Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Einem Restriktionsenzym basierte Klonen Methode, um das Beurteilen doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bestimmung sowohl der Host und viralen Eigenschaften, die Einfluss auf HIV-1-Pathogenese und Progression der Erkrankung ist von größter Bedeutung für eine rationelle Impfstoff-Design. Die zelluläre Immunantwort ist eine Schlüsselkomponente der menschlichen Immunantwort auf HIV-1-Infektion. Zytotoxische T-Lymphozyten (CTL) sind für die erste Kontrolle der akuten Virämie notwendig und erlauben dem Host, einen stabilen Zustand (Sollwert) die Viruslast 1,2 etablieren. Experimentelle Erschöpfung dieser Effektor-Zellen führt zu einem Verlust der viralen Steuer 3,4. Trotzdem entkommen Mutationen entstehen innerhalb des viralen Genoms, die CTL-Erkennung von virusinfizierten Zellen 5-9 zu untergraben.

Bestimmte HLA-Allele wurden mit niedriger Viruslast und langsamer Fortschreiten der Krankheit, einschließlich B * 57, B * 27 und B * 81 10-15 in Verbindung gebracht. Teil der Schutzwirkung von HLA Klasse I-Allele können, daß sie funktional eingeschränkten Regionen des Genoms, wie Gag Ziel zurückzuführenund wählen Flucht Mutationen, die die Fähigkeit des Virus zur Replikation in vitro 16-21 abnehmen. Obwohl Flucht aus dem zellulären Immunsystems ist vorteilhaft gegenüber dem Virus in Zusammenhang mit dem Auswahl HLA-Klasse-I-Allel kann die Wirkung dieser Mutationen Differenzfolgen für den Host bei der Übertragung zu einem HLA-übereinstimmende Einzel 22,23 aufweisen. Daher, das Verständnis der Auswirkungen von übertragenen HLA-assoziierten Mutationen Flucht auf die virale Replikation Kapazität wird wichtig sein, um unser Verständnis der frühen HIV-1-Pathogenese zu fördern.

Während viele Fortschritte gemacht worden, Identifizierung und Charakterisierung der Fitness der einzelnen Defekte mit bestimmten HLA-Klasse-I-Allele 24-29 verbunden Mutationen, natürlich vorkommende HIV-1-Isolate einzigartige und komplexe Spuren der HLA-assoziierten Polymorphismen, wahrscheinlich aus der HLA vermittelte Immun Druck von verschiedenen immungeneHinter 30. In aprevious Analyse, Goepfert et al. zeigten, dass eine Ansammlung von HLA-assoziierte Mutationen in den übertragenen Gag-Sequenzen von 88 akut infizierten Zambians abgeleitet wurde, mit einer Verringerung der Sollviruslast 31 verbunden. Dies legte nahe, dass die Übertragung von schädlichen Mutationen, insbesondere in Gag, an HLA-übereinstimmende Empfänger einen klinischen Nutzen und können durch virale Replikation gedämpft werden. Moving forward, ist es zwingend notwendig, zu untersuchen, wie komplexe Kombinationen von Gag-Polymorphismen in natürlich vorkommenden Isolate im Konzert arbeiten, um Eigenschaften des Virus übertragen wie Replikation Kapazität und wie früh Replikation kann wiederum HIV-1-klinischen Parametern und Spätstadium beeinflussen definieren Pathogenese.

Brockman et al. Eine Verbindung zwischen den Replikationskapazität von gag-pro-Sequenzen während der chronischen Phase der Infektion und Viruslast in beiden Subtyp C und B-Infektionen isoliert erstmals gezeigt32-35. Der experimentelle Ansatz in diesen Studien vorgestellt, obwohl geeignete für die Prüfung der in vitro Replikation Kapazität von Sequenzen aus chronisch infizierten Personen stammen, hat mehrere technische Vorbehalte und Einschränkungen, die das Studium machen HIV-1-Replikationskapazität in Subtyp C akut infizierten Personen schwierig. Dieses Verfahren beruht auf der Rekombination von Bevölkerungs basierten PCR-amplifizierten Sequenzen in den Subtyp B NL4-3 Provirus, die teilweise von LAV, abgeleitet wurde, angepasst, ein Laborvirusvorrat 36. Viruserzeugung wurde durch Co-Transfektion einer CEM-basierte T-Zelllinie mit 37 PCR-Produkte durchgeführt und aufgeschlossen Delta-gag-pro NL4-3 DNA. Dieses Verfahren erfordert das Auswachsen von Virus über einen Zeitraum von Wochen bis Monate, möglicherweise Neigen der Art des gewonnenen Virus Lager in Bezug auf die virale Quasi-Spezies in vivo und somit zur Änderung der Messung der Replikationsfähigkeit in vitro. Diese Methode, die ichist mehr für die Untersuchung chronisch infizierten Individuen, wenn sie tatsächlich selektiert Virus mit der höchsten Replikationsfähigkeit, und wo die Klonierung zahlreichen verschiedenen Virusvarianten aus einer großen Anzahl von chronisch infizierten Personen angemessen ist sehr arbeitsintensiv und daher nicht durchführbar ist. Jedoch in einer akut infizierten Individuum gibt es im allgemeinen ein zwei Varianten vor, und wodurch das Risiko einer Schrägstellung der Art des gewonnenen Virus-Stock, durch in vitro Selektionsdruck erlaubt eine bessere Beurteilung der in vitro-Replikationskapazität. Zweitens erfordert dieses Verfahren Rekombination Subtyp C-Gag-pro-Sequenzen in einem Subtyp B abgeleitet Rückgrat und könnte Rückgrat Inkompatibilität Vorurteile in die Analyse einzuführen. Aufgrund dieser Einschränkungen ist eine große Anzahl von Sequenzen, um mögliche Verzerrungen eingeführt überwinden analysiert werden.

Hier beschreiben wir eine alternative Versuchs approach für das Studium Sequenzen aus Subtyp C akut infizierten Individuen abgeleitet angemessen. Wir verwenden eine Restriktionsenzym-basierte Klonen Strategie, um die gag-Gen von einer akuten Infektion Zeitpunkte der HIV-1 Subtyp C infizierten Personen in den Subtyp C proviraler Rückgrat, MJ4 abgeleitet einzuführen. Die Verwendung von MJ4 als gemeinsames Grundgerüst, in dem gag-Gene zu klonieren ist für die Analyse von Subtyp C abgeleitete Sequenzen. MJ4 ist aus einem primären Isolat 38 abgeleitet, und somit wäre weniger wahrscheinlich, Verzerrung durch Subtyp Inkompatibilität zwischen dem Backbone und gag-Gen einzuführen. Darüber hinaus ist die Ansatz der Verwendung von Enzym-basierte Klonen Einschränkung erlaubt die proviralen Konstrukte direkt in 293T-Zellen transfiziert werden, und für die Wiederherstellung eines klonalen Virus-Stamm identisch mit dem geklonten gag-Sequenz.

Die nachstehenden Verfahren ein Hochdurchsatzverfahren zur Bewertung der Replikationsfähigkeit des Subtyps C abgeleitet Gag-MJ4chimären Viren. Transfektion in 293T-Zellen ist einfach und Virusgewinnung erfolgt nur drei Tage. In vitro Replikationskapazität auf demselben CEM-CCR5 basierend T-Zell-Linie, die durch Brockman et al untersucht. 37, aber unter Verwendung von für die erfolgreiche Replikation notwendig wichtiges Protokoll Modifikationen des Subtyps C MJ4 chimären Viren. Die Verwendung einer geeigneten T-Zell-Linie anstatt PBMCs ermöglicht eine große Anzahl von Subtyp C MJ4-chimären Viren mit hoher Reproduzierbarkeit Assay getestet werden. Schließlich, unter Verwendung einer radioaktiv markierten Reverse-Transkriptase-Assay zur Quantifizierung von Virus im Überstand ist kostengünstiger als die Verwendung von kommerziell erhältlichen p24-ELISA-Kits. Es gibt auch einen höheren Dynamikumfang, die wichtig zur Erkennung beide schlecht und sehr replizierende Viren innerhalb der gleichen Assay zum Nachweis und feine Unterschiede in der Replikation zwischen Isolaten war.

Im Ergebnis hat das hier vorgestellte Verfahren zur gestattetDie eingehende Untersuchung der Replikationskapazität von gag-Sequenzen von HIV-1 Subtyp C abgeleitet akut infizierten Personen aus Sambia und wie geschrieben, könnte auch erweitert werden, um andere Subtyp C infiziert Populationen zu untersuchen. Ein hohes Maß an Variation in der Replikation zwischen verschiedenen Kapazitäten Gag Isolate beobachtet. Darüber hinaus waren wir in der Lage, eine statistische Assoziation zwischen der Kapazität der Replikation übertragen Gag und Sollwert der Viruslast als auch mit CD4 + Rückgang über einen Zeitraum von drei Jahren 39 zeigen. Solche Ergebnisse unterstreichen die Bedeutung der Untersuchung, wie tragene Viruseigenschaften, wie Replikationskapazität, die Interaktion mit dem Immunsystem des Wirts zu Pathogenese während der frühen Infektion beeinflussen und Integral für die Entwicklung wirksamer Impfstoff Interventionen als auch die Behandlung sein.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Verstärkung der HIV-1-gag-Gens von infizierten, Frozen Plasma

  1. Extrahieren viraler RNA aus 140 ul aufgetaut HIV-1 infizierten Plasma unter Verwendung eines Extraktions-Kits.
    1. Wenn möglich, sofort nach RNA-Extraktion als nicht gefrorenen virale RNA liefert die besten Ergebnisse Verstärkung der cDNA-Synthese stattfindet. Wenn möglich, einzurichten PCR Master Mix für die erste Runde der DNA-Amplifikation und bei 4 ° C vor der viralen RNA-Extraktion.
  2. Reverse Transkription und cDNA aus RNA und verstärken ersten Runde DNA-Produkte mit Reverse-Transkriptase und eine thermostabile DNA-Polymerase in einer Ein-Schritt-RT-PCR.
    1. Nehmen RNA von -80 ° C Gefrierschrank (wenn Gefrierpunkt notwendig war) und kurz bei Raumtemperatur auftauen, dann in kaltem Block. Übertragungs 5 ​​ul RNA zu jedem PCR-Röhrchen mit 45 ul der Stammmischung, um ein Endvolumen von 50 ul zu ergeben. Sofort platzieren verbleibenden RNA-Proben in -80 ° C Gefrierschrank.
    2. Nach Enzym einedded zu der ersten Runde PCR Master Mix (Tabelle 1A), aliquote 45 ul in jedes dünnwandigen PCR-Amplifikation Rohr für die Anzahl der gewünschten Reaktionen. Achten Sie darauf, PCR-Röhrchen mit Einzeldeckeln verwenden und nicht abstreifen Kappen auf minimale Kreuzkontamination zwischen den Proben zu gewährleisten. Zeigen PCR-Röhrchen in einem kalten Block, um die temperaturempfindlichen RT-Enzym RNA-Matrize und zu schützen. Hinweis: Proben sollten in dreifacher Ausfertigung, um die viralen Quasispezies ausreichend Probe durchgeführt werden. Es ist auch wichtig, um ein Produkt mit einer High Fidelity DNA-Polymerase-Enzym, um die PCR-Fehleinbau eingeführt minimieren nutzen. Bitte beachten Sie die Reagenzien Liste für die empfohlene Produkt.
    3. Nach RNA-Matrize wurde bei allen Reaktionsröhrchen zugesetzt, übertragen PCR-Röhrchen mit einem Thermocycler zur Amplifikation unter Verwendung der in Tabelle 1b beschrieben Cyclerprogramm. Anmerkung: Das Produkt dieser Amplifikation werden in einer zweiten Runde nested PCR verwendet werden.
  3. Führen Sie eine verschachtelte second-Runde der PCR-Amplifikation unter Verwendung von 1 ul der ersten Runde der PCR-Amplifikation (1.2) als DNA-Matrize.
    1. Aliquot 49 ul zweiten Runde PCR Master Mix (Tabelle 2A) zu jeder dünnwandigen PCR-Röhrchen für die Anzahl der gewünschten Reaktionen. Übertragungs 1 ul aus der ersten Runde der PCR-Amplifikation zu jedem Reaktionsgefäß, um ein Endvolumen von 50 ul zu ergeben. Hinweis: Dies wird als Template-DNA für die zweite Runde Verstärkung dienen. Es ist auch wichtig, um eine DNA-Polymerase mit sehr hoher Genauigkeit und Korrekturmöglichkeiten, um die PCR-Fehleinbau eingeführt minimieren nutzen. Bitte beachten Sie die Reagenzien Liste für die empfohlene Produkt.
    2. Übertragen zweiten Runde PCR-Reaktionsmischung zu Thermocycler und in Tabelle 2B beschrieben Lauf-Programm. Anmerkung: Nach Abschluss des Programms werden die Produkte dieser Reaktion wurden auf einem Agarose-Gel laufen gelassen, um die Produktion des Produktes zu bestätigen.
  4. Hinzufügen 3 ul 5x Ladepuffer bis 5 & #181; l der 50 ul der zweiten Runde Reaktionsvolumen und bei 120 V auf einem 1% Agarose-TAE-Gel mit einem UV-fluoreszierenden DNA-Farbstoff ausgeführt, bis Banden aufgelöst werden. Visualisieren 1,6 kb Banden auf einem blauen Lichtbeleuchtung (siehe Abbildung 1a).
  5. Führen Sie die restlichen 45 ul Reaktionsvolumen auf einem 1% igen TAE-Gel, die eine DNA-Färbung, und der Verbrauch die entsprechenden Banden mit einem sauberen Rasierklinge.
    1. Extrahieren DNA aus dem Gel Scheibe mit einem Gel Purification Kit, eluieren in Nuklease-freies Wasser, kombinieren drei positive Reaktionen pro Einzel und gefrier Produkt bei -20 ° C für die spätere Verwendung.

2. Vorbereitung Gag Amplikons für Klonen von Einführung der notwendigen Beschränkung Seiten

  1. Verstärken die Long Terminal Repeat (LTR) / 5 'UTR Teil des MJ4 Plasmid (siehe Tabelle 3).
  2. Visualisieren 1,3 kb PCR-Produkte auf Illuminator, Verbrauch positive Amplikons, Gel reinigen und einfrieren, wie vorherbeschrieben (1.4,1.5, siehe Abbildung 1B).
  3. Verschmolzen MJ4 LTR- Gag Amplikons über "splice-Overlap-Extension" Create PCR (siehe Tabelle 4).
  4. Visualisieren, Verbrauchssteuern, zu reinigen, und frieren die 3,2 kb Amplikons wie in 1.4,1.5 (siehe Abbildung 1c).

3. Klonierung Amplified gag-Gene in die MJ4, Subtyp C, Infektions Molekulare Klon

  1. Verdauen 1,5 ug MJ4 Plasmid und 1,5 ug gereinigt LTR- Gag-PCR-Produkt mit dem BclI (Methylierung empfindlich) Restriktionsendonuklease für 1,5 h bei 50 ° C (siehe Tabelle 5a).
  2. 1 ul NgoMIV auf die Aufschlussreaktion und bei 37 ° C für 1 Stunde.
  3. Hinzufügen 5x Lade Farbstoff Restriktionsverdau Reaktionen und langsam Elektrophorese das Gesamtvolumen auf einem 1% igen TAE-Gel mit einem DNA-Gel-Färbung für 1-2 h bei 100 V. visualisieren, Verbrauch und reinigen angegebenen Bänder für das Klonen, wie vorher absteigendribed (siehe Abbildung 2).
  4. Bereiten Ligationsreaktionen unter Verwendung von gereinigtem LTR- Gag Einsatz und MJ4 Vektor-DNA in einem 3: 1-Einsatz auf Vektorverhältnis. Ligationsreaktionen über Nacht bei 4 ° C inkubieren (siehe Tabelle 5B).
  5. Verwandeln JM109 chemisch kompetente Bakterien mit Ligationsprodukte und auf LB-Agar-Platten mit 100 ug / ml Ampicillin und wachsen bei 30 ° C für 22 + Stunden.
    1. Auftauen JM109 kompetente Zellen auf Eis für 15 min. Beschriften Sie 1,5 ml Mikrozentrifugenröhrchen und Chill auf Eis.
    2. Aliquoten 50-100 ul JM109-Zellen vor, gekühlt 1,5 ml Mikrozentrifugenröhrchen. Fügen 2,5-5 ul Ligationsreaktion zu JM109-Zellen und schnippte Rohr leicht zu mischen und sofort wieder in Eis. Kompetenten Zellen mit Ligationsprodukt zu inkubieren auf Eis für 30 min.
    3. Hitzeschock 1,5 ml Mikrozentrifugenröhrchen mit JM109 kompetente Zellen und Ligationsreaktion in einem 42 ° C Wärmeblock für 45 sec und zum Eis für mindestens 3 min.
    4. Fügen Sie 50 ul SOC-Medium zu jedem Mikrozentrifugenröhrchen und Platte die gesamte Transformationsansatz auf Raumtemperatur LB-Agar-Platten mit 100 ug / ml Ampicillin.
    5. Übertragungsplatten zu einer 30 ° C-Inkubator und lassen für 20 Stunden oder bis Kolonien sind deutlich ausgebildet.
  6. Pick isolierte Kolonien wachsen und in 4 ml LB mit 100 ug / ml Ampicillin bei 30 ° C für 22 + h.
  7. Spin-Down-Kulturen bei 3.200 g für 15 min, abgießen Brühe, und Plasmid-DNA zu extrahieren.
  8. Um zu bestätigen, Klonen Treue, schneiden Miniprep-DNA mit NgoMIV und HpaI Restriktionsenzyme im Doppel verdauen bei 37 ° C für 2 Stunden. Analysieren auf 1% Agarose-TAE-Gel (siehe Tabelle 5C).
  9. Reihenfolge der LTR-gag Einsatz Bereich jedes Plasmid unter Verwendung der folgenden Primer: GagInnerF1, GagF2, Rev1, Rev3 und GagR6 (Tabelle 6), um Sequenzidentität zu bestätigen.
  10. Vergleichen Sie die mit der Bevölkerung Sequenzen der klonierten Sequenzen erhaltenvon der ersten gereinigten Amplikon von 1.5.1 Ived. Hinweis: Es ist wichtig, letztlich beurteilt die Replikationskapazität von zwei unabhängigen Klonen, um sicherzustellen, daß die in vitro-Replikation Phänotypen aufgrund Rückgrat Fehler während des Kopiervorgangs eingebracht.

4. Erzeugung und Titrierung von Replikations-kompetenten Gag-MJ4 chimären Viren

  1. Erzeugen Replikation zuständigen Virus durch Transfektion von 1,5 ug des chimären Plasmid Miniprep MJ4 DNA in 293T-Zellen mit einem 4: 1-Verhältnis von Fugene HD wie von Prince et al 39 beschrieben.
  2. Titer geerntete Virus Aktien auf TZM-bl-Zellen wie unten und in Prince et al 39 beschrieben.
    1. Platte TZM-bl-Zellen 24 h vor der Infektion mit dem Virus um eine 30-40% konfluenten Zellmonoschicht auf den folgenden Tag haben. Dies kann in der Regel durch Zugabe von 5 × 10 4 Zellen in einem Gesamtvolumen von 800 ul pro Vertiefung in einer 24-Well-Platte erreicht werden.
    2. Nach der Zugabe von Zellen, um den Brunnen, sanft bewegen Sie den 24-Well-Platte vor und zurück, dann Seite, um effizient zu verteilen Zellen Seite. Nie wirbeln - das wird in den Zellen, der sich in der Mitte der Platte führen.
    3. Am folgenden Tag vorzubereiten 1% FBS in DMEM; Dies wird verwendet, um DEAE-Dextran zu verdünnen und Virusstämme zu verdünnen. Lager DEAE-Dextran ist 10 mg / ml oder 125x und eine Endkonzentration von 80 ug / ml oder 1 x erwünscht ist.
    4. Nehmen Sie Virus-Stock, von -80 ° C Gefrierschrank und auf Schüttler getestet werden, um bei Raumtemperatur auftauen.
    5. Mit einer Mehrkanalpipette, seriell verdünnte Virusstämme in einem Rundgewebekultur behandelt 96-Well-Platte mit Deckel. Dies ist ein 3-facher Verdünnung Protokoll. Siehe Tabelle 7 für die Verdünnungsschema.
    6. Entfernen Sie das Medium aus ausgesät TZM-bl 24-Well-Platten mit einer Vakuumsauger dafür, dass nicht auf Zellschicht stören. Entfernen Sie die Medien aus einem 24-Well-Platte in einer Zeit, so dass die Zellen zu tunnicht austrocknen.
    7. Fügen Sie 150 ul der 1x DEAE-Dextran + 1% FBS in DMEM-Mischung in jede Vertiefung mit einem 1000 ul Pipette. Verwenden Sie nicht wiederholen Pipette, da dies stört die Monoschicht.
    8. Jeweils 150 ul jeder Virusverdünnung in die entsprechende Vertiefung. Fügen Virus auf der Mitte der gut und vorsichtig schwenken gleichmäßig zu verteilen Virus über die Zellschicht. Inkubieren infizierten Zellen für 2 h in einem Zellkulturbrutschrank bei 37 ° C und 5% CO 2.
    9. Nach der 2-stündigen Inkubation mit 0,5 ml 10% FBS in DMEM in jede Vertiefung und Rückplatten Inkubator für weitere 48 Stunden.
    10. Nach 48 Stunden sollten die Zellen 100% konfluent sein. Da MJ4 ist ein kompetenter Replikation Virus, wird es einige Zelltod zu sein, aber das ist zu erwarten.
    11. Entfernen Sie das Medium aus jeder Vertiefung und fügen Sie 400 ul / Vertiefung Fixierungslösung (siehe Tabelle 8A für Rezept). Fix nur eine Platte zu einer Zeit. Fügen Befestigungslösung unter Verwendung eines 1000 ul Pipette, und lassen Sie sich für 5 min beiRaumtemperatur.
    12. Fixierungslösung entfernen und waschen 3x mit PBS mit Ca 2 + / Mg 2 +. Verwenden Sie eine Spritzflasche vorsichtig auf die Seite der PBS auch hinzufügen, um nicht zu stören die Monoschicht. Nach dem dritten Waschen, trocknen Platte auf saugfähigem Papier trocken.
    13. Geben Sie 400 ul / Färbelösung (siehe Tabelle 8B für Rezept) zu jeder Vertiefung der 24-Well-Platte, und bei 37 ° C für mindestens 2 Stunden. Längere Inkubationszeiten sind akzeptabel, aber Inkubationszeiten sollte konsistent Titrierung Experimente aufbewahrt.
    14. Wasch 2x mit PBS mit Ca 2 + / Mg 2 + und Tor für eine Infektion, oder fügen PBS und bei 4 ° C für die Wertung später. Platten können bei 4 ° C für bis zu vier Tage gehalten werden, solange die Monoschicht hydratisiert gehalten.
    15. Um Infektionen zählen, verwenden Sie eine dauerhafte Markierung, um Vertiefungen der 24-Well-Platte in Quadranten aufteilen. Zählen Sie alle blauen Zellen in einem Sichtfeld, mit einer Gesamtvergrößerung von 200X, einmal injeder der vier Quadranten eines gut.
    16. Berechnen Sie infektiösen Einheiten pro ul wie folgt: [(# blauen Zellen / 4) x 67] / (ul-Virus hinzugefügt) = IE / ul. Siehe Tabelle 8C Volumen ul Virus zu jeder Vertiefung gegeben. Durchschnittliche mehrere Brunnen zusammen; die Zahlen sollten für eine genaue Titration relativ ähnlich sein.

5. Herstellung von Kultur, Medien und Ausbreitung von GXR25 Zellen für in-vitro-Assay-Replikation

  1. Bereiten komplettem RPMI (cRPMI) für die Vermehrung von Zellen GXR25. HINWEIS: Es ist sehr zu Kultur GXR25 Zellen mindestens 4 Monate vor der geplanten Experimente Replikation wichtig (siehe Tabelle 9).
  2. Geteilte Zellen 1.10 zweimal pro Woche aufrechterhalten Zelldichte von 1 × 10 5 bis 2 × 10 6 Zellen / ml.

6. In-vitro-Replikation von Gag-Chimären in MJ4 GXR25 (CEM-CCR5-GFP) Zellen

  1. Am Tag vor dem infection auf eine Konzentration aufgeteilt Zellen zwischen 2-3 × 10 5 Zellen / ml, so dass sie in der logarithmischen Wachstums am Tag der Infektion.
  2. Am Tag der Infektion, Virus entfernen Aktien von -80 ° C Gefrierschrank und Tauwetter. Berechnen des Volumens des Virus von jedem Lager benötigt auf der Grundlage der IE / ul Titer von TZM-bl-Zell-Assay, um auf 5 × 10 5 Zellen zu infizieren GXR25 bei einer Multiplizität der Infektion von 0,05 nach der Formel:
    Volumen der Virus für die Infektion (ul) = 1 ul / X IU x 0,05 x 500.000
    HINWEIS: Wir haben eine MOI von 0,05 gewählt, da dies zu einer logarithmischen Wachstumsphase für alle Viren, die wir getestet haben. Es ist wichtig, erste Versuche, um die optimale MOI bestimmen logarithmischen Wachstums erfassen für das Virus getestet befragen.
  3. Verdünnen Virus in cRPMI auf ein Volumen von 100 ul (um eine 0,05 MOI zu erreichen), und fügen Sie in eine Vertiefung einer Gewebekultur, V-Boden behandelt 96-Well-Platte. Hinweis: Fügen Sie sowohl eine positiVE (MJ4 WT infizierten) und eine negative (mock-infizierten Zellen) Kontrolle in jedem Satz von Replikationsexperimenten. Einrichten der Platte, so dass jede andere Spalte leer, um Kreuzkontaminationen zwischen Brunnen begrenzen. Die positive Kontrolle ist zwingend erforderlich, wie es später als ein Standard verwendet, um die Replikation Pisten, die ein Maß für die Replikationsrate von Experimentwiederholungen sind normalisiert werden.
  4. Graf GXR25 Zellen mit Hilfe eines automatisierten Zellzähler. Berechnen der Anzahl der Zellen in Summe für alle Infektionen (5 x 10 5 x # Infektionen) benötigt. Aliquots des erforderlichen Volumens in einen 50 ml konischen Röhrchen und zentrifugieren Zellen zu pelletieren. Immer für 25% mehr Infektionen berechnen als nötig.
  5. Aspirat Medien vorsichtig resuspendieren in cRPMI in einer Konzentration von 5 x 10 5 Zellen / 100 ul.
  6. Pipette Zellen in ein steriles Trog und gründlich mischen. Verwendung einer Mehrkanalpipette je 100 ul der Zellen in jede Vertiefung der 96-Well-Platte mit der verdünnten Virus. Mix gründlich.
  7. Add 2 ul 5 mg / ml (100x) Lösung von Polybren in jede Vertiefung und mischen Zellen gründlich.
  8. Bei 37 ° C in Gewebekultur-Inkubator mit 5% CO 2 für 3 Stunden.
  9. Um infizierte Zellen zu waschen, Zentrifuge 96-Loch-V-Bodenplatte Zellen zu pelletieren. Dann entfernen Sie vorsichtig 150 ul des Mediums und ersetzen mit frischen 150 ul cRPMI ohne das Zellpellet zu stören. 2 weitere Male wiederholen (einschließlich Zentrifugation) zu den Zellen ausreichend zu waschen.
  10. Nach der letzten Zentrifugation und Zugabe von 150 ul cRPMI, Zellpellet mit einer Mehrkanalpipette und fügen die gesamte Zell / Virus-Gemisch (etwa 200 ul) aus jeder Vertiefung unabhängig zu 800 ul cRPMI in eine Vertiefung einer 24-Well-Gewebe Kulturplatte.
  11. Ort Platte in 5% CO 2-Gewebekulturbrutschrank bei 37 ° C aufweist.
  12. Alle zwei Tage entfernt 100 ul des Überstandes von der Oberfläche des Kulturvertiefung und in ein 96-Loch-U-bottom Platte und bei -80 ° C eingefroren, bis die Quantifizierung läuft Virus-Assay. ANMERKUNG: Eine sorgfältige Anordnung der Überstände in 96-Well-Platten für Mehrkanalpipette Übertragung von Kulturüberständen im Virion Quantifizierung mittels eines radioaktiv markierten Reverse-Transkriptase (RT)-Assay zu ermöglichen. Jede Platte sollten die Proben von einer Infektion Standard, um inter-Platte Variation in der RT-Test Anzeige normalisieren enthalten.
  13. Nach dem Entfernen jeweils 100 ul Probe, geteilte Zellen 1: 2 durch gründlich resuspendiert Zellen und Entfernen der Hälfte des verbleibenden Volumens (450 ul). Wiederherstellen der ursprünglichen Volumen (1 ml) durch Zugabe von 550 ml frisches cRPMI in jede Vertiefung.

7. Analyse der Reverse Transcriptase (RT) in Zellkulturüberständen

Protokoll angepasst von Ostrowski et al 40.

  1. Einrichten biologischer Schutzhaube in einer Anlage BSL-3 für den Einsatz mit radioaktiven Stoffen.
    1. Zeigen saugfähigem Papier in hood und ersetzen Absauger für Absauger für radioaktive Verwendung bezeichnet. Hinweis: Alle radioaktiven Abfälle müssen ordnungsgemäß mit entsprechend der Sicherheitsbestimmungen entsorgt werden.
  2. Hinzufügen 1-2 ul 10 mCi / ml [33 P α-] dTTP und 4 ul 1 M Dithiothreitol (DTT) zu je 1 ml-Aliquot der RT-Mastermischung (siehe Tabelle 10 und Ostrowski et al. 40).
  3. Je 1,5 ml Mikrozentrifugenröhrchen von RT Master Mix, DTT und [α- 33 P] dTTP sorgfältig mischen mit einem 1000 ul Pipette und in ein steriles Trog.
  4. Verzichten 25 ul der markierten RT in jede Vertiefung der 96-Well-dünnwandigen PCR-Platte zu mischen. Hinweis: Fügen Sie Platz für eine positive Kontrolle (MJ4 WT-Infektion) und Negativkontrolle (Mock-Infektion).
  5. Geben Sie 5 ul jeder Überstand auf der PCR-Platte, die die RT Master Mix.
  6. Siegel PCR Platte mit Haftklebefolienabdeckung und Inkubation für 2 Stunden bei 37 ° C in einem Thermocycler. Aus Sicherheitsgründen rinse Pipettenspitzen mit Amphyl und entsorgen Tipps in kleine Behälter, Amphyl Abfälle, die später von in radioaktiver Abfall entsorgt werden.
  7. Nach der Inkubation machen kleine Löcher in der Deckfolie mit einer 200 ul Mehrkanalpipette. Hinweis: Wenn Pipettenspitzen berühren Flüssigkeit in gut ersetzen Tipps, bevor Sie zur nächsten Spalte oder Zeile.
  8. Mischungsproben 5x und Transfer 5 ul jeder Probe auf die DE-81-Papier. Luft trocknen 10 min.
  9. Wasch Blots 5x mit 1x SSC (Natriumchlorid, Natriumcitrat) und anschließend 2x mit 90% Ethanol bei 5 min pro Waschung. An der Luft trocknen.
    1. Setzen Sie jeden Fleck in einem separaten Waschbehälter, wie ein Sandwich Aufbewahrungsbox, fügen Sie genug Waschpuffer (1x SSC oder 90% EtOH) zu decken Blot, und schütteln für 5 min.
    2. Abgießen Waschpuffer in separate Behälter und wiederholen. Hinweis: Die ersten 3 Wäschen werden als radioaktiv und müssen ordnungsgemäß entsorgt werden. Die letzten 2 Wäschen kann regelmäßig entsorgt werden.
  10. Einmal trocken, Autoefully wickeln Blot in Frischhaltefolie und setzen auf eine phosphoscreen in einem dicht verschlossenen Kassette über Nacht bei Raumtemperatur.
  11. Analysieren phosphoscreens mit einem Phosphor und Quantifizierung radioaktiver Transkripte.
  12. Zeichnen Sie einen Kreis um jeden radioaktives Signal mit OptiQuant Software. Die Werte grafisch darstellen Digital Light Unit (DLU), um die Replikation Kurven zu generieren.
  13. Um Replikationskapazität Partituren zu erzeugen, waren DLU Werte log 10 -transformierten und Pisten wurden mit dem Tag 2, 4, und 6 Zeitpunkten. Replikation Pisten werden dann durch die Steigung der WT MJ4, um zu generieren Replikationskapazität Noten unterteilt. Es ist wichtig, auf der Grundlage der Werte MJ4 WT aus der gleichen RT Platte erhalten, um Intra-Assay-Variabilität zu reduzieren normalisieren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Um dieses Protokoll, das einen proviralen Plasmid in der Lage, voll funktions Montage, Infektions Gag-Chimären erzeugt MJ4 richtig auszuführen, muss sorgfältig darauf geachtet, die entsprechenden PCR-Produkte erzeugen. Ermitteln, ob die PCR hat den entsprechend großen Gag Amplikon erzeugt wird, ist von entscheidender Bedeutung. Produkte sollten innerhalb von 100 Basenpaaren (bp) von der in 1A dargestellt ca. 1.700 bp Amplikon sein. Die genaue Länge dieses Fragments wird in Abhängigkeit von der gag-Gens zu unter variieren. Als nächstes muß die 5'-Long Terminal Repeat (LTR) Teil des molekularen Klons MJ4 verstärkt und dem gag-Amplikons, um es für die nachfolgende Klonierung geeignet zu machen gespleißt werden. Die MJ4 LTR Amplikon sollte 1.474 bp lang sein. 1B zeigt ein repräsentatives Gel Bild, für das korrekte Band Größen angegeben. Nach der Spleiß-Overlap-Extension-PCR 41, sollte kombiniert LTR- Gag Produktenca. 3200 bp lang, wie in 1C dargestellt.

Sobald das gag-Gen wurde für die Klonierung durch Fusion mit der 5'-LTR von MJ4, die die notwendige NgoMIV Restriktionsstelle enthält, sowohl Vektor-und gag-Einsatz hergestellt worden ist, muß mit NgoMIV und BclI-Restriktionsenzymen verdaut und nach Elektrophorese aus einem Agarosegel ausgeschnitten werden, Trennung. Es ist zwingend notwendig, um die geeigneten Vektor und Insert-Bands herauszuschneiden. Ein repräsentatives Gel wird in 2 gezeigt. Der Vektoranteil der MJ4 Plasmid sollte etwa 10.000 Basenpaare lang sein, während die LTR- gag Einsatz sollte bei etwa 3000 bp lange bleiben, wie die Restriktionsstellen an den äußersten Enden gelegen Das Amplikon. Eine erhebliche Abnahme in der Größe zeigt eine zusätzliche Schnitt-Stelle innerhalb des gag-Gen untersucht.

Nach der Ligation der beiden Fragmente, bakterielle Transformation, einend Isolierung von Plasmid-DNA, müssen die Gag-Chimären MJ4 für entsprechende Größe überprüft werden, indem ein Double-Digest mit NgoMIV und HpaI Restriktionsenzyme. Volllängen-Gag-MJ4 Chimären, die keine Löschereignisse während Bakterienreplikation nicht entstanden sind, eine Beschränkung Muster ähnlich dem in Figur 3 dargestellt, mit zwei Banden von etwa 8.700 und 4.300 bp aufweisen.

Ein wichtiger Unterschied dieses Protokolls im Vergleich zu früheren Ansätzen ist der Einsatz des HIV-1 Subtyp C infektiösen molekularen Klon, MJ4, anstatt die gemeinsame Labor angepasst NL4-3 Virus. Jedoch könnten die im vorangegangenen Abschnitt beschriebenen Ansätze zur Klonierung des Subtyps B gag-Sequenzen in pNL4-3 modifiziert werden.

Eine Optimierung der Multiplizität der Infektion (MOI) für die Verwendung in nachfolgenden Experimenten wurde entwickelt, um die optimale MOI das logarithmische Wachstum einer Mehrzahl der getesteten Viren zeigte wählen geführt.4 zeigt repräsentative Kurven Replikation von drei verschiedenen MOIs (0,01, 0,05 und 0,25) für MJ4 (4A) als auch für NL4.3 (4B). MJ4 repliziert viel weniger effizient als in GXR25 Zellen NL4-3, die wichtig zu berücksichtigen ist, da eine entsprechende MOI für NL4-3 Replikation würde wahrscheinlich zu gering sein, um eine effiziente Replikation MJ4 erkennen. Wie in 4A, mit einer MOI von 0,05 gegenüber 0,01 und 0,25 zu sehen ist, war die optimale Wahl, da logarithmischen Wachstums wurde zwischen den Tagen 2-6 nach MJ4 beobachtet. Für den unteren MOI, 0.01, sind Tag 6 DLU Werte kaum nachweisbar, und wir erwarteten die Erzeugung von Gag-MJ4 chimären Viren, die niedriger als MJ4 repliziert. Daher ist diese MOI nicht erfassen, das Wachstum der abgeschwächter Gag-MJ4 Chimären, die auch die biologisch kritisch sein kann. Darüber hinaus wird eine MOI von 0,25 war nicht ideal, weil die schnelle Kinetik der viralen Replikation eine wesentliche amou getötetnt der Zellen selbst bei Tag 4. Dies bewirkt, daß die Replikation Kurve ein Plateau, und Berechnen einer Neigung auf der Grundlage einer Kennlinie, wie dies die Replikationskapazität unterschätzen. Anhand von Kurven für NL4-3 erzeugt, selbst bei einer MOI von 0,01, erhältlich Zielzellen wurden merklich von Tag 6 nach Infektion erschöpft. Abschließend wird eine MOI von 0,05 wurde als optimal für eine große Gruppe von Gag-MJ4 chimären Viren, die alle hatten diverse gag-Sequenzen und unterschiedlichen Graden der Replikation sein.

Insgesamt 149 Gag-MJ4 chimären Viren des Subtyps C aus akuten Gag Sequenzen abgeleitet wurden für in vitro-Replikation mit diesem Test getestet. Die normierten RC-Werte lagen bei 0,01 bis über 3,5 mit einigen Viren replizieren mehr als 100-mal effizienter als der Wildtyp MJ4. Abbildung 5 zeigt die Replikationslinien von neun Vertreter Gag-MJ4 chimären Viren, die mit Wildtyp MJ4 in rot dargestellt, und zeigt das breite Spektrum der Replikation capacities beobachtet. Somit kann die Sequenz-Diversität innerhalb des gag-Gens allein drastisch beeinflussen die Fähigkeit des Virus zur Replikation in vitro. Während diese Vertreter der Gag-MJ4 chimären Viren von akut infizierten Zambians abgeleitet ist, anderen Subtyp C Sequenzen nicht ausführlich getestet wurde, und können unterschiedliche Replikationskinetik aufweisen. Deshalb muss sorgfältig darauf geachtet werden, um das Trägheitsmoment zu optimieren, um die spezifische Replikation der Viren von einer bestimmten Studie zu entsprechen, denn es kann ein breites Spektrum in der Höhe der Replikation zwischen verschiedenen HIV-1-Backbones und Gag isoliert sein.

Einer der Vorteile der Verwendung eines T-Zell-Linie wie die GXR25 Zelllinie, die die Replikation von MJ4 unterstützt, ist die Reproduzierbarkeit in bezug auf die Replikation beobachtet Experimente mit stimulierten peripheren mononukleären Blutzellen als Targets. In ersten Optimierungsversuche, MJ4 Wildtyp zeigte eine Intra-Assay-Variabilität von 8,7% und Differenznt Klone der gleichen Gag-MJ4 chimären Virus zeigte Variabilität in der Replikation von 8,5%. Da verschiedene Mixe und Master phosphoscreen Einwirkung kann DLU Werte, die in der Größe unterscheiden sich geringfügig zu geben, kann Intra-Assay-Variabilität weiter, indem Sie den gleichen Virus-Standard (in unserem Fall Wildtyp-MJ4) in jedem RT-Testplatte gesteuert werden. Abbildung 6 zeichnet die DLU Werte aus der gleichen MJ4 Infektion abgeleitet, in acht verschiedenen RT-Platten quantifiziert. Normalisierung auf ein Virus, das die für alle RT-Assays können helfen, potenzielle Fehler durch diese leichte Veränderungen in Signalgröße zwischen Assays induzierte mildern.

Interassay variabel wurde auch getestet und Wiederholungen an verschiedenen Tagen wiederholt wurden stark korreliert. Figur 7 trägt den normalisierten RC Scorewerte aus zwei unabhängigen Experimenten etwa ein Jahr auseinandergeführt. Eine hohe Korrelation mit dem Fehlen von großen Ausreißer (R 2 = 0,873) beobachtet wurde zwischen zwei unabhängigen Wiederholungen.

Obwohl stark korreliert, dass eine Schwankung in der Gesamtstärke von Replikationskinetik zwischen den zwei unabhängigen Experimenten. Dies kann teilweise auf der Differenz zwischen den Zahlen von Passagen GXR25 Zellen Bestände in jedem Experiment verwendet zurückzuführen. Im allgemeinen GXR25 Zellen Bestände, für einen Zeitraum von mehr als 6 Monate agiert worden sind, neigen dazu, die effiziente Replikation des Gag-MJ4 Chimären unterstützen. Daher ist es ratsam, die Replikation Kapazität zwischen Gruppen von Chimären innerhalb einer einmonatigen Frist zu beurteilen. Wenn die vorangegangenen Schritte werden genau verfolgt, ist dieser Assay in der Lage, sehr robuste und reproduzierbare Ergebnisse, die für eine breite Palette von Studien.

Figur 1
Abbildung 1. Repräsentative Gel imagES darstellt elektrophoretische Trennung von PCR-Produkten. Für alle PCR-Produkte wurden 5 ul jeder 50 ul Reaktion mit 3 ul 5x Ladepuffer gemischt, in einem 1% Agarose-TAE-Gel mit 1X SYBR-Safe-DNA Gelfärbemittels ergänzt geladen und durch Elektrophorese bei 120 V für 45 min getrennt. Die Promega 1 kb DNA-Leiter (Spur 1) wurde verwendet, um Amplikongrößen. A) Der Gag-Gen wurde aus Virus-RNA mit einer verschachtelten PCR Ansatz amplifiziert nähern. Durch Insertionen und Deletionen, kann der Knebel Amplikon von 1,600-1,700 bp in der Länge variieren und scheint leicht über dem 1500 bp DNA-Leiter Marker. Spuren 2-5 zeigen erfolgreiche gag-Gen-Amplifikation. B) Das 5 'LTR von MJ4 wurde aus dem Wildtyp-Plasmid MJ4 verstärkt und über die elektrophoretische Trennung visualisiert. Spuren 2-5 zeigen erfolgreiche Amplifikation des 1474 bp LTR Produkt, das unter der 1.500 bp DNA-Leiter Marker. C) Die 5R leicht erscheint17; LTR aus Wildtyp-MJ4 abgeleitet und die Gag-Gen aus Patientenplasma verstärkt miteinander über Spleiß-Overlap-Extension-PCR fusioniert sind und über die elektrophoretische Trennung visualisiert. Spuren 2-5 zeigen, die erfolgreich fusionierten Amplikons etwa 3.200 bp groß sind, und die erscheinen etwas oberhalb der 3.000 bp DNA-Leiter Marker.

Figur 2
Abbildung 2. Repräsentative Bild Gel darstellt elektrophoretische Trennung von Restriktionsverdau zur Klonierung von Genen in Patienten gag MJ4. Wildtyp-Plasmid und MJ4 LTR- gag-Fusionsprodukte wurden mit BclI 1,5 h bei 50 ° C und NgoMIV für 1 h bei 37 ° verdaut C. Vektor und Insert-Fragmente wurden durch elektrophoretische Auftrennung auf einem 1% Agarose-TAE-Gel mit 1X SYBR-Safe-DNA g ergänzt visualisiertel Fleck bei 100 V für 2 h und mit einer blauen Lichtbeleuchtung, um die UV-induzierte DNA-Schäden zu reduzieren. Die Vektor und Insert-Fragmente für die anschließende Klonierung Schritte erscheinen bei ca. 10.000 bp und 2.900 bp.

Figur 3
Abbildung 3. Repräsentative Gel Bild, das die elektrophoretische Trennung von Restriktionsverdauen gereinigtes Gag-MJ4 Plasmid-DNA-Chimäre. Gereinigtes Gag-MJ4 Chimäre Plasmid-DNA wurde mit NgoMIV doppelt verdaut und HpaI-Restriktionsenzymen für 2 h bei 37 ° C aufweist. Restriktionsverdaus wurden durch elektrophoretische Auftrennung auf einem 1% Agarose-TAE-Gel mit 1X SYBR-Safe-DNA-Gel-Färbung für 45 min bei 120 V ergänzt visualisiert. Plasmide ohne große Deletionen wird auf zwei verschiedene Banden bei ca. 8.700 und 4.300 bp zu lösen.


Abbildung 4. Replikation von MJ4 und NL4-3 Isolate von HIV-1 in der GXR25 Zelllinie bei verschiedenen Multiplizitäten der Infektion (MOI). 5 x 10 5 Zellen wurden infiziert GXR25 wie in dem Verfahren Protokoll mit 5-fach erhöht Innenministeriums beschrieben jeder Virus Lager. Überstände wurden an den Tagen 2, 4, 6 gesammelt und 8 nach der Infektion und Virion-Produktion wurde über einen radioaktiv markierten Reverse-Transkriptase-Assay quantifiziert. Infektionen wurden dreifach durchgeführt und Fehlerbalken bezeichnen die Standardabweichung für die drei Wiederholungen. (A) MJ4 (B) NL4-3.

Figur 5
Abbildung 5. Repräsentative Bereich der Replikation für verschiedene Gag-MJ4 Chimären. 5 GXR25 Zellen wurden mit Wildtyp-MJ4 oder Gag-MJ4 Chimären mit einer MOI von 0,05 infiziert wurden die Überstände in Intervallen von zwei Tagen nach der Infektion gesammelt und Virionproduktion von einer radioaktiv markierten quantifiziert RT-Test. Einfügen von verschiedenen Subtyp C abgeleitet gag-Gene kann einen dramatischen Einfluss auf die Replikationskapazität von MJ4. Wildtyp-MJ4 Replikation ist rot gekennzeichnet.

Figur 6
Abbildung 6. Vergleich der Intra-Assay-Variation in der radioaktiv markierten Reverse-Transkriptase-(RT)-Assay Quantifizierung. Die Grafik zeigt inhärenten Intra-Assay-Variabilität durch Auftragen der DLU-Werte der gleichen Überstände aus einer Wildtyp-Infektion MJ4 in acht verschiedenen RT-Test Platten. Die Variation der Kurven spiegelt die leichte Veränderungen in Signalgröße Wetteschen Platten, die durch Ausführen eines Standard auf jedem RT Platte, die später verwendet werden können, um die Hänge des Gag-MJ4 Chimären auf der gleichen Platte getestet normalisieren korrigiert werden kann.

Figur 7
Figur 7. Die Reproduzierbarkeit des Replikationstest über die Zeit in der GXR25 Zelllinie. Die gleichen Gag-MJ4 chimären Viren wurden verwendet, um Zellen zu infizieren GXR25 in zwei unabhängigen Experimenten durchgeführt, etwa ein Jahr auseinander. Replikation Partituren wurden durch Berechnung der Steigung von log-transformierten DLU Werte und die Normalisierung dieser Hang zu Wildtyp-MJ4 erzeugt. Gag-MJ4 Chimären, die effizienter replizieren als Wildtyp-MJ4 haben Replikations Partituren größer als 1, und diejenigen, die weniger effizient replizieren als Wildtyp-MJ4 haben Replikations Noten weniger als 1. Die beiden unabhängigen Messungen stark korreliert sind (R 2 = 0,87, lineare Regression) und markieren die Reproduzierbarkeit des Tests zu unterschiedlichen Zeiten und mit Zellen in verschiedenen Durchgängen durchgeführt.

A)

Reagens Volumen für 1x Reaktion (ul)
2x Reaction Mix (Invitrogen) 25
Nuklease-freies H 2 O 17
Forward-Primer GOF (20 uM Konzentration) 1
Reverse-Primer Vifor (20 uM Konzentration) 1
Superscript III Ein-Schritt-Enzym-Mix 1
RNA-Matrize 5
Gesamtvolumen 50

B)

Anzahl der Zyklen Zeit (h: min: sec) Temperatur (° C)
1 01.00.00 50
1 02.00 94
10 00.15 94
00.30 56
05.00 68
40 00.15 94
00.30 56
5.00 + 5 sec / Zyklus 68
1 12.00 68
1 4
Ende

Tabelle 1. A) Master-Mix und B) Erstrunden-Gag Verstärkung. * Anmerkung: GOF-Primersequenz: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor Primersequenz: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reagens Volumen für 1x Reaktion (ul)
Nuklease-freies H 2 O 35,5
5x Phusion HF Buffer 10
dNTPs (40 mM Desoxynukleotiden) 1
Forward-Primer GagInnerF1 (20 uM Konzentration) 1
Reverse-Primer BclIDegRev2 (20 uM Konzentration) 1
Phusion Hot Start Polymerase II 0,5
Erstrunden-PCR als Template 1
Gesamtvolumen 50

B)

Anzahl der Zyklen Zeit (h: min: sec) Temperatur (° C)
1 00.30 98
29 00.10 98
00.30 53
01.00 72
1 10.00 72
1 4
Ende

Tabelle 2. A) Master-Mix und B) Thermocycler Bedingungen für verschachtelte zweiten Runde Gag Verstärkung. * NAnmerkung: GagInnerF1 Primer-Sequenz: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 Primersequenz: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reagens Volumen für 1x Reaktion (ul)
Nuklease-freies H 2 O 35,5
5x Phusion HF Buffer 10
dNTPs (40 mM Desoxynukleotiden) 1
Forward-Primer MJ4For1b (20 uM Konzentration) 1
Reverse-Primer MJ4Rev (20 uM Konzentration) 1
Phusion Hot Start Polymerase II 0,5
MJ4 Plasmid als Matrize (10 ng / ul) 1
Gesamtvolumen 50

B)

Anzahl der Zyklen Zeit (h: min: sec) Temperatur (° C)
1 00.30 98
29 00.10 98
00.30 58
00.45 72
1 10.00 72
1 4
Ende

Tabelle 3. A) Master-Mix und B) Bedingungen für Thermocycler 5 'LTR MJ4 Verstärkung. * Anmerkung: MJ4For1b Primersequenz: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev Primer-Sequenz: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reagens Volumen für 1x Reaktion (ul)
Nuklease-freies H 2 O 34,5
5x Phusion HF Buffer 10
dNTPs (40 mM Desoxynukleotiden) 1
Forward-Primer MJ4For1b (20 uM Konzentration) 1
Reverse-Primer BclIRev (20 uM Konzentration) 1
MJ4 LTR 1,3 kb Amplikon (gereinigt, ~ 50 ng) 1
Phusion Hot Start Polymerase II 0,5
Gag-Amplikon (Gel gereinigt, ~ 100 ng) 1
Gesamtvolumen 50

B)

Anzahl der Zyklen Zeit (h: min: sec) Temperatur (° C)
1 00.30 98
29 00.10 98
00.30 58
01.30 72
1 10.00 72
1 4
Ende

Tabelle 4. A) Master-Mix und B) Thermocycler Bedingungen für Spleiß-Overlap-Extension-PCR, um LTR- Gag Einsätze erzeugen. * Hinweis: BclIRev Primer-Sequenz: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reagens Volumen für 1x Reaktion (ul) Inkubationszeit (hr) Inkubation Temperatur (° C)
1,5 ug von 3 kb LTR- Gag Amplikon oder MJ4 Plasmid x ul 1,5 ug
NEB CutSmart Buffer (vorher NEB Puffer # 4) 2
BclI Restriktionsenzym 1
Nuklease-freies H 2 O x
Gesamtvolumen 19 1,5 50
NgoMIV Restriktionsenzym 1
Gesamtvolumen 20 1 37

B)

Reagens Volumen für 1x Reaktion (ul) Inkubationszeit (hr) Inkubation Temperatur (° C)
50 ng Plasmid-Vektor geschnitten MJ4 x ul für 50 ng
45 ng Schnitt LTR- Gag Einsatz (Verhältnis 3: 1) x ul für 45 ng
Roche 10x Ligasepuffer 2
Roche T4 DNA-Ligase (5 U / ul) 1
Nuklease-freies H 2 O
Gesamtvolumen 20 18 Jahre alt (über Nacht) 4

C)

Reagens Volumen für 1x Reaktion (ul) Inkubationszeit (hr) Inkubation Temperatur (° C)
450 ng Plasmid-Gag-MJ4 x ul 450 ng
NEB CutSmart Buffer (vorher NEB Puffer # 4) 2
NgoMIV Restriktionsenzym 0,5
HpaI Restriktionsenzym 0,5
Nuklease-freies H 2 O x
Gesamtvolumen 20 2 37

Tabelle 5) Einschränkung verdauen Master-Mix und B) Ligationsreaktion zur Erzeugung von Gag-MJ4 chimären Provirus. C) Diagnose Restriktionsverdau zu Gag-MJ4 Klonen Treue zu gewährleisten.

Primer-Name Nukleotid-Sequenz (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabelle 6. Liste der Sequenzierprimer notwendig, 5 'LTR und gag-Sequenz Identität des Gag-MJ4 chimären Provirus bestätigen.

Ein gut 8 ul-Virus + 232 ul 1% FBS in DMEM
Nun B 80 ul von Gut A + 160 ul 1% FBS in DMEM
Nun C 80 ul von Gut B + 160 ul 1% FBS in DMEM
Nun D 80 ul von Gut C + 160 ul 1% FBS in DMEM
Nun E 80 ul von gut 160 ul D + 1% FBS in DMEM
Nun F 80 ul von gut E + 160 ul 1% FBS in DMEM

Tabelle 7. Verdünnungsschema (3-fach) für Titern infektiöser Viren auf TZM-bl-Zellen.

A)

Reagens Volumen
PBS ohne Ca 2 + oder Mg 2 + 500 ml
Glutaraldehyd 4 ml
Formaldehyd 11 ml

* Hinweis: Lagerung bei 4 ° C.

B)

Reagens Volumen
PBS ohne Ca 2 + oder Mg 2 + 4,75 ml
Kaliumferricyanid (0,2 M) 100 ul
Kaliumferrocyanid (0,2 M) 100 ul
Magnesiumchlorid (1 M) 20 ul
X-Gal (50 mg / ml) 40 ul

* Hinweis: Stellen Sie frisch und weg vom Licht bis zur Verwendung.


C.

Original Verdünnung gut Ein B C D E F
Volumen-Virus (ul) in die Vertiefungen einer 24-Well-Platte Zeile hinzugefügt 5 1.6667 0,5556 0,1852 0,06173 0,02057

Tabelle 8. A) B) Befestigungslösungen für Titerung von Gag-MJ4 chimären Viren auf der TZM-bl Indikator-Zelllinie. C) Das Volumen des Virus pro Vertiefung für die Berechnung der infektiösen Einheiten / ul.

Reagens Volumen
Fötalem Rinderserum (FBS), definiert 55 ml
Penicillin, Streptomycin, Glutamin (100x) 6 ml
HEPES-Puffer (1 M) 6 ml

Tabelle 9. Rezept für komplette RPMI-Medium für die Ausbreitung der GXR25 Zellen.

Reagens Volumen (ml)
Nuclease-freiem H 2 O 419,5
Tris-Cl, pH 7,8 (1 M) 30
Kaliumchlorid (1 M) 37,5
Magnesiumchlorid (1 M) 2.5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1,02
Polyadenylsäure, Kaliumsalz (2 mg / ml) 1,25
Oligo-dT-Primer (25 ug / ml) 3,25
Gesamtvolumen 500

Tabelle 10. Rezept für radioaktiv markierten Reverse-Transkriptase-Test Master-Mix. * Hinweis: Shop als 1 ml Aliquots bei -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aufgrund der Länge und die Art der diesem Protokoll gibt es mehrere Schritte, die für die sowohl die erfolgreiche Konstruktion von chimären Gag-MJ4 Plasmide als auch für die Quantifizierung der viralen Replikationskapazität sind. Obwohl das Restriktionsenzym basierte Klonen Strategie für die Einführung von Fremdgenen in MJ4 Gag in diesem Protokoll beschriebenen hat zahlreiche Vorteile gegenüber bisher verwendeten Rekombination basierte Methoden, kann das Protokoll technisch eine Herausforderung sein, wenn kritische Schritte nicht genau befolgt.

Erstens ist es absolut notwendig, MJ4, die in einem kompetenten Bakterienstamm fehlt das DCM und Damm DNA Methylasen erzeugt wurde Plasmid-DNA zu verwenden. Dies ist notwendig, da die enzymatische Aktivität des BclI Restriktionsendonuklease, die verwendet wird, um gag-Gene in das Rückgrat MJ4 klonieren, ist die Mutter / DCM Methylierung empfindlich. Die JM110 und SCS110 (ein endA negativen JM110-Derivat) E. coli-Stämme einWieder zur Erzeugung unmethylierte MJ4 Plasmid-DNA. Zusätzlich für die Exzision von Vektor und Insert-Bands, ist es sehr empfehlenswert, dass ein blauer Lichtbeleuchtung zur Visualisierung verwendet werden. Dies wird UV-Wellenlängen-abhängigen DNA-Schäden zu reduzieren und die Effizienz drastisch erhöhen Klonen. Wenn ein blauer Lichtbeleuchtung nicht verfügbar ist, kann das Klonen Effizienz durch Visualisierung DNA mit SYBR Sicherer DNA-Gel Fleck anstelle von Ethidiumbromid und Minimierung der UV Belichtungszeit maximiert werden.

Schließlich hat die molekulare Klonierung mit großen (> 10 kb) und / oder retroviralen Plasmide wie MJ4 traditionell aus einer Vielzahl von Gründen schwierig. Große Plasmide reduzieren Transformationeffizienz von kompetenten Bakterienstämme 42 während retroviralen Inserts, die lange terminale Wiederholung (LTR)-Sequenzen, reduzieren die Stabilität des Plasmids und des Kompromisses Replikationsgenauigkeit der Plasmid-DNA in den bakteriellen Wirt, die zu Deletionen des retroviralen Genoms enthalten 43 E. coli-Stamm über die Stämme DH5a, in unseren Händen. Aufgrund der instabilen Natur des Plasmids sollte gereinigte Plasmid Produkte immer die korrekte Größe Plasmid durch Restriktionsenzym-Verdau überprüft werden; Hier wird eine doppelte Verdauung mit den NgoMIV und Restriktionsendonucleasen HpaI bei 37 ° C für 2 Stunden.

Nach erfolgreichen Generation von chimären Gag-MJ4 Plasmide erreicht wurde, wird Virus über die Transfektion von 2 erzeugt93T Zellen, auf einer Indikator-Zelllinie, TZM-bl-Zellen, und die Replikation Kapazität titriert wird mit einem CEM-basierte T-Zelllinie gemessen. Die CEM-basierte GXR25 Zelllinie für diese Replikationsstudien verwendet wird, ist eines der wenigen etablierten T-Zelllinien in der Lage, um den Eintritt und die Replikation von CCR5-tropen Stämme von HIV-1 zu unterstützen. Dies wurde durch retrovirale Transduktion erreicht worden, um eine stabile Expression des menschlichen CCR5 37 zu ermöglichen. Diese Zelllinie natürlich exprimiert CXCR4 und die Replikation von CXCR4-tropen HIV-1, wie die Labor-adaptierten Stamm NL4-3 unterstützen. Um jedoch zu unterstützen effiziente Replikation von CCR5-tropen Stämmen wie MJ4 müssen die GXR25 Zellen für nicht weniger als 4 Monate vor der Infektion vermehrt werden. Richtig agierten Kulturen können die Replikation auch nach Passage für bis zu 1 Jahr zu unterstützen. Eine sorgfältige Überwachung der CCR5-trop Replikation in Passage ist von wesentlicher Bedeutung für eine erfolgreiche Experimente.

Wie bei jedem Verfahren, gibt es Einschränkungen bei der ProProtokoll, die berücksichtigt werden müssen. Aufgrund der Lage von Restriktionsstellen in der MJ4 Plasmid als auch die Verfügbarkeit von konservierten Restriktionsstellen in natürlich vorkommenden HIV-1-Isolate, ist die 3 'distalen Restriktionsstelle, BclI, 137 Nukleotide von dem Gag Stop-Codon entfernt. Obwohl dies erzeugt einen chimären Protease-Gens, ist diese Region 96,5% in dieser Kohorte erhalten, und wir haben nicht eine Fülle von toten oder defekt chimären Viren zu beobachten.

Einer der Vorteile der Verwendung des MJ4 Subtyp C infektiösen molekularen Klon mit Subtyp C abgeleitete Sequenzen ist, dass es das Risiko einer suboptimalen Gen gag Paarung zwischen Genen und Backbone Vektoren verschiedener Subtypen reduziert. Eine bestimmte Menge an in-Stamm Vielfalt besteht jedoch, wie durch die Clusterbildung von HIV-1-Sequenzen nachgewiesen Land oder die Region, als auch innerhalb der gleichen Untertyp 31 gefunden. Dies könnte zu suboptimalen Paarung beitragen zwischen die gag-Gene dervon akut infizierten Sambia und der molekularen Infektions MJ4 Klon Rückgrat, das von einer chronisch infizierten Person aus Botswana 38 abgeleitet wurde Ived. Jedoch eine Mehrheit der untersuchten Konstrukte infektiösen Nachkommenviren. Da verschiedene HIV-1 Subtyp C infektiösen molekularen Klone weiter verbreitet zu werden, wird es wichtig sein, dieses System weiter zu validieren durch Klonierung in diesen HIV-1 Subtyp C gag-Gene in andere Backbones, um sicherzustellen, dass es eine minimale Verzerrung aufgrund eingeführt Rückgrat zu Unverträglichkeiten.

Die GXR25 Zelllinie ist eine einzigartige Zelllinie, die speziell wegen seiner Fähigkeit, sowohl CXCR4 und CCR5-trop-Stämme und ihre HIV-1 induzierbare GFP-Reporter 37 unterstützt. Es gibt jedoch einige Einschränkungen und sollte sorgfältig, bevor Sie diese Zelllinie für die Experimente aus diesem Protokoll angepasst betrachtet werden. Die GXR25 Zelllinie nicht erscheint, um den Eintritt einer Mehrheit von Subtyp C oder A, CCR5-trop, PR-Unterstützungimary Isolate, die wir getestet haben. Zusätzlich ist die Mutter CEM-Zelllinie, von der die GXR25 Zellinie hohe Cyclophilin A, die bis zu 2 abgeleitet weist 4-fach höhere Expression als die Jurkat-Zelllinie 44. Aufgrund der hohen Niveaus von Cyclophilin A, die Replikationsdefekt üblicherweise mit kanonischen HLA-B * 57 zugeordnet Flucht Mutation, T242N, was zu einer verringerten Fähigkeit von Kapsid zurückzuführen ist Cyclophilin binden, verknüpft sind, können nicht leicht in diese bestimmte Zelllinie nachgewiesen werden 25. Damit der CEM-Zelllinie basiert GXR25 ist nicht ideal für die Untersuchung der Replikation Defekte mit Mutationen in der HIV-1-Capsid-Cyclophilin-bindenden Schleife verbunden.

Schließlich, während dieses Protokoll ist für die Analyse der Replikationskapazität des gag-Sequenzen aus akutem Zeitpunkten abgeleitete Modifikationen müssen, um die Replikationsfähigkeit der gag-Gene von chronisch infizierten Individuen abgeleitet studieren werden. Dieses Protokoll beinhaltet die Uhrfachung der Bevölkerung Sequenzen aus akuten Zeitpunkten (Median 45 Tage pfosten geschätzten Datum der Ansteckung), wenn virale Vielfalt ist begrenzt. Das gag-Gen von jeder Chimäre wird dann sequenziert und verglichen mit der Anfangspopulation PCR-Amplikon zu gewährleisten Klonierung Treue. Angesichts des begrenzten Sequenzdiversität bei akuten Zeitpunkten, ist das Klonen von PCR-Produkten Bevölkerung möglich. Innerhalb der viralen Quasi-Spezies aus einem chronisch infizierten Individuum existiert jedoch Sequenzdiversität; Deshalb, um, genau zu beurteilen, die Replikation Kapazität der chronischen Quasispezies, müssen einzelne Genom Verstärkung eingesetzt werden, um mehrere repräsentative Varianten zu erfassen. Jede dieser Varianten ist dann für die in vitro-Replikation untersucht werden.

Diese Technik hat mehrere breitere Anwendungen, die von den Vorteilen gegenüber bestehenden Verfahren stammen. Da dieser Prozess führt zu einer klonalen Replikation zuständigen Plasmid, ist es einfach, für zusätzliche Konstrukte m verwendenutagenesis Studien, die helfen können, um die Beiträge der spezifischen Resten, die virale Replikation aufzuklären. Ferner kann durch Klonieren in gag-Gene von longitudinalen Zeitpunkten kann man die Entwicklung der viralen Replikationsfähigkeit im Laufe der Zeit zu bewerten, und wie diese Änderungen Pathogenese bei einem HIV-1 infizierten Individuums beeinträchtigen.

Diese Technik kann, um seine Nützlichkeit für verschiedene Anwendungen modifiziert werden, erweitern. Zusätzliche HIV-1-Virusproteine ​​können in das Plasmid MJ4, um ihre Wirkungen auf eine virale Replikation oder deren Interaktion mit Wirtsproteinen zu bewerten konstruiert werden. Dies kann durch gentech zusätzliche Restriktionsstellen an gewünschten Regionen im Genom durch Einführung von stillen Nukleotidaustausche erfolgen. Allerdings muss besondere Beachtung, wenn die Konstruktion neuer Restriktionsstellen in der 3'-Hälfte des HIV-1-Genoms, wie viele Hilfsproteine ​​werden in alternativen Leserahmen kodiert wird, und Änderungen in einem stillen entnommen werdenProtein könnte zu Aminosäuresubstitutionen in einer anderen führen. In diesem Fall Restriktionsstelle unabhängig Klonierungsverfahren wie die von Dudley et al. 45 kann diese Einschränkung zu überwinden. Virussequenzen aus verschiedenen Populationen stammen können unterschiedliche Bereiche der Replikationskapazität aufweisen, und die MOI entsprechend, um die Mehrheit der viralen Isolate in ihrer logarithmischen Wachstumsphase zu erfassen eingestellt werden. Schließlich wird die GXR25 Zellinie wurde stabil mit GFP unter einem LTR-driven, Tat-induzierbaren Promotors transfiziert, und die Virusausbreitung in Abhängigkeit von GFP-positiven Zellen durch Durchflußzytometrie 37 als Alternative zu dem RT-Test oder hier beschrieben gemessen werden ein traditionelles p24 ELISA.

Abschließend bietet das Protokoll eine effiziente und leistungsfähige Technik für die Beurteilung der HIV-1-Virusreplikation, wie durch die gag-Gen, die eine konservierte Strukturprotein notwendig für die richtige Virionbildung codiert übertragen, Angehenden, Reifung und Demontage 46-48. Außerdem erzeugt dieses Verfahren einen replikationskompetenten klonalen Plasmid, das ideal für die Mutagenese Studien und stellt somit ein Verfahren zur Aufklärung der spezifischen Aminosäure Determinanten der viralen Fitness. Studien wie diese sind zwingend notwendig, um das Verständnis, wie Immungetriebenen viralen Evolution betrifft Pathogenese und Progression der Erkrankung bei HIV-1-infizierten Personen zu verbessern.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Einem Restriktionsenzym basierte Klonen Methode, um das Beurteilen<em&gt; In-vitro-</em&gt; Replikation Kapazität von HIV-1 Subtyp C-Gag MJ4 chimären Viren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter