Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Een restrictie-enzym Based Klonen Methode om de Beoordelen doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Om zowel de gastheer en virale kenmerken die invloed HIV-1 pathogenese en progressie van het grootste belang voor rationeel vaccinontwerp. De cellulaire immuunreactie is een belangrijk onderdeel van de menselijke immune reactie op HIV-1 infectie. Cytotoxische T lymfocyten (CTL) zijn nodig voor de eerste controle van acute viremie en laat de host een steady state (set point) viral load 1,2 vestigen. Experimentele depletie van deze effectorcellen leidt tot verlies van virale controle 3,4. Ondanks dit, ontsnappen mutaties ontstaan ​​binnen het virale genoom dat CTL erkenning van viraal geïnfecteerde cellen 5-9 ondermijnen.

Bepaalde HLA allelen zijn geassocieerd met lagere virale lading en tragere progressie van de ziekte zoals B * 57 B * 27 B * 81 en 10-15. Een deel van het beschermende voordeel van HLA klasse I allelen kan worden toegeschreven aan het feit dat ze gericht functioneel beperkte gebieden van het genoom, zoals Gagen selecteren op ontsnappingsmutaties dat het vermogen van het virus om te repliceren in vitro 16-21 verminderen. Hoewel ontsnapping van het cellulaire immuunsysteem is gunstig voor het virus in de context van de selectie HLA klasse I allel, kan het effect van deze mutaties differentiële gevolgen voor de ontvangende upon overbrenging moet een HLA-mismatch individuele 22,23. Daarom is het begrijpen van de effecten van de verzonden-HLA geassocieerd escape mutaties op de virale replicatie capaciteit zal belangrijk zijn om ons begrip van vroege HIV-1 pathogenese bevorderen.

Hoewel er veel vooruitgang is geboekt bij de fitness gebreken van afzonderlijke escape mutaties geassocieerd met specifieke HLA klasse I allelen 24-29 te identificeren en te karakteriseren, natuurlijk voorkomende HIV-1 isolaten zijn unieke en complexe voetafdrukken van HLA-geassocieerde polymorfismen, waarschijnlijk als gevolg van het HLA gemedieerde immuun druk van verschillende immunogenetische achtergronden 30. In apet bestaan ​​analyse Goepfert et al. blijkt dat een accumulatie van HLA-geassocieerde mutaties in het uitgezonden Gag sequenties afgeleid van 88 acuut geïnfecteerde Zambians werd geassocieerd met een vermindering instelling viral load 31. Dit suggereerde dat de overdracht van schadelijke ontsnappingsmutaties, specifiek Gag, HLA-mismatch ontvangers verschaft een klinisch voordeel en kan het gevolg zijn van virale replicatie verzwakt. Moving forward, is het noodzakelijk om te bestuderen hoe complexe combinaties van Gag polymorfismen binnen natuurlijk voorkomende isolaten werken in overleg met de kenmerken van de uitgezonden virus zoals replicatie capaciteit, en hoe vroeg replicatie kunnen op hun beurt van invloed op HIV-1 klinische parameters en de late-fase definiëren pathogenese.

Brockman et al. Eerst een verband tussen de replicatie capaciteit van gag-pro sequenties geïsoleerd tijdens de chronische fase infectie en virale lading in zowel subtype C en B-infecties aangetoond32-35. De experimentele benadering gepresenteerd in deze studies, hoewel geschikt voor de behandeling van in vitro replicatie aantal sequenties, verkregen uit chronisch geïnfecteerde individuen, heeft verschillende technische restricties en beperkingen maken het bestuderen van HIV-1 replicatie capaciteit subtype C acuut geïnfecteerde individuen moeilijk. Deze werkwijze berust op de recombinatie van populatiegebaseerde PCR-geamplificeerde sequenties in de subtype B NL4-3 provirus, dat gedeeltelijk afgeleid van LAV, een laboratorium aangepaste virus stock 36. Virusproductie werd bewerkstelligd door co-transfectie van een CEM-gebaseerde T-cellijn 37 met PCR amplicons en gedigereerd delta gag-pro NL4-3 DNA. Deze methode vereist de uitgroei van virus gedurende weken tot maanden, eventueel vertekening de aard van het teruggewonnen virus stock betrekking tot de virale quasispecies in vivo, en derhalve het veranderen van de meting van replicatie capaciteit in vitro. Deze methode is meer geschikt voor het bestuderen van chronisch geïnfecteerde individuen, waar het effectief kiest voor virus met de hoogste replicatieve capaciteit, en wanneer kloneren tal verschillende virale varianten van een groot aantal chronisch geïnfecteerde individuen is vrij arbeidsintensief en derhalve nog niet. Echter, in een acuut geïnfecteerde individu er doorgaans 01:59 varianten aanwezig, en zo het risico van vertekening de aard van het teruggewonnen virus stock elimineren, door in vitro selectie drukken, zorgt voor een nauwkeurigere bepaling van de in vitro replicatie capaciteit. Tweede methode vereist recombineren subtype C gag-pro-sequenties in een subtype B afgeleide ruggengraat en kan backbone onverenigbaarheid biases in de analyse introduceren. Vanwege deze beperkingen moeten grote aantallen sequenties worden geanalyseerd om mogelijke vertekeningen ingevoerd overwinnen.

Hier beschrijven we een alternatieve experimentele voorkomendach geschikt voor het bestuderen van sequenties afgeleid van subtype C acuut geïnfecteerde individuen. We gebruiken een restrictie-enzym gebaseerde klonering strategie het gag gen afgeleid van acute infectie tijdstippen van HIV-1 subtype C geïnfecteerde individuen in het subtype C provirale backbone, MJ4 voeren. Het gebruik van MJ4 als gemeenschappelijke backbone waarin gag genen kloneren cruciaal voor de analyse van het subtype C afgeleide sequenties. MJ4 is afgeleid van een primair isolaat 38, en zou dus minder waarschijnlijk vertekening door subtype incompatibiliteit tussen de hoofdketen en gag gen. Bovendien is de benadering van het gebruik van restrictie-enzymen gebaseerde klonering maakt de provirale constructen rechtstreeks in 293T-cellen worden getransfecteerd, en voor het herstel van een klonale virus stock identiek aan de gekloneerde sequentie gag.

De methode hieronder weergegeven is een high throughput methode voor het beoordelen van de replicatie capaciteit van subtype C afgeleid Gag-MJ4chimère virussen. Transfectie in 293T-cellen is eenvoudig en terugwinning van virus duurt slechts drie dagen. In vitro replicatie capaciteit getest op dezelfde CEM-CCR5 gebaseerde T-cellijn door Brockman e.a.. 37, maar met belangrijke protocol aanpassingen noodzakelijk voor een succesvolle replicatie subtype C MJ4 chimere virussen. Het gebruik van een geschikte T-cellijn plaats PBMC maakt grote aantallen subtype C MJ4-chimere virussen te testen met hoge assay reproduceerbaarheid. Ten slotte, wordt een radioactief reverse transcriptase assay voor het kwantificeren van virus in het supernatant kosteneffectiever dan met commercieel verkrijgbare p24 ELISA kits. Het geeft ook een hoger dynamisch bereik, die belangrijk zijn voor het detecteren zowel slecht en zeer replicerende virussen binnen dezelfde assay en voor het detecteren van subtiele verschillen in replicatie tussen isolaten.

De conclusie is dat de hier gepresenteerde methode toegestaan ​​voorde grondige studie van de replicatie capaciteit van gag sequenties afgeleid van HIV-1 subtype C acuut geïnfecteerde individuen uit Zambia, en zoals geschreven, kan ook worden uitgebreid naar andere subtype C geïnfecteerde populatie te bestuderen. Een hoge mate van variatie in replicatie capaciteit tussen verschillende Gag isolaten waargenomen. Daarnaast konden we een statistisch verband tussen de replicatie capaciteit van het verzonden Gag en setpoint viral load als met CD4 + daling vertonen gedurende een periode van drie jaar 39. Dergelijke resultaten benadrukken het belang van het bestuderen van hoe doorgelaten virale kenmerken, zoals replicatie capaciteit, interactie met de gastheer immuunsysteem pathogenese beïnvloeden tijdens de vroege infectie en integraal voor het ontwikkelen van effectieve interventies vaccin evenals de behandeling zal zijn.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Versterking van de HIV-1 gag Gene uit Infected, Frozen Plasma

  1. Uittreksel viraal RNA in 140 gl ontdooid HIV-1 geïnfecteerde plasma middels een extractie kit.
    1. Indien haalbaar, onmiddellijk overgaan tot cDNA-synthese na RNA-extractie als onbevroren viraal RNA levert de beste versterking resultaten. Indien mogelijk ingesteld PCR Master Mix voor de eerste ronde van DNA amplificatie en bewaar bij 4 ° C voordat viraal RNA extractie.
  2. Reverse transcriptie-cDNA uit RNA en amplificeren eerste ronde DNA producten middels reverse-transcriptase en een thermostabiel DNA polymerase in een eenstaps RT-PCR.
    1. Neem RNA van -80 ° C vriezer (als bevriezing nodig was) en even ontdooien bij kamertemperatuur en breng vervolgens in koud blok. Breng 5 ul van RNA aan elke PCR buis die 45 gl master mix tot een eindvolume van 50 pi geven. Onmiddellijk plaatst resterende RNA monsters in -80 ° C vriezer.
    2. Na enzym eenT OEGEVOEGDE de eerste ronde PCR Master Mix (tabel 1A), 45 pi aliquot in elk dunwandige PCR amplificatie buis voor het aantal gewenste reacties. Zorg ervoor dat PCR-buisjes met individuele caps te gebruiken en niet te strippen caps minimale kruisbesmetting tussen de monsters te garanderen. Plaats PCR buizen in een koud blok naar de temperatuurgevoelige RT enzym RNA template beschermen. Opmerking: De monsters moeten worden uitgevoerd in drievoud om adequaat te proeven van de virale quasispecies. Het is ook belangrijk om een ​​product met een high fidelity DNA polymerase-enzym te gebruiken om PCR geïntroduceerd verkeerde incorporatie minimaliseren. Verwijzen wij u naar de lijst met reagentia voor het aanbevolen product.
    3. Na RNA template is toegevoegd aan alle reageerbuizen, transfer PCR buizen een thermocycler voor amplificatie met het cyclusprogramma in Tabel 1B beschreven. Opmerking: Het product van de amplificatie wordt gebruikt in een tweede ronde geneste PCR.
  3. Voer een geneste second-round PCR amplificatie met 1 pl van de eerste ronde PCR-amplificatie (1.2) als DNA-matrijs.
    1. Aliquot 49 ul van tweede-ronde-PCR master mix (tabel 2A) aan elke dunwandige PCR-buis voor het aantal reacties gewenst. Breng 1 pl van de eerste ronde PCR amplificatie aan elke reactiebuis een eindvolume van 50 pi geven. Opmerking: Dit zal als template DNA te dienen voor de tweede-ronde versterking. Het is ook belangrijk om een ​​DNA polymerase met een zeer hoge betrouwbaarheid en proeflezen mogelijkheden benutten om PCR geïntroduceerd verkeerde incorporatie minimaliseren. Verwijzen wij u naar de lijst met reagentia voor het aanbevolen product.
    2. Transfer tweede ronde PCR-mix te thermocyclusinrichting en run-programma in Tabel 2B beschreven. Opmerking: Na voltooiing van het programma, de producten van deze reactie worden uitgevoerd op een agarose gel om de productie van het product te bevestigen.
  4. Voeg 3 ul 5x loading dye 5 & #181, l 50 gl tweede ronde reactievolume en draaien met 120 V op een 1% agarose TAE-gel bevattende een UV-fluorescerende DNA vlek tot banden worden opgelost. Visualiseer 1,6 kb banden op een blauw licht verlichting (zie figuur 1A).
  5. Voer de resterende 45 pl reactievolume op een 1% agarose TAE-gel die een DNA vlek en uitsnijden passende banden met een schoon scheermesje.
    1. Extraheer DNA uit de gel slice met een gel zuiveringskit, elueren in nuclease-vrij water, combineer drie positieve reacties per individu en product invriezen bij -20 ° C voor later gebruik.

2 Voorbereiding gag Amplicons voor Klonen door invoeren van de nodige beperking Sites

  1. Versterken de Long Terminal Repeat (LTR) / 5 'UTR gedeelte van de MJ4 plasmide (zie tabel 3).
  2. Visualiseer 1,3 kb PCR-producten op verlichting, accijnzen positieve amplicons, gel zuiveren en zoals eerder bevriezenbeschreven (1.4,1.5 zie figuur 1B).
  3. Maak gesmolten MJ4 LTR- gag ampliconen via "splice-overlap-extensie" PCR (zie tabel 4).
  4. Visualiseren, accijnzen, te zuiveren, en vries het 3,2 kb ampliconen als in 1.4,1.5 (zie figuur 1C).

3 Klonen Amplified gag Genen in de MJ4, Subtype C, Infectious Molecular Clone

  1. Digest 1.5 ug MJ4 plasmide en 1,5 ug gezuiverd LTR- gag PCR product met BclI (methylering gevoelige) restrictie-endonuclease gedurende 1,5 uur bij 50 ° C (zie Tabel 5A).
  2. Voeg 1 ul van NgoMIV de digestie reactie en incubeer bij 37 ° C gedurende 1 uur.
  3. Voeg 5x loading kleurstof restrictiedigestie reacties en langzaam Electrophorèse het totale volume op een 1% agarose TAE-gel die een DNA gel kleuring voor 1-2 uur bij 100 V. zichtbaar, accijns en zuiveren deze banden voor klonering zoals eerder described (zie figuur 2).
  4. Bereid ligatiereacties met gezuiverd LTR- gag insert en MJ4 vector-DNA bij een 3: 1 insert naar vector verhouding. Ligatiereacties Incubeer overnacht bij 4 ° C (zie Tabel 5B).
  5. Transformeren JM109 chemisch competente bacteriën ligatieproducten en uitgespreid op LB agar platen met 100 ug / ml ampicilline en groei bij 30 ° C voor 22 + uur.
    1. Dooi JM109 competente cellen op ijs gedurende 15 minuten. Label 1.5 ml microcentrifugebuizen en chill op ijs.
    2. Aliquot 50-100 ul van JM109 cellen pre-gekoelde 1,5 ml microcentrifugebuizen. Voeg 2,5-5 pi ligatie reactie op JM109 cellen, flicking buis licht te mengen en onmiddellijk terug te keren naar het ijs. Incubeer competente cellen met ligatieproduct op ijs gedurende 30 minuten.
    3. Heat shock 1,5 ml microcentrifuge buisjes die JM109 competente cellen en ligatie reactie in een 42 ° C warmteblok gedurende 45 seconden en terugkeren naar ijs gedurende ten minste 3 minuten.
    4. Voeg 50 pl SOC media aan elke microcentrifugebuis en plaat het gehele transformatie reactiemengsel op kamertemperatuur LB-agarplaten gesupplementeerd met 100 ug / ml ampicilline.
    5. Overdrachtsplaten tot een 30 ° C incubator gedurende 20 uur, of totdat kolonies duidelijk gevormd.
  6. Extra geïsoleerde kolonies en groeien in 4 ml LB met 100 ug / ml ampicilline bij 30 ° C voor 22 + uur.
  7. Spin down kweken bij 3200 xg gedurende 15 min, giet bouillon, en plasmide-DNA te extraheren.
  8. Om te bevestigen klonen trouw miniprep DNA geknipt met HpaI en NgoMIV restrictie-enzymen in een dubbel digest bij 37 ° C gedurende 2 uur. Analyseer op 1% agarose-TAE gel (zie tabel 5C).
  9. Type de LTR-gag insertgebied van elk plasmide met de volgende primers: GagInnerF1, GagF2, Rev1, Rev3 en GagR6 (Tabel 6) sequentie identiteit te bevestigen.
  10. Vergelijk de gekloonde sequenties die zijn verkregen met de bevolking sequenties derived van de eerste gezuiverde amplicon van 1.5.1. Opmerking: Het is belangrijk de replicatie capaciteit van twee onafhankelijke klonen om uiteindelijk na te zorgen dat de in vitro replicatie fenotypes niet door backbone fouten die tijdens het klonen.

4 Generatie en titering replicatiecompetent Gag-MJ4 Chimeric Virussen

  1. Genereer replicatie competent virus door transfecteren 1,5 ug van het chimere plasmide MJ4 miniprep DNA in 293T-cellen met een 4: 1 verhouding van Fugene HD zoals beschreven door Prince c.s. 39.
  2. Titer geoogst virusvoorraden op TZM-bl cellen zoals beschreven hieronder en in Prins et al 39.
    1. Plate TZM-bl cellen 24 uur vóór infectie met virus om een ​​30-40% confluente monolayer van cellen op de volgende dag. Dit kan gewoonlijk worden bereikt door toevoeging van 5 x 10 4 cellen in een totaal volume van 800 ul per putje in een 24-well plaat.
    2. Na het toevoegen van cellen om het goed, beweeg de 24-well plaat naar voren en weer terug, dan van links naar rechts om de cellen efficiënt te distribueren. Nooit swirl - dit zal resulteren in cellen ophopen in het midden van de plaat.
    3. De volgende dag, bereid 1% FBS in DMEM; deze wordt gebruikt om verdunnen DEAE-dextraan en virusvoorraden verdunnen. De DEAE-Dextran is 10 mg / ml of 125x, en een uiteindelijke concentratie van 80 ug / ml of 1x gewenst.
    4. Neem virus voorraad te testen van -80 ° C vriezer en plaats op shaker te ontdooien op kamertemperatuur.
    5. Met behulp van een multichannel pipet, serieel verdund virus voorraden in een ronde bodem weefselkweek behandelde plaat met 96 putjes met deksel. Dit is een 3-voudige verdunning protocol. Zie tabel 7 voor de verdunning regeling.
    6. Verwijder het afdrukmateriaal uit gezaaid TZM-bl 24-well platen met behulp van een vacuüm aspirator zorg ervoor celmonolaag niet te verstoren. Verwijder het medium Slechts van een 24-well plaat op een moment, zodat cellenniet uitdrogen.
    7. Voeg 150 ul van 1 x DEAE-Dextran + 1% FBS in DMEM mengsel aan elk putje met een 1.000 III pipet. Gebruik geen herhaling pipet als dit verstoort de monolaag.
    8. Voeg 150 pi van elke virusverdunning de juiste goed. Virus In het midden van het putje en schud zachtjes gelijkmatig verdelen virus in de cel monolaag. Incubeer geïnfecteerde cellen gedurende 2 uur in een weefselkweek incubator bij 37 ° C en 5% CO2.
    9. Na 2 uur incubatie wordt 0,5 ml 10% FBS in DMEM aan elk putje en platen incubator keren nog eens 48 uur.
    10. Na 48 uur moeten de cellen 100% confluent zijn. Omdat MJ4 is een replicatie competent virus, zal er enige celdood, maar dit is te verwachten.
    11. Verwijder het afdrukmateriaal uit elk putje en voeg 400 ul / putje van de vaststelling oplossing (zie tabel 8A voor recept). Fix slechts een plaat tegelijk. Voeg fixeeroplossing met een 1.000 ul pipet en laat zitten voor 5 min bijkamertemperatuur.
    12. Verwijder fixeeroplossing en was 3x met PBS met Ca 2 + / Mg 2 +. Gebruik een spuitfles voorzichtig toevoegen PBS aan de zijkant van de put te verstoren de monolaag. Na de derde wasbeurt, vlek plaat droog op absorberend papier.
    13. Voeg 400 ul / putje kleuroplossing (zie Tabel 8B voor recept) aan elk putje van de 24-well plaat en incubeer bij 37 ° C gedurende ten minste 2 uur. Langere incubatietijd tijden zijn aanvaardbaar, maar incubatietijd moeten consistent tussen titering experimenten worden gehouden.
    14. Was 2x met PBS met Ca 2 + / Mg 2 + en scoren voor infectie, of voeg PBS en bewaar bij 4 ° C voor het scoren later. Platen kunnen bij 4 ° C bewaard tot vier dagen, zolang de monolaag gehydrateerd blijft.
    15. Om te scoren voor de infectie, gebruik maken van een permanent marker op putjes van de 24-well plaat verdelen in kwadranten. Tel alle blauwe cellen binnen een gezichtsveld, met een totale vergroting van 200X, eenmaal inelk van de vier kwadranten van een goed.
    16. Bereken infectieuze eenheden per ul als volgt: [(# blauwe cellen / 4) x 67] / (pi virus toegevoegd) = IE / ul. Zie Tabel 8C voor volume gl virus toegevoegd aan elk putje. Gemiddeld aantal putjes tezamen; de getallen moet betrekkelijk Vertaald een nauwkeurige titratie.

5 Voorbereiding van Cultuur Media en Voortplanting van GXR25 Cellen voor in vitro replicatie Assay

  1. Bereid compleet RPMI (cRPMI) voor de vermeerdering van GXR25 cellen. LET OP: Het is uiterst belangrijk om de cultuur GXR25 cellen ten minste 4 maanden voorafgaand aan de geplande replicatie-experimenten (zie tabel 9).
  2. Split cellen 1:10 twee keer per week en onderhouden celdichtheid van 1 x 05-2 oktober x 10 6 cellen / ml.

6 In vitro replicatie van Gag-MJ4 Hersenschimmen in GXR25 (CEM-CCR5-GFP) Cellen

  1. De dag voor de infection, splitsen cellen om een concentratie van 2-3 x 10 5 cellen / ml, zodat zij in logaritmische groei op de dag van de infectie.
  2. Op de dag van infectie te verwijderen virus voorraden van -80 ° C vriezer en ontdooien. Bereken de hoeveelheid virus die nodig is van elke stock volgens de IU / ul titer van TZM-bl cell assay om 5 x 10 5 GXR25 cellen te infecteren bij een multipliciteit van infectie van 0,05 met de volgende formule:
    Volume van het virus voor infectie (pi) = 1 pi / X IE x 0,05 x 500.000
    OPMERKING: We kiezen een MOI van 0,05 en resulteert in een logaritmische groeifase voor alle virussen die we hebben getest. Het is belangrijk initiële experimenten om de optimale MOI bepalen logaritmische groei vangen van het virus te testen.
  3. Verdun virus in cRPMI tot een volume van 100 ul (om een ​​0,05 MOI te bereiken) en voeg in een putje van een V-bodem weefselkweek behandelde plaat met 96 putjes. Opmerking: Omvat zowel een positive (MJ4 WT geïnfecteerde) en een negatieve (mock geïnfecteerde cellen) controle in elke set replicatie experimenten. Het opzetten van de plaat zodanig dat elke andere kolom is leeg om kruisbesmetting tussen de putten te beperken. De positieve controle is noodzakelijk, zoals later als een standaard worden gebruikt om de replicatie hellingen, die een maat is voor de replicatie snelheid van experimentele herhalingen zijn normaliseren.
  4. Telling GXR25 cellen middels een geautomatiseerde celtelinrichting. Bereken het aantal cellen nodig totaal voor alle virussen (5 x 10 5 x # infecties). Aliquot het gewenste volume in een 50 ml conische buis en gecentrifugeerd om cellen te pelleteren. Bereken altijd voor 25% meer infecties dan nodig is.
  5. Zuig media zorgvuldig en resuspendeer in cRPMI bij een concentratie van 5 x 10 5 cellen / 100 ul.
  6. Pipet cellen in een steriele bak en meng. Een multi-kanaal pipet 100 ul cellen in elk putje van de 96-well plaat met de verdunde virus. Mix grondig.
  7. Voeg 2 pl van 5 mg / ml (100x) oplossing van polybreen aan elke well en meng grondig cellen.
  8. Incubeer bij 37 ° C in weefselkweek incubator met 5% CO2 gedurende 3 uur.
  9. Om geïnfecteerde cellen te wassen, centrifuge 96-well V-bodemplaat cellen neer. Dan verwijder voorzichtig 150 pi van het medium en te vervangen door verse 150 ul van cRPMI zonder verstoring van de cel pellet. Herhaal 2 keer (inclusief centrifugatie) cellen voldoende wassen.
  10. Na de laatste centrifugatie en toevoeging van 150 ul cRPMI, resuspendeer de celpellet met een multichannel pipet en voeg de gehele cel / virus mengsel (ongeveer 200 pl) van elk putje afzonderlijk 800 gl cRPMI in een putje van een 24-well tissue kweekplaat.
  11. Place plaat in 5% CO 2 weefselkweek incubator bij 37 ° C.
  12. Elke twee dagen, verwijder 100 ul supernatant van buitenzijde kweekputje en overbrengen naar een 96-well U-Bottom plaat en opslag bevroren bij -80 ° C tot actief virus kwantificering assay. OPMERKING: Zorgvuldige regeling van supernatanten in 96-well platen zal voor multi-channel pipet overdracht van kweeksupernatanten tijdens virion kwantificering via een radioactief reverse transcriptase (RT) assay. Elke plaat moeten monsters uit een infectie standaard bevatten om inter-plaat variatie normaliseren in de RT-assay uitlezing.
  13. Na het verwijderen van elk 100 pl monster, split cellen 1: 2 grondig resuspenderen cellen en verwijderen helft van de resterende volume (450 pl). Herstel oorspronkelijke volume (1 ml) door toevoeging van 550 pl vers cRPMI aan elk putje.

7 Analyse van Reverse Transcriptase (RT) in celkweeksupernatanten

Protocol aangepast van Ostrowski et al 40.

  1. Opgezet biologische veiligheid kap in een BSL-3-faciliteit voor gebruik met radioactieve stoffen.
    1. Leg absorberend papier in hood en vervang aspirator voor aspirator aangewezen voor radioactieve gebruik. Opmerking: Alle radioactief afval moet goed worden afgevoerd met het volgens de veiligheidsvoorschriften.
  2. Voeg 1-2 ul van 10 mCi / ml [α- 33P] dTTP en 4 ui van 1 M dithiothreitol (DTT) aan elke 1 ml van RT master mix (zie tabel 10 en Ostrowski et al. 40).
  3. Meng zorgvuldig elk 1,5 ml microcentrifugebuisje van RT master mix, DTT, en [α- 33P] dTTP met een 1.000 ul pipet overgebracht in een steriele trog.
  4. Breng 25 pl gelabelde RT mengen in elke well van 96-well dunwandige PCR plaat. Opmerking: Inclusief ruimte voor een positieve controle (MJ4 WT infectie) en negatieve controle (Mock-infectie).
  5. Voeg 5 ul van elk supernatant van de PCR-plaat met de RT master mix.
  6. Verbinding PCR plaat met zelfklevende folie deksel en incubeer gedurende 2 uur bij 37 ° C in een thermocycler. Om veiligheidsredenen, rinse pipet tips met Amphyl en gooi tips in kleine container met Amphyl afval, die later zal worden vernietigd radioactief afval.
  7. Na incubatie kleine gaatjes in het folie deksel met een 200 ul multichannel pipet. Opmerking: Als pipetuiteinden raken vloeistof in goed, vervang tips voordat u naar de volgende kolom of rij.
  8. Mix monsters 5x en overdracht 5 ul van elk monster voor de DE-81 papier. Lucht drogen 10 minuten.
  9. Was blots 5x met 1x SSC (natriumchloride, natriumcitraat), en vervolgens 2x met 90% ethanol bij 5 min per wasbeurt. Laat drogen.
    1. Plaats elke vlek in een aparte container wassen, zoals een sandwich opbergdoos, voeg voldoende wasbuffer (1 x SSC en 90% EtOH) ter dekking blot en schud 5 minuten.
    2. Giet wasbuffer in aparte container en herhaal. Opmerking: De eerste 3 wast zijn radioactief beschouwd en moeten worden afgevoerd. De laatste 2 wasbeurten kan worden afgevoerd regelmatig.
  10. Eenmaal droog, autoefully wikkel blot in Saran wrap en blootstellen aan een phosphoscreen in een goed afgesloten cassette nacht bij kamertemperatuur geroerd.
  11. Analyseer phosphoscreens met een fosforimager en kwantificeren radioactieve transcripties.
  12. Teken een cirkel rond elke radioactieve signaal met behulp Optiquant software. De grafiek van de Digital Light Unit (EBA) waarden tot replicatie curves genereren.
  13. Om replicatiecapaciteit scores genereren DLU-waarden log 10 getransformeerde en hellingen werden berekend met het dag 2, 4 en 6 tijdstippen. Replicatie hellingen worden vervolgens gedeeld door de helling van de WT MJ4 om genereren replicatiecapaciteit scores. Het is belangrijk te normaliseren op basis van de MJ4 WT waarden verkregen uit dezelfde RT plaat intra-assay variatie verminderen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Om dit protocol, dat een proviraal plasmide in staat is het monteren van een volledig functionele, besmettelijke Gag-MJ4 hersenschimmen creëert goed uit te voeren, moet grote zorg worden genomen om de geschikte PCR amplicons genereren. Bepalen of de PCR de juiste maat gag amplicon heeft gegenereerd is cruciaal. Producten moeten binnen 100 basenparen (bp) van de ongeveer 1.700 bp amplicon weergegeven in figuur 1A. De exacte lengte van dit fragment is afhankelijk van het gag-gen onder studie. Vervolgens moet het 5 'long terminal repeat (LTR) gedeelte van de MJ4 moleculaire kloon worden geamplificeerd en gelast aan de gag amplicon om deze geschikt voor daaropvolgende klonering te maken. De MJ4 LTR amplicon moet 1.474 bp lang zijn. Een representatief beeld gel die correct bandgroottes aangegeven Figuur 1B toont. Na de splice-overlap-extensie PCR-41, moet gecombineerd LTR- gag producten zijnongeveer 3.200 bp lang, zoals in figuur 1C.

Zodra het gag gen geschikt gemaakt voor klonering door fusie met het 5'-LTR van MJ4, die de nodige NgoMIV restrictieplaats bevat, zowel vector en gag insert moet gedigereerd met BclI en NgoMIV restrictie-enzymen en uitgesneden uit een agarosegel na elektroforese scheiding. Het is noodzakelijk om de juiste vector en insert bands accijnzen. Een representatieve gel is weergegeven in figuur 2. Het vectordeel van het plasmide MJ4 moet ongeveer 10.000 bp lang zijn, terwijl de LTR- gag insert ongeveer 3000 bp lang moet blijven, omdat de restrictieplaatsen zijn bij de uiteinden van het amplicon. Elke aanzienlijke afname in omvang zal een extra cut-terrein binnen de gag-gen onder de studie geven.

Na ligatie van de twee fragmenten, bacteriële transformatie, eennd isolatie van plasmide DNA, moet de Gag-MJ4 hersenschimmen worden gecontroleerd voor de juiste maat door het uitvoeren van een dubbele verteren met NgoMIV en Hpal restrictie-enzymen. Full-length Gag-MJ4 chimaera dat deletie gebeurtenissen niet zijn gemaakt in bacteriële replicatie moet restrictiepatroon vergelijkbaar met die afgebeeld in figuur 3, met twee banden van ongeveer 8.700 en 4.300 bp hebben.

Een belangrijk onderscheid van het protocol vergeleken met eerdere benaderingen is het gebruik van de HIV-1 subtype C infectueuze moleculaire kloon, MJ4, in plaats van de gebruikelijke laboratorium aangepaste NL4-3 virus. Echter, de in de vorige paragraaf beschreven benaderingen worden aangepast voor het klonen van subtype B gag sequenties in pNL4-3.

Een optimalisatie van de multipliciteit van infectie (MOI) voor gebruik bij volgende experimenten werd uitgevoerd om het ideale MOI die logaritmische groei van de meerderheid van de geteste virussen vertoonden selecteren.Figuur 4 toont representatieve replicatie curves van drie verschillende MOI (0,01, 0,05 en 0,25) voor MJ4 (Figuur 4A) en voor NL4.3 (Figuur 4B). MJ4 repliceert veel minder efficiënt in cellen GXR25 dan NL4-3, wat belangrijk rekening te houden, als een MOI geschikt voor NL4-3 replicatie waarschijnlijk te laag is om efficiënte replicatie MJ4 detecteren. Zoals in figuur 4A, een MOI van 0,05 tegenover 0,01 of 0,25, was de ideale keuze, omdat logaritmische groei werd waargenomen tussen dag 2-6 voor MJ4. Voor de lagere MOI, 0.01, dag 6 DLU waarden zijn nauwelijks detecteerbaar, en we verwachten de generatie van Gag-MJ4 chimere virussen die lager gerepliceerd dan MJ4. Daarom is deze MOI zou de groei van het meer verzwakte Gag-MJ4 chimeren, die ook biologisch meest kritische kan niet vangen. Daarnaast wordt een MOI van 0,25 was niet ideaal, omdat de snelle kinetiek van virale replicatie doodde een aanzienlijke amount cellen zelfs dag 4 Hierdoor wordt de replicatie curve plateau en het berekenen van een helling basis van een curve als dit de replicatie capaciteit onderschatten. Op basis van curves gegenereerd voor NL4-3, zelfs bij een MOI van 0,01, zijn verkrijgbaar cel targets is merkbaar uitgeput door dag 6 na infectie. Kortom, een MOI van 0,05 werd gevonden optimaal voor een groot paneel van Gag-MJ4 chimere virussen, die alle een verschillende Gag sequenties en verschillende mate van replicatie zijn.

Een totaal van 149 Gag-MJ4 chimère virussen afgeleid van acute subtype C Gag-sequenties werden getest in vitro replicatie met deze assay. De genormaliseerde RC waarden varieerden van 0,01 tot meer dan 3,5 met sommige virussen repliceren meer dan 100 maal efficiënter dan wildtype MJ4. Figuur 5 toont de replicatie curves uit negen representatieve Gag-MJ4 chimère virussen met wildtype MJ4 afgebeeld in rood, en toont de uiteenlopende replicatie capacities waargenomen. Aldus kan de sequentiediversiteit in het gag-gen alleen drastisch beïnvloeden het vermogen van het virus om te repliceren in vitro. Hoewel dit representeert Gag-MJ4 chimère virussen afgeleid van acuut geïnfecteerde Zambians, andere subtype C sequenties niet uitgebreid getest, en kunnen verschillende replicatie kinetiek vertonen. Daarom moet grote zorg worden genomen om de MOI optimaliseren om de specifieke replicatie van de virussen van een bepaalde studie passen, omdat er diverse in de niveaus van replicatie tussen verschillende HIV-1 Gag en backbones isolaten kunnen worden.

Een van de voordelen van een T-cellijn, zoals het GXR25 cellijn die de replicatie van MJ4 ondersteunt, is de reproduceerbaarheid waargenomen ten opzichte van replicatie experimenten met gestimuleerde perifere bloed mononucleaire cellen als doelwit. In de eerste optimalisatie experimenten, MJ4 wild type vertoonden een intra-assay variabiliteit van 8,7%, en different klonen van dezelfde Gag-MJ4 chimeer virus vertoonde variabiliteit in replicatie van 8,5%. Omdat verschillende mastermengsels en phosphoscreen posities DLU waarden verschillend uitvallen groot kunnen geven, kunnen intra-assay variatie verder worden gecontroleerd door het uitvoeren van hetzelfde virus norm (in ons geval wildtype MJ4) in elke RT testplaat. Figuur 6 de grafieken DLU waarden afgeleid van dezelfde MJ4 infectie gekwantificeerd in acht verschillende RT schotels. Normaliseren van een virus dat voor alle RT assays kunnen helpen foutmarge veroorzaakt door deze lichte veranderingen in signaalgrootte tussen assays beperken.

Inter-assay variabel werd ook getest en replicaties herhaald op verschillende dagen waren sterk gecorreleerd. Figuur 7 percelen de genormaliseerde RC score waarden van twee onafhankelijke experimenten uitgevoerd ongeveer een jaar uit elkaar. Een hoge mate van correlatie met de afwezigheid van grote uitschieters (R2 = 0,873) werd waargenomen tusEEN van de twee onafhankelijke herhalingen.

Hoewel sterk gecorreleerd is er enige variatie in de totale omvang van replicatie kinetiek tussen de twee onafhankelijke experimenten. Dit kan worden toegeschreven aan het verschil in aantallen doorgang tussen de GXR25 cellen bestanden die in elk experiment. In het algemeen GXR25 cellen bestanden die zijn gepasseerd voor een periode van meer dan 6 maanden meestal efficiënter replicatie van Gag-MJ4 chimeren ondersteunen. Daarom is het raadzaam om replicatie capaciteit tussen groepen chimaera binnen een maand tijdsbestek beoordelen. Bij de voorgaande stappen nauw gevolgd deze test kan produceren zeer robuust en reproduceerbare resultaten, die voor een groot aantal studies.

Figuur 1
Figuur 1 vertegenwoordiger gel IMAGes afbeelden elektroforetische scheiding van PCR producten. Voor alle PCR producten, 5 pi van elk 50 pi reactiemengsel werd gemengd met 3 pl 5x ladingskleurstof, in een 1% agarose TAE-gel aangevuld met 1X SYBR-safe DNA gel stain geladen en door elektroforese bij 120 V gedurende 45 minuten. De Promega 1 kb DNA ladder (Baan 1) werd gebruikt om amplicon afmetingen. A) Het gag-gen werd geamplificeerd uit viraal RNA met een geneste PCR benadering benaderen. Door inserties en deleties, kan de prop amplicon variëren van 1600-1700 bp lang en wordt iets boven de 1500 bp DNA ladder merker. Lanen 2-5 tonen gag succesvolle genamplificatie. B) Het 5 'LTR van MJ4 werd geamplificeerd van het wildtype MJ4 plasmide en gevisualiseerd elektroforetische scheiding. Lanen 2-5 verbeelden succesvolle versterking van de 1.474 bp LTR product, dat iets verschijnt onder de 1.500 bp DNA ladder marker. C) De 5R17; LTR afgeleid van wild-type MJ4 en de gag-gen geamplificeerd van patiëntenplasma worden samengesmolten via splice-overlap-extensie PCR en gevisualiseerd via elektroforetische scheiding. Lanen 2-5 afbeelden met succes versmolten amplicons dat zijn ongeveer 3.200 bp in grootte, en die lijken iets boven de 3.000 bp DNA ladder marker.

Figuur 2
Figuur 2 beeld Representatieve gel afschilderen elektroforetische scheiding van restrictiedigesten van klonen van patient gag genen in MJ4. Wildtype MJ4 plasmide en LTR- gag fusie-producten werden gedigereerd met BclI gedurende 1,5 uur bij 50 ° C en NgoMIV gedurende 1 uur bij 37 ° C. Vector en insert fragmenten werden gevisualiseerd elektroforetische scheiding op een 1% agarose TAE-gel aangevuld met 1X SYBR-safe DNA gel vlek bij 100 V gedurende 2 uur en met behulp van een blauwe schijnwerper om UV-geïnduceerde DNA-schade te beperken. De vector en insert fragmenten geschikt voor daaropvolgende kloneringsstappen verschijnen ongeveer 10.000 bp respectievelijk 2.900 bp.

Figuur 3
Figuur 3 beeld Representatieve gel afschilderen elektroforetische scheiding van restrictiedigesten gezuiverd Gag-MJ4 chimeer plasmide DNA. Gezuiverd Gag-MJ4 chimeer plasmide-DNA werd dubbel gedigereerd met HpaI en NgoMIV restrictie-enzymen gedurende 2 uur bij 37 ° C. Restrictiedigesten werden gevisualiseerd elektroforetische scheiding op een 1% agarose TAE-gel aangevuld met 1X SYBR-safe DNA gel stain bij 120 V gedurende 45 minuten. Plasmiden zonder grote deleties zullen besluiten tot twee verschillende bands op ongeveer 8.700 en 4.300 bp.


Figuur 4 Replicatie van MJ4 en NL4-3 isolaten van HIV-1 in de GXR25 cellijn verschillende veelvouden van infectie (MOI). 5 x 10 5 GXR25 cellen werden geïnfecteerd zoals beschreven in de werkwijze protocol met 5-voudige verhoging van MOI elk virus voorraad. Supernatanten werden verzameld op dagen 2, 4, 6 en 8 na infectie en virion productie werd gekwantificeerd via een radioactief reverse transcriptase assay. Infecties werden uitgevoerd in drievoud en error bars geven de standaarddeviatie voor de drie herhalingen. (A) MJ4 (B) NL4-3.

Figuur 5
Figuur 5 Vertegenwoordiger scala van replicatie voor verschillende Gag-MJ4 hersenschimmen. 5 GXR25 cellen geïnfecteerd met wild type MJ4 of Gag-MJ4 chimaera bij een MOI van 0,05, werden supernatanten verzameld op dag twee intervallen na infectie en virion productie gekwantificeerd door een radioactief RT-bepaling. Toevoeging van subtype C afgeleid gag 'genen kan een dramatisch effect op de replicatie capaciteit van MJ4 hebben. Wildtype MJ4 replicatie aangeduid in rood.

Figuur 6
Figuur 6 Vergelijking van intra-assay variatie in het radioactief gemerkte reverse transcriptase (RT) kwantificering assay. Grafiek geeft inherent intra-assay variatie door het uitzetten van de DLU waarden van dezelfde supernatanten van een wildtype MJ4 infectie in acht verschillende RT-bepaling platen. De variatie in bochten weerspiegelt de lichte veranderingen in signaalgrootte between platen, die kunnen worden gecorrigeerd door het uitvoeren van een standaard RT op elke plaat, die vervolgens kan worden gebruikt om de hellingen van Gag-MJ4 chimaera getest op dezelfde plaat normaliseren.

Figuur 7
Figuur 7 Reproduceerbaarheid van de replicatie assay tijd in de GXR25 cellijn. Dezelfde Gag-MJ4 chimere virussen werden gebruikt om GXR25 cellen te infecteren in twee onafhankelijke experimenten uitgevoerd ongeveer een jaar elkaar. Replicatie scores werden gegenereerd door het berekenen van de helling van de log-getransformeerde waarden DLU en normaliseren die helling wildtype MJ4. Gag-MJ4 chimeren die efficiënter repliceren dan wildtype MJ4 hebben replicatie scoort hoger dan 1, en die welke minder efficiënt repliceren dan wildtype MJ4 hebben replicatie scoort minder dan 1 De twee onafhankelijke metingen sterk gecorreleerd (R2 = 0.87, lineaire regressie) en benadrukken de reproduceerbaarheid assays uitgevoerd op verschillende tijdstippen en met cellen bij verschillende passages.

A)

Reagens Volume voor 1x reactie (pl)
2x Reaction Mix (Invitrogen) 25
Nuclease-vrij H2O 17
Voorwaartse primer GOF (20 uM concentratie) 1
Reverse primer Vifor (20 uM concentratie) 1
SuperScript III One-stap Enzym Mix 1
RNA template 5
Totale volume 50

B)

Aantal Cycles Tijd (uur: min: sec) Temperatuur (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 sec / cyclus 68
1 00:00 68
1 4
END

Tabel 1: A) Master mix en B) gag versterking. * Opmerking: GOF primersequentie: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor primer sequentie: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reagens Volume voor 1x reactie (pl)
Nuclease-vrij H2O 35.5
5x Phusion HF Buffer 10
dNTPs (40 mM deoxynucleotiden) 1
Voorwaartse primer GagInnerF1 (20 uM concentratie) 1
Reverse primer BclIDegRev2 (20 uM concentratie) 1
Phusion Hot Start II Polymerase 0.5
Eerste ronde PCR als matrijs 1
Totale volume 50

B)

Aantal Cycles Tijd (uur: min: sec) Temperatuur (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
END

Tabel 2: A) Master mix en B) thermocycler voor geneste tweede-ronde-gag versterking. * Noot GagInnerF1 primersequentie: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 primer sequentie: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reagens Volume voor 1x reactie (pl)
Nuclease-vrij H2O 35.5
5x Phusion HF Buffer 10
dNTPs (40 mM deoxynucleotiden) 1
Voorwaartse primer MJ4For1b (20 uM concentratie) 1
Reverse primer MJ4Rev (20 uM concentratie) 1
Phusion Hot Start II Polymerase 0.5
MJ4 plasmide als sjabloon (10 ng / ul) 1
Totale volume 50

B)

Aantal Cycles Tijd (uur: min: sec) Temperatuur (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
END

Tabel 3: A) Master mix en B) thermocycler voorwaarden voor 5 'MJ4 LTR versterking. * Opmerking: MJ4For1b primersequentie: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev primer sequentie: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reagens Volume voor 1x reactie (pl)
Nuclease-vrij H2O 34.5
5x Phusion HF Buffer 10
dNTPs (40 mM deoxynucleotiden) 1
Voorwaartse primer MJ4For1b (20 uM concentratie) 1
Reverse primer BclIRev (20 uM concentratie) 1
MJ4 LTR 1.3 kb amplicon (gel gezuiverd, ~ 50 ng) 1
Phusion Hot Start II Polymerase 0.5
Gag amplicon (gel gezuiverd, ~ 100 ng) 1
Totale volume 50

B)

Aantal Cycles Tijd (uur: min: sec) Temperatuur (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
END

Tabel 4 A) Master mix en B) thermocycler voorwaarden voor splice-overlap-extensie PCR om LTR- gag inserts genereren. * Opmerking: BclIRev primersequentie: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reagens Volume voor 1x reactie (pl) Incubatie tijd (uur) Incubatie Temperatuur (° C)
1,5 ug van 3 kb LTR- gag amplicon of MJ4 plasmide x ui 1,5 ug
NEB CutSmart Buffer (voorheen NEB Buffer # 4) 2
BclI restrictie-enzym 1
Nuclease-vrij H2O x
Totale volume 19 1.5 50
NgoMIV restrictie enzym 1
Totale volume 20 1 37

B)

Reagens Volume voor 1x reactie (pl) Incubatie tijd (uur) Incubatie Temperatuur (° C)
50 ng geslepen MJ4 plasmidenvector x gl 50 ng
45 ng geslepen LTR- gag insert (3: 1 verhouding) x pi voor 45 ng
Roche 10x ligase buffer 2
Roche T4 DNA ligase (5 U / pl) 1
Nuclease-vrij H2O
Totale volume 20 18 jaar of ouder ('s nachts) 4

C)

Reagens Volume voor 1x reactie (pl) Incubatie tijd (uur) Incubatie Temperatuur (° C)
450 ng Gag-MJ4 plasmide x pi voor 450 ng
NEB CutSmart Buffer (voorheen NEB Buffer # 4) 2
NgoMIV restrictie enzym 0.5
Restrictie-enzym HpaI 0.5
Nuclease-vrij H2O x
Totale volume 20 2 37

Tabel 5 A) Beperking verteren master mix en B) ligeringsreactie voor het genereren van Gag-MJ4 chimeer provirus. C) Diagnostic restrictiedigest om Gag-MJ4 klonen trouw te waarborgen.

Primer Naam Nucleotide Sequentie (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabel 6: Lijst van sequencing primers noodzakelijk om 5 'LTR en gag-overeenkomst van Gag-MJ4 chimeer provirus bevestigen.

Een goed 8 ul virus + 232 gl 1% FBS in DMEM
Nou B 80 gl van Well A + 160 gl 1% FBS in DMEM
Nou C 80 gl van goed B + 160 gl 1% FBS in DMEM
Nou D 80 gl van Well C + 160 gl 1% FBS in DMEM
Nou E 80 gl van Well D + 160 gl 1% FBS in DMEM
Nou F 80 gl van goed E + 160 gl 1% FBS in DMEM

Tabel 7 Verwatering regeling (3-vouwen) voor titering besmettelijke virussen op TZM-bl cellen.

A)

Reagens Deel
PBS zonder Ca 2 + of Mg2 + 500 ml
Gluteraldehyde 4 ml
Formaldehyde 11 ml

* Opmerking: Bewaren bij 4 ° C.

B)

Reagens Deel
PBS zonder Ca 2 + of Mg2 + 4,75 ml
Kaliumferricyanide (0,2 M) 100 pl
Kaliumferrocyanide (0,2 M) 100 pl
Magnesiumchloride (1 M) 20 gl
X-gal (50 mg / ml) 40 gl

* Let op: Zorg fris en uit de buurt van licht tot gebruik.


C.

Originele Verwatering goed Een B C D E F
Volume virus (pl) toegevoegd aan de putjes van een 24-well plaat rij 5 1,6667 0,5556 0,1852 0,06173 0,02057

Tabel 8 A) B) de vaststelling van oplossingen voor titering van Gag-MJ4 chimere virussen op de TZM-bl indicator cellijn. C) Het volume van het virus toegevoegd per putje voor de berekening van infectieuze eenheden / pl.

Reagens Deel
Foetaal runderserum (FBS), gedefinieerd 55 ml
Penicilline, streptomycine, glutamine (100x) 6 ml
HEPES buffer (1M) 6 ml

Tabel 9: Recept voor volledige RPMI medium voor de verspreiding van GXR25 cellen.

Reagens Volume (ml)
Nuclease-vrije H 2 O 419.5
Tris-Cl, pH 7,8 (1M) 30
Kaliumchloride (1 M) 37.5
Magnesiumchloride (1 M) 2,5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Polyadenylzuur, kaliumzout (2 mg / ml) 1.25
Oligo-dT primer (25 ug / ml) 3.25
Totale volume 500

Tabel 10 Recept voor radioactief gemerkt reverse-transcriptase assay master mix. * Opmerking: Bewaren als 1 ml fracties bij -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Door de lengte en de technische aard van dit protocol, zijn er verschillende stappen die kritiek zijn voor zowel de succesvolle constructie van chimere Gag-MJ4 plasmiden en voor kwantificering van virale replicatie capaciteit zijn. Hoewel het restrictie-enzym gebaseerde klonen strategie voor de invoering van buitenlandse gag genen in MJ4 beschreven in dit protocol heeft tal van voordelen ten opzichte van eerder gebruikte recombinatie gebaseerde methoden, kan het protocol technisch uitdagend zijn als kritische stappen niet precies worden gevolgd.

Ten eerste is het absoluut noodzakelijk om MJ4 plasmide-DNA dat is gegenereerd in een bevoegde bacteriestam ontbreekt de DCM en dam DNA methylasen gebruiken. Dit is nodig omdat de enzymatische activiteit van het BclI restrictie-endonuclease, dat wordt gebruikt om gag-genen te kloneren in de MJ4 hoofdketen is dam / DCM methylering gevoelig. De JM110 en SCS110 (een Enda negatieve JM110 derivaat) E. coli stammen eenopnieuw geschikt voor het genereren ongemethyleerde MJ4 plasmide DNA. Bovendien, voor de excisie van vector en insert bands, is het sterk aanbevolen dat een blauw licht verlichting worden gebruikt voor visualisatie. Dit zal UV golflengte-afhankelijke DNA-schade te beperken en drastisch verhogen kloneringsefficiéntie. Als een blauw licht verlichting niet beschikbaar is, kan het klonen van efficiëntie worden gemaximaliseerd door het visualiseren van DNA met SYBR Safe DNA gel vlek in plaats van ethidiumbromide en het minimaliseren van UV-blootstelling tijd.

Tenslotte heeft moleculair klonen met grote (> 10kb) en / of retrovirale plasmiden zoals MJ4 traditioneel moeilijk om verschillende redenen. Grote plasmiden verminderen transformatie-efficiëntie van competente bacteriële stammen 42 terwijl retrovirale inserts, die lange terminale herhaling (LTR) sequenties, verminderen stabiliteit van het plasmide en compromissen replicatie betrouwbaarheid van het plasmide DNA in de bacteriële gastheer die tot deleties van het retrovirale genoom bevat 43 E. coli-stam via DH5a-stam, in onze handen. Vanwege de onstabiele aard van het plasmide zou gezuiverde plasmide producten altijd gecontroleerd worden plasmide maat door restrictie-enzym digestie; Hier dubbele verteren met NgoMIV en HpaI restrictie-endonucleasen bij 37 ° C gedurende 2 uur.

Zodra succesvolle generatie van chimeer Gag-MJ4 plasmiden is bereikt, wordt het virus gegenereerd via transfectie van 293T cellen getitreerd op een indicator cellijn, TZM-bl cellen en replicatie capaciteit wordt gemeten met een CEM-gebaseerde T-cellijn. De CEM-gebaseerde GXR25 cellijn replicatie van deze studies is een van de weinige gevestigde T-cellijnen kunnen binnenkomst en replicatie van CCR5-trope stammen van HIV-1 ondersteunen. Dit is bereikt door retrovirale transductie stabiele expressie van humaan CCR5 37 mogelijk. Deze cellijn natuurlijke expressie CXCR4 verschijnt replicatie van CXCR4-troop HIV-1 ondersteunen zoals het laboratorium aangepaste stam NL4-3. Echter, ter ondersteuning efficiënte replicatie van CCR5-trope stammen, zoals MJ4, moet de GXR25 cellen worden gekweekt voor ten minste 4 maanden voor infectie. Behoorlijk gepasseerde culturen kan replicatie steunen, zelfs na passage van maximaal 1 jaar. Een zorgvuldige controle van de CCR5-troop replicatie gedurende passages is essentieel voor een succesvolle experimenten.

Zoals met elke techniek zijn er beperkingen aan het proprotocol dat moet worden beschouwd. Door de ligging van de restrictieplaatsen in het plasmide MJ4 en de beschikbaarheid van geconserveerde restrictieplaatsen in natuurlijk voorkomende HIV-1 isolaten, het 3 'distale restrictieplaats, BcII ligt 137 nucleotiden van het gag stopcodon. Hoewel dit genereert een chimeer protease-gen, deze regio is 96,5% behouden in dit cohort, en we hadden een overvloed aan dode of defecte chimere virussen niet waarnemen.

Een van de voordelen van de MJ4 subtype C infectueuze moleculaire kloon met subtype C afgeleide sequenties is dat het risico van suboptimale gen paring tussen gag genen en backbone vectoren van verschillende subtypes vermindert. Echter, een bepaalde hoeveelheid binnen-clade diversiteit bestaat, zoals blijkt uit de clustering van HIV-1-reeksen per land of regio, zelfs wanneer binnen hetzelfde subtype 31. Dit zou kunnen bijdragen tot suboptimale koppeling tussen de 'gag' genen derived van acuut geïnfecteerde Zambians en MJ4 infectueuze moleculaire kloon backbone, die was afgeleid van een chronisch geïnfecteerde individu van Botswana 38. Een meerderheid van de geanalyseerde constructen geproduceerd infectieus nageslacht virus. Omdat verschillende HIV-1 subtype C infectueuze moleculaire klonen worden grotere schaal beschikbaar, is het belangrijk om het systeem verder te valideren door klonering in deze HIV-1 subtype C gag genen in andere ruggengraten om te zorgen voor een minimale vertekening die door aan ruggengraat onverenigbaarheden.

De GXR25 cellijn is een uniek cellijn specifiek vanwege zijn vermogen om zowel CXCR4 en CCR5-trope stammen en de HIV-1 induceerbare GFP reporter 37 ondersteunen. Echter, een aantal beperkingen bestaan ​​en moet zorgvuldig worden overwogen voordat u deze cellijn voor experimenten aangepast van dit protocol. De GXR25 cellijn lijkt niet om het invoeren van een meerderheid van subtype C of A, CCR5-troop, pr ondersteunenimary isoleert we hebben getest. Bovendien, de ouder CEM cellijn waaruit de GXR25 cellijn afgeleid vertoont hoge cyclofiline A, tot 2 tot 4 maal hogere expressie dan Jurkat cellijn 44. Vanwege de hoge mate van cyclofiline A, de replicatie defect normaal zijn voor de canonieke HLA-B * 57 verbonden escape mutatie, T242N, die wordt toegeschreven aan een verminderd vermogen van capside om cyclofiline A binden, niet gemakkelijk gedetecteerd kunnen worden in deze specifieke cellijn 25. Dus de CEM-gebaseerde GXR25 cellijn is niet geschikt voor het bestuderen van replicatie gebreken geassocieerd met mutaties in het HIV-1 capside-cyclofiline bindende lus.

Tenslotte, terwijl dit protocol is geschikt voor het analyseren van de replicatie capaciteit van gag sequenties afgeleid van acute tijdstippen, wijzigingen moeten worden aangebracht om de replicatie capaciteit van gag-genen verkregen uit chronisch geïnfecteerde individuen bestuderen. Dit protocol omvat de ameenvoudiging van de bevolking sequenties uit acute tijdstippen (mediaan 45 dagen na de waarschijnlijke datum van besmetting) bij virale diversiteit is beperkt. Het gag-gen van elk chimeer wordt vervolgens de sequentie bepaald en vergeleken met de oorspronkelijke populatie PCR amplicon te waarborgen klonen trouw. Vanwege de beperkte diversiteit sequentie acuut tijdstippen klonen van PCR producten populatie mogelijk. Echter, sequentiediversiteit bestaat binnen de virale quasispecies van een chronisch geïnfecteerd individu; Daarom, om de replicatie capaciteit van het chronische quasispecies nauwkeurig te beoordelen, enkel genoom amplificatie worden gebruikt voor verscheidene representatieve varianten vangen. Elk van deze varianten moeten vervolgens worden getest op in vitro replicatie.

Deze techniek heeft verscheidene bredere toepassingen die samenhangen met de voordelen over bestaande werkwijzen. Omdat dit proces resulteert in een klonale replicatiecompetente plasmide, is het eenvoudig om constructen gebruikt voor bijkomende mutagenesis studies, die kunnen helpen om de bijdragen van specifieke residuen aan virale replicatie te helderen. Bovendien, door het kloneren in gag-genen van longitudinale tijdstippen, kan de ontwikkeling van virale replicatie capaciteit kan beoordelen hoe deze veranderingen pathogenese gevolgen hebben een HIV-1 geïnfecteerd individu.

Deze techniek kan worden gemodificeerd om zijn bruikbaarheid voor verschillende toepassingen vergroten. Bijkomende HIV-1 virale eiwitten kunnen worden gemanipuleerd in de MJ4 plasmide teneinde de effecten te evalueren van virale replicatie of hun interacties met gastheereiwitten. Dit kan worden bereikt door de engineering bijkomende restrictieplaatsen in gewenste gebieden in het genoom door de invoering van stille nucleotide veranderingen. Echter, moet bijzondere aandacht worden gehouden bij de engineering van nieuwe restrictieplaatsen in de 3 'helft van de HIV-1 genoom zoveel accessoire eiwitten worden gecodeerd in alternatieve reading frames, en stille veranderingen in eeneiwit kan leiden tot aminozuursubstituties in andere. In dit geval restrictieplaats onafhankelijke klonen werkwijzen zoals die beschreven door Dudley et al. 45 kan deze beperking overwinnen. Virale sequenties afgeleid van verschillende populaties variërende reeksen van replicatie capaciteiten en de MOI kunnen derhalve om de meerderheid van virale isolaten op hun logaritmische groeifase vangen aangepast. Ten slotte GXR25 cellijn stabiel getransfecteerd met GFP onder een LTR-gedreven, Tat-induceerbare promoter, en virale verspreiding kan gemeten worden als functie van GFP positieve cellen via flowcytometrie 37 als alternatief voor de RT-bepaling of hier beschreven traditionele p24 ELISA.

Tot slot, dit protocol zorgt voor een efficiënte en krachtige techniek voor de beoordeling van HIV-1 virale replicatie als die welke door de gag-gen, dat een geconserveerde structurele eiwit codeert noodzakelijk voor een goede virion vorming, Ontluikende, rijping, en demontage 46-48. Verder is deze methode levert een replicatiecompetent klonale plasmide, ideaal voor mutagenese studies en dus een werkwijze voor het ophelderen van de specifieke aminozuur determinanten van virale fitheid. Studies zoals deze zijn noodzakelijk om te begrijpen hoe immuun-gestuurde virale evolutie beïnvloedt pathogenese en ziekteprogressie bij HIV-1 geïnfecteerde individuen verbeteren.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Een restrictie-enzym Based Klonen Methode om de Beoordelen<em&gt; In vitro</em&gt; Replicatie Capaciteit van HIV-1 Subtype C Gag-MJ4 Chimeric Virussen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter