بين المقايسات.

تم اختبار بين فحص بنسب مختلفة أيضا ويعيد تكرار في أيام مختلفة كانت مرتبطة إلى حد كبير. الشكل 7 المؤامرات القيم النتيجة RC تطبيع من تجربتين مستقلة أجريت حوالي سنة واحدة على حدة. ولوحظ وجود درجة عالية من الارتباط مع غياب القيم المتطرفة الرئيسية (R 2 = 0.873) betwالتابعين هما مكررات مستقلة.

على الرغم من أن يرتبط بعلاقة متبادلة، وهناك بعض التباين في الحجم العام لحركية النسخ المتماثل بين اثنين من تجارب مستقلة. ويمكن أن يعزى هذا جزئيا إلى الاختلاف في الأرقام مرور بين الخلايا الأسهم GXR25 المستخدمة في كل تجربة. بشكل عام، GXR25 خلايا الأسهم التي تم passaged لفترة من الوقت أكبر من 6 أشهر تميل لدعم تكرار أكثر كفاءة من الوهم الكمامة-MJ4. ولذلك، فإنه من المستحسن لتقييم قدرة التكرار بين مجموعات من الوهم في إطار زمني شهر واحد. عندما يتم اتباع الخطوات السابقة بشكل وثيق، هذا الاختبار قادر على تحقيق نتائج قوية للغاية وقابلة للتكرار، والتي تنطبق على مجموعة واسعة من الدراسات.

الشكل 1
الرقم 1. الممثل هلام ايماجوفاق تصور الفصل الكهربي للمنتجات PCR. بالنسبة لجميع المنتجات PCR، 5 ميكرولتر من كل رد فعل 50 ميكرولتر كانت مختلطة مع 3 ميكرولتر من صبغ 5X التحميل وتحميلها في 1٪ الاغاروز تاي هلام تستكمل مع 1X SYBR آمنة هلام DNA وصمة عار، و مفصولة الكهربائي على 120 فولت لمدة 45 دقيقة. تم استخدام PROMEGA 1 كيلوبايت DNA سلم (لين 1) لتقريب أحجام amplicon. A) تم تضخيم الجين الفيروسي RNA من هفوة باستخدام نهج PCR المتداخلة. بسبب الإدراج والحذف، وamplicon هفوة قد تختلف من 1،600-1،700 BP في الطول، ويبدو قليلا فوق 1،500 نقطة أساس سلم DNA علامة. الممرات 2-5 تصور ناجح هفوة التضخيم الجيني. B) تم تضخيم "LTR 5 من MJ4 من النوع البري MJ4 البلازميد وتصور عبر الفصل الكهربي. الممرات 2-5 تصور التضخيم الناجح ل1،474 BP LTR المنتج، الذي يبدو قليلا أقل من 1،500 شركة بريتيش بتروليوم سلم DNA علامة. ج) 5R17؛ LTR المستمدة من النوع البري وMJ4 وتنصهر الجين هفوة تضخيمها من بلازما المريض معا عن طريق لصق-التداخل تمديد PCR وتصور عبر الفصل الكهربي. الممرات 2-5 تصوير تنصهر بنجاح amplicons أن ما يقرب من 3،200 شركة بريتيش بتروليوم في الحجم، والتي تظهر أعلى قليلا من 3،000 شركة بريتيش بتروليوم سلم DNA علامة.

الشكل 2
الشكل 2. صورة هلام التمثيلية التي تصور الفصل الكهربي من تقييد هضم لاستنساخ الجينات هفوة المرضى في MJ4. تم هضمها من نوع البرية MJ4 البلازميد وLTR- هفوة المنتجات الانصهار مع BclI مقابل 1.5 ساعة عند 50 درجة مئوية وNgoMIV لمدة 1 ساعة عند 37 درجة C. تم تصور النواقل وإدراج شظايا عبر الفصل الكهربي على 1٪ الاغاروز تاي هلام تستكمل مع 1X SYBR آمنة DNA ز ش صمة عار في 100 V لمدة 2 ساعة وباستخدام ضوء إضاءة زرقاء من أجل الحد من الحمض النووي من التلف الناجم عن الأشعة فوق البنفسجية. ناقلات وإدراج شظايا مناسبة لاستنساخ الخطوات اللاحقة تظهر في حوالي 10،000 سنة مضت 2،900 نقطة أساس على التوالي.

الرقم 3
الرقم 3. هلام التمثيلية صورة تصور الفصل الكهربي للهضم تقييد النقي الكمامة MJ4-DNA البلازميد الوهم. تم هضمها نقرا مزدوجا تنقية الكمامة-MJ4 الوهم بلازميد الحمض النووي مع NgoMIV وتقييد الانزيمات انفلونزا الطيور لمدة 2 ساعة عند 37 درجة مئوية. تم تصور هضم تقييد عبر الفصل الكهربي على 1٪ الاغاروز تاي هلام تستكمل مع 1X-SYBR آمنة هلام DNA وصمة عار في 120 V لمدة 45 دقيقة. سوف البلازميدات دون الحذف كبيرة لحل لشريطين متميزة في حوالي 8،700 و 4،300 نقطة أساس.

ogether.within الصفحات = "دائما"> الرقم 4
الرقم 4. تكرار MJ4 وNL4-3 يعزل من HIV-1 في خط الخلية GXR25 في مولتيبليكيتييس مختلفة من العدوى (وزارة الداخلية). أصيب 5 × 10 5 GXR25 الخلايا كما هو موضح في البروتوكول الأسلوب مع 5 أضعاف زيادة زارة الداخلية لكل سهم الفيروس. تم جمع Supernatants في أيام 2 و 4 و 6، وكان كميا آخر 8 العدوى والفيريون إنتاج عبر رديولبلد الناسخ العكسي الفحص. تم تشغيل التهابات في ثلاث نسخ وأشرطة الخطأ دلالة على الانحراف المعياري لثلاث مكررات. (A) MJ4 (B) NL4-3.

الرقم 5
الرقم 5. مجموعة الممثل النسخ المتماثل لمختلف الوهم الكمامة-MJ4. 5 GXR25 مع خلايا من النوع البري MJ4 أو الكمامة-MJ4 الوهم في وزارة الداخلية من 0.05، تم جمع supernatants على فترات لمدة يومين بعد العدوى، وإنتاج الفيريون كميا من قبل رديولبلد RT الفحص. ادراج مختلف النوع الفرعي C الجينات المستمدة هفوة يمكن أن يكون لها تأثير كبير على قدرة تكرار MJ4. وتدل البرية من نوع تكرار MJ4 باللون الأحمر.

الرقم 6
الرقم 6. مقارنة الاختلاف داخل الفحص في الناسخ العكسي رديولبلد (RT) فحص الكمي. الرسم يصور تقلب المتأصل داخل فحص من قبل المتهم بالتآمر في القيم DLU من نفس supernatants من النوع البري العدوى MJ4 واحد في ثمانية RT فحص مختلف لوحات. التباين في المنحنيات يعكس تغييرات طفيفة في حجم إشارة الرهانلوحات وين، والتي يمكن تصحيحها عن طريق تشغيل المعيار على كل لوحة RT، والتي يمكن استخدامها في وقت لاحق لتطبيع منحدرات الوهم الكمامة-MJ4 يعاير على نفس اللوحة.

الرقم 7
الرقم 7. استنساخ للمقايسة تكرارها على مر الزمن في خط الخلية GXR25. واستخدمت نفس الفيروسات خيالية الكمامة-MJ4 لتصيب خلايا GXR25 في تجربتين مستقلة أجريت حوالي سنة واحدة على حدة. تم إنشاؤها عشرات النسخ المتماثل حساب انحدار القيم DLU-حولت سجل وتطبيع المنحدر إلى أن من النوع البري MJ4. الوهم-MJ4 أسكت التي تحاكي أكثر كفاءة من النوع البري MJ4 بها عشرات تكرار أكبر من 1، وتلك التي تحاكي أقل كفاءة من النوع البري MJ4 ديك عشرات تكرار أقل من 1. ترتبط القياسات المستقلتين بقوة ( R 2 = 0.87، الانحدار الخطي) وتسليط الضوء على استنساخ فحوصات أجريت في أوقات مختلفة ومع الخلايا في مقاطع مختلفة.

A)

كاشف حجم رد الفعل ل1X (ميكرولتر)
2X رد فعل ميكس (إينفيتروجن) 25
nuclease خالية H 2 O 17
إلى الأمام التمهيدي GOF (20 ميكرومتر تركيز) 1
التمهيدي العكسي VifOR (20 تركيز ميكرومتر) 1
مرتفع الثالث خطوة واحدة أنزيم ميكس 1
قالب RNA 5
إجمالي حجم 50

B)

ف together.within الصفحات = "دائما" الحدود = "0" بطانة الخلايا = "0" CELLSPACING = "0">
عدد دورات الوقت (ساعة: دقيقة: ثانية) درجة الحرارة (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 ثانية / دورة 68
1 00:00 68
1 4
END

الجدول 1. A) مزيج الماجستير وB) هفوة التضخيم. * ملاحظة: تسلسل GOF التمهيدي: 5'-ATTTGACTAGCGGAGGCTAGAA-3. VifOR تسلسل التمهيدي: 5'-TTCTACGGAGACTCCATGACCC-3.

A)

كاشف حجم رد الفعل ل1X (ميكرولتر)
nuclease خالية H 2 O 35.5
5X Phusion HF العازلة 10
dNTPs (40 deoxynucleotides ملم) 1
التمهيدي إلى الأمام GagInnerF1 (20 تركيز ميكرومتر) 1
BclIDegRev2 التمهيدي العكسي (20 تركيز ميكرومتر) 1
Phusion حار البدء II البلمرة 0.5
أول جولة PCR كقالب 1
إجمالي حجم 50

B)

عدد دورات الوقت (ساعة: دقيقة: ثانية) درجة الحرارة (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
END

الجدول 2. A) مزيج الماجستير وB) الظروف thermocycler لمتداخلة في الدور الثاني التضخيم هفوة. * NOTE: GagInnerF1 تسلسل التمهيدي: 5'-AGGCTAGAAGGAGAGAGATG-3. BclIDegRev2 تسلسل التمهيدي: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3.

A)

كاشف حجم رد الفعل ل1X (ميكرولتر)
nuclease خالية H 2 O 35.5
5X Phusion HF العازلة 10
dNTPs (40 deoxynucleotides ملم) 1
التمهيدي إلى الأمام MJ4For1b (20 تركيز ميكرومتر) 1
MJ4Rev التمهيدي العكسي (20 تركيز ميكرومتر) 1
Phusion حار البدء II البلمرة 0.5
MJ4 بلازميد كقالب (10 نانوغرام / UL) 1
إجمالي حجم 50

B)

عدد دورات الوقت (ساعة: دقيقة: ثانية) درجة الحرارة (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
END

الجدول 3. A) مزيج الماجستير وB) الظروف thermocycler لمدة 5 "MJ4 LTR التضخيم. * ملاحظة: تسلسل MJ4For1b التمهيدي: 5'-CGAAATCGGCAAAATCCC-3. MJ4Rev تسلسل التمهيدي: 5 '-CCCATCTCTCTCCTTCTAGC-3.

A)

كاشف حجم رد الفعل ل1X (ميكرولتر)
nuclease خالية H 2 O 34.5
5X Phusion HF العازلة 10
dNTPs (40 deoxynucleotides ملم) 1
التمهيدي إلى الأمام MJ4For1b (20 تركيز ميكرومتر) 1
BclIRev التمهيدي العكسي (20 تركيز ميكرومتر) 1
MJ4 LTR 1.3 كيلوبايت amplicon (جل النقى ~ 50 نانوغرام) 1
Phusion حار البدء II البلمرة 0.5
amplicon هفوة (جل تنقيته، ~ 100 نانوغرام) 1
إجمالي حجم 50

B)

عدد دورات الوقت (ساعة: دقيقة: ثانية) درجة الحرارة (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
END

الجدول 4. A) مزيج الماجستير وB) الظروف thermocycler للصق-التداخل تمديد PCR لتوليد LTR- إدراج هفوة. * ملاحظة: تسلسل BclIRev التمهيدي: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 "

A)

كاشف حجم رد الفعل ل1X (ميكرولتر) فترة حضانة (الموارد البشرية) حضانة درجة الحرارة (° C)
1.5 ميكروغرام من 3 كيلوبايت LTR- هفوة أو amplicon MJ4 بلازميد س ميكرولتر 1.5 ميكروغرام
NEB CutSmart العازلة (سابقا NEB العازلة # 4) 2
BclI انزيم التقييد 1
nuclease خالية H 2 O س
إجمالي حجم 19 1.5 50
NgoMIV انزيم التقييد 1
إجمالي حجم 20 1 37

B)

كاشف حجم رد الفعل ل1X (ميكرولتر) فترة حضانة (الموارد البشرية) حضانة درجة الحرارة (° C)
50 نانوغرام قطع MJ4 ناقلات بلازميد س ميكرولتر لمدة 50 نانوغرام
45 نانوغرام قطع LTR- هفوة إدراج (3: 1 نسبة) س ميكرولتر لمدة 45 نانوغرام
روش 10X العازلة يغاز 2
روش T4 يغاز الحمض النووي (5 U / ميكرولتر) 1
nuclease خالية H 2 O
إجمالي حجم 20 18+ (بين عشية وضحاها) 4

C)

كاشف حجم رد الفعل ل1X (ميكرولتر) فترة حضانة (الموارد البشرية) حضانة درجة الحرارة (° C)
450 نانوغرام من الكمامة-MJ4 بلازميد س ميكرولتر عن 450 نانوغرام
NEB CutSmart العازلة (سابقا NEB العازلة # 4) 2
NgoMIV انزيم التقييد 0.5
انفلونزا الطيور انزيم التقييد 0.5
nuclease خالية H 2 O س
إجمالي حجم 20 2 37

الجدول 5. A) تقييد هضم مزيج الرئيسي وB) رد فعل لربط جيل من طليعة الفيروس خيالية الكمامة-MJ4. C) تقييد التشخيص هضم لضمان GAG-MJ4 استنساخ الإخلاص.

اسم التمهيدي تسلسل النوكليوتيدات (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
REV3 GACAGGGCTATACATTCTTACTAT
REV1 AATTTTTCCAGCTCCCTGCTTGCCCA

الجدول 6. قائمة الاشعال التسلسل اللازمة لتأكيد 5 'LTR وتسلسل هفوة هوية الكمامة-MJ4 طليعة الفيروس خيالية.

حسنا و 8 فيروس ميكرولتر + 232 ميكرولتر 1٪ FBS في DMEM
حسنا B 80 ميكرولتر من حسنا A + 160 ميكرولتر 1٪ FBS في DMEM
حسنا C 80 ميكرولتر من حسنا B + 160 ميكرولتر 1٪ FBS في DMEM
حسنا D 80 ميكرولتر من حسنا C + 160 ميكرولتر 1٪ FBS في DMEM
حسنا E 80 ميكرولتر من حسنا D + 160 ميكرولتر 1٪ FBS في DMEM
حسنا F 80 ميكرولتر من حسنا E + 160 ميكرولتر 1٪ FBS في DMEM

الجدول 7. مخطط التخفيف (3-أضعاف) لtitering الفيروسات المعدية على الخلايا TZM از.

A)

كاشف حجم
PBS دون الكالسيوم أو المغنيسيوم 2+ 2+ 500 مل
Gluteraldehyde 4 مل
الفورمالديهايد 11 مل

* ملاحظة: مخزن في 4 درجات مئوية.

B)

كاشف حجم
PBS دون الكالسيوم أو المغنيسيوم 2+ 2+ 4.75 مل
فيري سيانيد البوتاسيوم (0.2 M) 100 ميكرولتر
فيروسيانيد البوتاسيوم (0.2 M) 100 ميكرولتر
كلوريد المغنيسيوم (1 M) 20 ميكرولتر
X-غال (50 ملغ / مل) 40 ميكرولتر

* ملاحظة: تأكد الطازجة وتخزينها بعيدا عن الضوء حتى الاستخدام.


C.

الأصلي التخفيف جيدا و B C D E F
حجم فيروس (ميكرولتر) تضاف إلى آبار على التوالي 24 لوحة جيدا 5 1.6667 0.5556 0.1852 0.06173 0.02057

الجدول 8. A) وB) تحديد حلول لtitering من الفيروسات خيالية الكمامة-MJ4 على خط الخلية مؤشر-TZM الطوباوي C) حجم فيروس أضاف لكل بئر لحساب الوحدات المعدية / ميكرولتر.

كاشف حجم
مصل بقري جنيني (FBS)، الذي يعرف 55 مل
البنسلين، الستربتوميسين، الجلوتامين (100X) 6 مل
HEPES عازلة (1 M) 6 مل

الجدول 9. وصفة لكامل RPMI المتوسطة لانتشار الخلايا GXR25.

كاشف حجم (مل)
نوكليازH 2 O خالية 419.5
تريس، الكلور، ودرجة الحموضة 7.8 (1 M) 30
كلوريد البوتاسيوم (1 M) 37.5
كلوريد المغنيسيوم (1 M) 2.5
Nonidet P-40 (10٪) 5
EDTA (0.5 M) 1.02
Polyadenylic حامض وملح البوتاسيوم (2 ملغ / مل) 1.25
بنسبة ضئيلة من DT التمهيدي (25 ميكروغرام / مل) 3.25
إجمالي حجم 500

الجدول 10. صفة لرديولبلد العكسية الناسخ مزيج الرئيسي الفحص. * ملاحظة: مخزن ك 1 مل aliquots في -20 درجة مئوية.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

بسبب طول وطبيعة التقنية لهذا البروتوكول، وهناك العديد من الخطوات التي تعتبر بالغة الأهمية لكل من البناء الناجح خيالية البلازميدات الكمامة-MJ4 وكذلك لتقدير حجم القدرة تكاثر الفيروس. على الرغم من أن استراتيجية استنساخ انزيم التقييد استنادا لإدخال الجينات هفوة الأجانب إلى MJ4 المبينة في هذا البروتوكول ديها مزايا عديدة أكثر من الطرق المستخدمة سابقا إعادة التركيب القائم، يمكن للبروتوكول أن يكون تحديا تقنيا إذا لم يتم اتباع الخطوات الحاسمة على وجه التحديد.

أولا، من الضروري للغاية لاستخدام MJ4 بلازميد الحمض النووي التي تم إنشاؤها في السلالة البكتيرية المختصة تفتقر إلى DCM والسد methylases DNA. هذا أمر ضروري لأن النشاط الأنزيمي من تقييد نوكلياز داخلية BclI، والذي يستخدم لاستنساخ الجينات أسكت في العمود الفقري MJ4، هو سد / DCM مثيلة الحساس. وJM110 وSCS110 (وهو مشتق إندا السلبية JM110) E. سلالات القولونية وإعادة مناسبة لتوليد unmethylated الحمض النووي بلازميد MJ4. بالإضافة إلى ذلك، لاستئصال النواقل وإدراج العصابات، ويوصى بشدة أن الضوء إضاءة زرقاء استخدامها في التصور. وهذا سوف يقلل تعتمد على الطول الموجي للأشعة فوق البنفسجية الحمض النووي من التلف وبشكل كبير زيادة كفاءة الاستنساخ. إذا كان ضوء إضاءة زرقاء غير متوفرة، يمكن تعظيم الكفاءة من خلال وضع تصور استنساخ الحمض النووي DNA مع SYBR الآمن جل وصمة عار بدلا من بروميد إيثيديوم وتقليل زمن التعرض للأشعة فوق البنفسجية.

أخيرا، كان الاستنساخ الجزيئي مع كبير (> 10KB) و / أو البلازميدات فيروسات مثل MJ4 الصعب تقليديا لمجموعة متنوعة من الأسباب. البلازميدات كبيرة تقلل من كفاءة التحول من السلالات البكتيرية المختصة 42 بينما تدرج فيروسات، والتي تحتوي على تكرار محطة الطويلة (LTR) متواليات، والحد من استقرار البلازميد والتسوية تكرار الإخلاص من DNA البلازميد داخل المضيف البكتيري مما يؤدي إلى الحذف من جينوم فيروس 43 E. سلالة القولونية على سلالة DH5α، في أيدينا. بسبب الطبيعة غير المستقرة للالبلازميد، ينبغي دائما أن يتم التحقق منتجات تنقية البلازميد الصحيح لحجم البلازميد بواسطة انزيم الهضم قيود. هنا، هضم مزدوج مع NgoMIV وانفلونزا الطيور نوكليازات الاقتطاع الداخلية عند 37 درجة مئوية لمدة 2 ساعة.

مرة واحدة تم إنجازه الجيل الناجح خيالية البلازميدات الكمامة-MJ4، يتم إنشاء الفيروسات عبر ترنسفكأيشن من 293T خلايا، titered على خط مؤشر الخلية، وخلايا TZM-BL، والقدرة على تكرار يقاس باستخدام خط الخلايا التائية استنادا CEM. خط الخلية GXR25 استنادا CEM-المستخدمة في هذه الدراسات تكرار هو واحد من عدد قليل T إنشاء خطوط الخلايا قادرة على دعم الدخول وتكرار سلالات CCR5 مدار HIV-1. وقد تحقق ذلك من خلال تنبيغ فيروسات للسماح التعبير مستقر من CCR5 البشري 37. هذا خط خلية يعبر بشكل طبيعي CXCR4 وستدعم تكرار CXCR4-مدار HIV-1، مثل سلالة تكييفها مختبر NL4-3. ومع ذلك، من أجل دعم تكرار كفاءة سلالات CCR5 استوائية، مثل MJ4، لا بد من نشر الخلايا GXR25 مدة لا تقل عن 4 أشهر قبل العدوى. صحيح الثقافات passaged يمكن أن تدعم التكرار حتى بعد الركض لمدة تصل إلى 1 سنة. الرصد الدقيق لتكرار CCR5-مدار الركض طوال ضروري للتجارب الناجحة.

كما هو الحال مع أي تقنية، وهناك قيود للمحترفينtocol التي يجب مراعاتها. ونظرا لموقع من مواقع التقييد في البلازميد MJ4 فضلا عن توافر المواقع المحفوظة في تقييد طبيعيا HIV-1 العزلات، 3 'الموقع تقييد البعيدة، BclI، يقع 137 النيوكليوتيدات من رامزة توقف هفوة. على الرغم من أن يولد هذا الجين البروتيني خيالية، وهذه المنطقة هي 96.5٪ المحفوظة في هذا الفوج، ونحن لم نلاحظ وفرة من الفيروسات خيالية الميتة أو المعيبة.

واحدة من المزايا من استخدام MJ4 النوع الفرعي C استنساخ الجزيئية المعدية مع النوع الفرعي C تسلسل المستمدة هو أنه يقلل من خطر الاقتران بين الجينات الجين الأمثل هفوة وناقلات العمود الفقري لأنواع فرعية مختلفة. ومع ذلك، فإن كمية معينة من التنوع داخل كليد موجود كما يتضح من تجميع HIV-1 تسلسل حسب البلد أو المنطقة حتى عندما وجدت داخل نفس النوع الفرعي 31. هذا يمكن أن تسهم في الاقتران الأمثل بين الجينات هفوة ديرived من الزامبيين المصابة تماما وMJ4 المعدية العمود الفقري استنساخ الجزيئية، والتي كانت مستمدة من فرد وإصابة مزمنة من بوتسوانا 38. ومع ذلك، أنتجت أغلبية يبني تحليل فيروس ذرية المعدية. كما يختلف HIV-1 النوع الفرعي C استنساخ الجزيئية المعدية تصبح متاحة على نطاق أوسع، سيكون من المهم مواصلة التحقق من صحة هذا النظام في استنساخ هذه الجينات هفوة HIV-1 كليد C في العمود الفقرى الأخرى من أجل ضمان وجود الحد الأدنى من وجود تحيز بسبب قدم لعدم التوافق العمود الفقري.

خط الخلية GXR25 هو خط خلية فريدة من نوعها، وتحديدا بسبب قدرته على دعم كل CXCR4 وسلالات CCR5 استوائية ولها HIV-1 GFP محرض مراسل 37. ومع ذلك، توجد بعض القيود وينبغي النظر فيها بعناية قبل استخدام هذا الخط خلية للتجارب مقتبسة من هذا البروتوكول. لا يظهر خط الخلية GXR25 لدعم دخول أغلبية النوع الفرعي C أو A، CCR5-الاستوائية، والعلاقات العامةimary العزلات اختبرناها. بالإضافة إلى ذلك، الوالد خط الخلية CEM الذي تم اشتقاق خط الخلية GXR25 المعارض مستويات عالية من cyclophilin A، يصل إلى 2 إلى 4 أضعاف أعلى التعبير من خط الخلية Jurkat 44. نظرا لمستويات عالية من cyclophilin A، الخلل تكرار ترتبط عادة مع الكنسي HLA-B * 57 المرتبطة الهروب الطفرة، T242N، وهو ما يرجع إلى قدرة انخفضت من قفيصة لربط cyclophilin A، لا يمكن الكشف عنها بسهولة في هذا الخط خلية معينة 25. وبالتالي فإن خط الخلية GXR25 استنادا CEM-ليست مثالية لدراسة العيوب المرتبطة تكرار الطفرات في HIV-1 قفيصة ملزم cyclophilin حلقة.

أخيرا، في حين أن هذا البروتوكول هو مثالي لتحليل القدرة تكرار متواليات هفوة المستمدة من النقاط الزمنية الحادة، يجب أن يتم إدخال تعديلات من أجل دراسة القدرة تكرار إسكات الجينات المستمدة من المصابين المزمنين. هذا البروتوكول يتضمن صباحاplification من متواليات السكان من النقاط الزمنية الحادة (متوسط ​​45 يوما من تاريخ الإعلان العدوى مقدرة) عندما التنوع الفيروسي محدودة. الجين هفوة من كل الوهم وثم متسلسلة وبالمقارنة مع السكان الأولي PCR amplicon لضمان استنساخ الإخلاص. نظرا لتنوع تسلسل محدود في نقاط زمنية الحادة، استنساخ من المنتجات PCR السكان غير ممكن. ومع ذلك، يوجد تنوع تسلسل داخل quasispecies الفيروسية من شخص مصاب مزمن. لذا، من أجل تقييم دقيق لقدرة تكرار quasispecies المزمنة، يجب أن توظف التضخيم الجينوم واحد لالتقاط عدة بدائل تمثيلية. ثم يجب أن يعاير كل من هذه المتغيرات لفي المختبر النسخ المتماثل.

هذه التقنية لديها العديد من التطبيقات الأوسع، والتي تنبع من مزاياه أكثر الأساليب القائمة. منذ هذه العملية يؤدي إلى تكرار البلازميد المختصة النسيلي، هو بسيط لاستخدام بنيات للمتر إضافيدراسات utagenesis، التي يمكن أن تساعد على توضيح مساهمات بقايا محددة لتكاثر الفيروس. وعلاوة على ذلك، من خلال استنساخ الجينات في هفوة من النقاط الزمنية الطولية، ويمكن للمرء أن تقييم تطور قدرة تكاثر الفيروس مع مرور الوقت وكيف يمكن أن تؤثر هذه التغيرات المرضية في HIV-1 فرد المصاب.

يمكن تعديل هذه التقنية من أجل توسيع فائدته لمختلف التطبيقات. يمكن هندستها HIV-1 البروتينات الفيروسية إضافية في البلازميد MJ4 من أجل تقييم آثارها على تكاثر الفيروس أو تفاعلاتها مع بروتينات المضيف. ويمكن تحقيق ذلك عن طريق الهندسة المواقع قيود إضافية على المناطق المرغوبة في جينوم من خلال إدخال تغييرات النوكليوتيدات الصامتة. ومع ذلك، يجب اتخاذ عناية خاصة عندما هندسة تقييد مواقع جديدة في "نصف 3 من الجينوم HIV-1 يتم ترميز العديد من البروتينات التبعي في إطارات قراءة بديلة، والتغيرات في واحدة صامتةالبروتين يمكن أن يؤدي إلى استبدال الحمض الأميني في بلد آخر. في هذا المثال، الموقع تقييد أساليب الاستنساخ مستقلة مثل تلك التي نوقشت من قبل دادلي وآخرون 45 قد تجاوز هذا القيد. تسلسل الفيروسي المستمدة من مجموعات سكانية مختلفة قد يكون نطاقات متفاوتة من قدرات التكرار، وزارة الداخلية يمكن تعديلها وفقا لذلك من أجل القبض على معظم العزلات الفيروسية في مرحلة لوغاريتمي نموها. أخيرا، تم خط الخلية GXR25 ستابلي مع GFP تحت LTR يحركها، والمروج تات-محرض، ويمكن قياس انتشار الفيروس بوصفها وظيفة من خلايا إيجابية GFP عبر التدفق الخلوي 37 كبديل للفحص RT الموصوفة هنا أو وP24 التقليدي ELISA.

في الختام، يوفر هذا البروتوكول تقنية فعالة وقوية لتقييم HIV-1 تكاثر الفيروس والتي يمنحها هذا الجين هفوة، الذي يشفر بروتين الهيكلي الحفظ اللازمة لتشكيل الفيريون السليم، في مهدها، والنضج، والتفكيك 46-48. وعلاوة على ذلك، فإن هذا الأسلوب يولد تكرار البلازميد النسيلي المختص، والذي يعتبر مثاليا للدراسات الطفرات، وبالتالي، توفر وسيلة لتوضيح المحددات الأحماض الأمينية محددة من اللياقة البدنية الفيروسية. دراسات مثل هذه أمر لا بد منه لتعزيز فهم كيفية تأثير التطور الفيروسي مدفوعة المناعة المرضية وتطور المرض في HIV-1 الأفراد المصابين.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
تقييد أنزيم الاستنساخ القائم على أسلوب لتقييم<em&gt; في المختبر</em&gt; القدرة تكرار HIV-1 النوع الفرعي C-الكمامة MJ4 همي الفيروسات
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter