Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

הגבלת אנזים מבוסס שיבוט שיטה להערכה doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

קביעת שני המארח ומאפיינים נגיפיים המשפיעים על הפתוגנזה HIV-1 והתקדמות מחלה היא בעל חשיבות עליונה לעיצוב חיסון רציונלים. התגובה החיסונית התאית היא מרכיב מרכזי של התגובה החיסונית האנושית לזיהום HIV-1. לימפוציטים מסוג T ציטוטוקסי (CTL) נחוצים לשליטה הראשונית של viremia החריף, ולאפשר למארח להקים מדינה יציבה (נקודת סט) עומס נגיפי 1,2. דלדול ניסיוני של תאי מפעיל אלה גורם לאובדן שליטה הנגיפית 3,4. למרות זאת, לברוח מוטציות להתעורר בתוך הגנום הנגיפי שלחתור תחת הכרת CTL של תאים נגועים בנגיף 5-9.

אללים HLA מסוימים נקשרו עם עומס נגיפי נמוך והתקדמות מחלה איטית יותר כולל B * 57, B * 27 וB * 81 10-15. חלק מהיתרון המגן שלי אללים כיתת HLA ניתן לייחס לעובדה שהם ממקדים אזורים מוגבלים מבחינה תפקודית של הגנום כגון איסור פרסוםובחר למוטציות בריחה שתקטנה את יכולתו של הנגיף לשכפל במבחנה 16-21. למרות בריחה מהמערכת החיסונית התאית מועילה לווירוס בהקשר של מעמד HLA הבחירה אני אלל, את ההשפעה של מוטציות אלה עלולות להיות השלכות ההפרש למארח על העברת ל22,23 פרט HLA-תואם. לכן, הבנת ההשפעות של מוטציות הבריחה הקשורים HLA מועברים על יכולת שכפול נגיפית תהיה חשובה כדי לקדם את ההבנה של הפתוגנזה HIV-1 המוקדמת שלנו.

בעוד הרבה הושג התקדמות לזהות ולאפיין את פגמי הכושר של מוטציות בריחה בודדות הקשורים ספציפי כיתת HLA אני אללים של 24-29, מתרחשות באופן טבעי HIV-1 מבודד שעקבות ייחודיות ומורכבות של פולימורפיזם הקשורים-HLA, סביר הנובעת מHLA לחץ חיסוני בתיווך של רקעי immunogenetic שונים 30. בapניתוח revious, Goepfert et al. הראה כי הצטברות של המוטציות הקשורות-HLA ברצפי Gag מועברים נגזרים מ88 Zambians חריפות הנגוע הייתה קשורה לירידה בעומס נגיפי נקודת סט ביום 31 ב. זה הציע שהשידור של מוטציות בריחה מזיקות, במיוחד בGag, לנמעני HLA-תואם מספק תועלת קלינית, ויכול להיות בגלל נחלש שכפול נגיפי. במבט קדימה, זה הכרחי כדי ללמוד כיצד מורכב שילובים של פולימורפיזם Gag בתוך מבודדים באופן טבעי פועל בתיאום להגדיר מאפיינים של הנגיף מועבר כגון יכולת שכפול, ואיך שכפול מוקדם עשוי בתורו משפיע על HIV-1 פרמטרים קליניים ושלב מאוחר פתוגנזה.

ברוקמן et al. הפגין קשר בין יכולת השכפול של רצפי איסור פרסום-פרו מבודדת במהלך זיהום כרוני במה ועומס נגיפי בשני C תת הסוג B ודלקות ראשון32-35. יש הגישה הניסויית שהוצגה במחקרים אלה, אם כי מתאים לבחינת יכולת שכפול במבחנה של רצפים נגזרים מאנשים נגועים כרוני, כמה אזהרות טכניות ומגבלות ההופכות את לימוד HIV-1 קיבולת replicative בתת הסוג C יחידים בחריפות נגוע קשה. שיטה זו מסתמכת על רקומבינציה של רצפים מוגברים-PCR מבוסס אוכלוסייה לprovirus B NL4-3 תת הסוג, שנגזר בחלקו מLAV, מעבדה מותאמת מניות וירוס 36. דור וירוס בוצע על ידי שיתוף transfection של קו T-cell מבוסס CEM 37 עם amplicons PCR ומתעכל delta- איסור פרסום-פרו NL4-3 DNA. שיטה זו מחייבת תוצאה של וירוס על פני תקופה של שבועות עד חודשים, שעלול להיות שהטתה את האופי של מניות הווירוס התאוששו ביחס לquasispecies הנגיפי in vivo, ולכן שינוי המדידה שיכולת שכפול במבחנה. אני בשיטה זוזה מתאים יותר ללימוד אנשים נגועים כרוני, שבו בצורה יעילה בוחר לוירוס עם קיבולת replicative הגבוהה ביותר, ושבו שיבוט גרסאות נגיפיות שונות רבות ממספר גדול של אנשים באופן כרוני הנגועים הוא עבודה די אינטנסיבי ולכן לא ריאלי. עם זאת, בתוך פרט בחריפות נגוע, יש בדרך כלל 1:59 גרסאות הנוכחיות, ובכך מבטל את הסיכון של עיקום הטבע של מניות הווירוס התאוששו, דרך לחצי בחירה במבחנה, מאפשר להערכה מדויקת יותר של במבחנה שיכולת שכפול. שנית, שיטה זו דורשת recombining רצפי איסור פרסום-Pro C תת סוג לתוך עמוד השדרה נובעת תת סוג B, ויכולה להציג את ההטיות אי התאמת עמוד השדרה לניתוח. בשל מגבלות אלה, מספר רב של רצפים חייב להיות מנותח על מנת להתגבר על כל הטיות אפשריות הציגו.

כאן אנו מתארים appro הניסיוני חלופיACH המתאים ללימוד רצפים נגזרים מאנשים C תת סוג נגוע בחריפות. אנו משתמשים באסטרטגית שיבוט מבוסס אנזים הגבלה להציג את גן איסור הפרסום נובע מנקודות זמן זיהום חריפות של אנשים נגועים תת סוג HIV-1 C לתוך עמוד השדרה proviral C תת הסוג, MJ4. השימוש בMJ4 כעמוד השדרה נפוצה בה כדי לשכפל גני איסור פרסום הוא קריטי לניתוח רצפים נגזרים תת סוג C. MJ4 נגזר מבודד עיקרי 38, וכך יהיה פחות סיכוי להציג את ההטיה בשל אי התאמה בין תת עמוד השדרה וגן איסור פרסום. בנוסף, הגישה של שימוש בשיבוט הגבלה מבוססת אנזים מאפשרת לproviral בונה להיות transfected ישירות לתוך תאי 293T, ולהתאוששות של מניות וירוס משובטים הזהה לרצף איסור הפרסום המשובט.

השיטה המובאת להלן היא שיטת תפוקה גבוהה להערכת יכולת השכפול של C תת סוג נגזרה Gag-MJ4וירוסי chimeric. Transfection לתוך תאי 293T הוא פשוט וההתאוששות של וירוס לוקחת רק שלושה ימים. במבחנה יכולת שכפול assayed על הקו זהה CEM-CCR5 מבוסס T-cell שנוצר על ידי et ברוקמן אל. 37, אבל באמצעות שינויים בפרוטוקול חשובים נחוצים לשכפול המוצלח של וירוסי chimeric תת סוג C MJ4. השימוש בקו T-תא מתאים ולא PBMCs מאפשר למספר גדול של וירוסי MJ4-chimeric C תת הסוג להיבדק עם שחזור הגבוה assay. לבסוף, באמצעות assay טרנסקריפטאז radiolabeled לכימות של וירוס בsupernatant הוא יותר חסכוני מאשר באמצעות ערכות ELISA p24 הזמינים מסחרי. זה גם נותן טווח דינמי גבוהה יותר, מה שהיה חשוב לאיתור שני הווירוסים משכפלים גרוע ומאוד בתוך אותו assay ולאיתור הבדלים דקים בשכפול בין בידודים.

לסיכום, השיטה המוצגת כאן אפשרה להמחקר המעמיק של יכולת השכפול של רצפי איסור פרסום נובעים מתת הסוג HIV-1 C בחריפות אנשים נדבק מזמביה, וכפי שנכתב, יכול גם להיות מורחב כדי ללמוד תת סוג אחר C נגוע אוכלוסיות. רמה גבוהה של שונות ביכולות שכפול בין בידודי Gag השונים נצפתה. בנוסף, הצלחנו להראות קשר סטטיסטי בין יכולת השכפול של Gag המשודר ועומס נגיפי נקודה שנקבעה, כמו גם עם CD4 + ירידה על פני תקופה של שלוש שנות 39. תוצאות כאלה מדגישות את החשיבות של לימוד מאפיינים נגיפיים איך לשדר, כמו שיכולת שכפול, אינטראקציה עם המערכת החיסונית המארח להשפיע פתוגנזה במהלך הזיהום המוקדם ותהיה נפרד לפיתוח התערבויות חיסון יעילים, כמו גם טיפול.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

.1 הגברה של ג'ין איסור הפרסום HIV-1 ממאשרום, קפוא פלזמה

  1. לחלץ רנ"א נגיפי מ140 μl המופשר HIV-1 בפלזמה נגועה באמצעות ערכת חילוץ.
    1. כאשר אפשרי, מייד להמשיך סינתזת cDNA לאחר מיצוי RNA כרנ"א הנגיפי יצא מן ההקפאה מניב את התוצאות הטובות ביותר ההגברה. במידת האפשר, להקים תמהיל אב PCR להגברת DNA בסיבוב הראשון ולאחסן ב 4 ° C לפני מיצוי רנ"א נגיפי.
  2. Reverse-לתמלל cDNA מRNA ולהגביר מוצרי DNA-סיבוב הראשון באמצעות הפוך transcriptase וDNA פולימרז thermostable בצעד אחד RT-PCR.
    1. קח RNA מתוך -80 מקפיא C ° (אם ההקפאה הייתה צורך) והפשרה קצרה בטמפרטורת חדר ואז למקם בבלוק קר. העברה 5 μl של רנ"א על ​​צינור אחד PCR המכיל 45 μl של תערובת הורים לתת נפח סופי של μl 50. מייד למקום שנותר דגימות RNA למקפיא -80 מעלות צלזיוס.
    2. לאחר האנזים הואdded לסיבוב הראשון תמהיל PCR הראשי (לוח 1 א), aliquot 45 μl לתוך צינור אחד PCR הגברה דק דופן למספר התגובות הרצויות. הקפד להשתמש בצינורות PCR עם כובעים בודדים ולא להפשיט כובעים כדי להבטיח זיהום צולב מינימאלי בין דגימות. מניחים צינורות PCR בבלוק קר כדי להגן על תבנית האנזים וRNA הטמפרטורה רגישה RT. הערה: דוגמאות יש להפעיל בשלושה עותקים כדי לטעום כראוי quasispecies ויראלי. כמו כן, חשוב לנצל את מוצר עם אנזים DNA פולימרז איכות גבוהה על מנת למזער misincorporation הציג-PCR. נא עיין ברשימת חומרים כימיים למוצר המומלץ.
    3. לאחר תבנית RNA נוסף לכל צינורות התגובה, להעביר צינורות PCR לthermocycler להגברת שימוש בתכנית Cycler המתואר בטבלה 1 ב '. הערה: המוצר של הגברה זה ישמש בסיבוב שני מקונן PCR.
  3. בצע מקונן seמנצח בסיבוב ההגברה PCR, באמצעות 1 μl של ההגברה הסיבוב הראשונה PCR (1.2) כתבנית DNA.
    1. Aliquot 49 μl של סיבוב השני תמהיל PCR הראשי (לוח 2 א) על צינור אחד PCR דק דופן למספר התגובות הרצויות. העברת 1 μl מהסיבוב הראשון ההגברה PCR לצינור כל תגובה לתת נפח סופי של μl 50. הערה: זה ישמש DNA תבנית כלהגברה בסיבוב השני. כמו כן, חשוב לנצל DNA פולימרז עם יכולות נאמנות והגהה גבוהות מאוד על מנת למזער misincorporation הציג-PCR. נא עיין ברשימת חומרים כימיים למוצר המומלץ.
    2. העבר את הסיבוב שני לערבב PCR תגובה לthermocycler ולהפעיל תכנית המתוארת בטבלה 2 ב. הערה: לאחר השלמת התכנית, המוצרים של תגובה זו יהיה לרוץ על ג'ל agarose כדי לאשר את הייצור של מוצר.
  4. הוסף 3 μl של צבע טעינת 5x עד 5 & #181; l של 50 μl בסיבוב שני נפח התגובה ולהפעיל ב120 V על 1% agarose ג'ל-TAE מכיל כתם DNA UV-ניאון עד להקות נפתרות. דמיין 1.6 להקות kb בפנס אור כחול (ראה איור 1 א).
  5. הפעל נותר 45 μl נפח תגובה על 1% agarose ג'ל-TAE מכיל כתם DNA, ותחתוך את הלהקות המתאימות בסכין גילוח נקי.
    1. לחלץ דנ"א מפרוסת ג'ל באמצעות ערכת טיהור ג'ל, elute במי nuclease חינם, לשלב שלוש תגובות חיוביות לנפש, ולהקפיא את המוצר ב -20 מעלות צלזיוס לשימוש מאוחר יותר.

.2 Amplicons איסור פרסום הכנה לשיבוט על ידי הקדמה של אתרי הגבלה הכרחיים

  1. הגברת חזור הארוך המסוף (LTR) / 5 חלק 'UTR של פלסמיד MJ4 (ראה טבלה 3).
  2. דמיינו מוצרי 1.3 kb PCR על הפנס, amplicons החיובית בלו, ג'ל לטהר ולהקפיא כמו בעברתאר (1.4,1.5, ראה איור 1).
  3. צור התמזגה amplicons איסור פרסום MJ4 LTR- באמצעות "אחוי-חפיפה הארכה" PCR (ראה טבלה 4).
  4. דמיין, בלו, לטהר, ולהקפיא את 3.2 amplicons kb כמו ב1.4,1.5 (ראה איור 1 ג).

3 גני איסור פרסום השיבוט Amplified לMJ4, סוג המשנה C, Clone מולקולרי זיהומיות

  1. לעכל 1.5 מיקרוגרם של פלסמיד MJ4 ו1.5 מיקרוגרם של מוצר LTR- איסור הפרסום PCR מטוהר עם endonuclease הגבלת BclI (מתילציה רגישה) ל1.5 שעות על 50 מעלות צלזיוס (ראה 5 א).
  2. הוסף 1 μl של NgoMIV לתגובת העיכול ולדגור על 37 מעלות צלזיוס במשך שעה 1.
  3. להוסיף צבע טעינת 5x להגבלה לעכל תגובות וElectrophorese הנפח הכולל על 1% agarose ג'ל-TAE מכיל כתם ג'ל DNA ל1-2 שעות ב100 V. דמיין, בלו לאט, ולטהר את להקות מצויינים לשיבוט כיורדים בעברribed (ראה איור 2).
  4. הכן תגובות קשירה באמצעות הוספה מטוהרת LTR- איסור פרסום וDNA וקטור MJ4 ב3: להוסיף 1 ליחס וקטור. דגירה תגובות קשירת הלילה ב 4 מעלות צלזיוס (ראה טבלת 5 ב).
  5. להפוך חיידקים כימיים המוסמכים JM109 עם מוצרי קשירה ולהפיץ על צלחות אגר LB עם אמפיצילין / מ"ל ​​100 מיקרוגרם ולצמוח ב30 מעלות צלזיוס במשך 22 + שעות.
    1. להפשיר JM109 תאים המוסמכים על קרח במשך 15 דקות. תווית 1.5 מ"ל microcentrifuge צינורות ומקררים על קרח.
    2. Aliquot 50-100 μl של תאי JM109 מראש מצונן 1.5 מ"ל צינורות microcentrifuge. הוספת 2.5-5 μl תגובת קשירה לJM109 תאים, מצליף צינור קל לערבב ומייד חוזר לקרח. דגירה תאים המוסמכים עם מוצר קשירה על קרח למשך 30 דקות.
    3. הלם חום 1.5 מ"ל microcentrifuge צינורות המכילים תאים המוסמכים JM109 ותגובת קשירה בגוש חום 42 מעלות צלזיוס במשך 45 שניות ולחזור לקרח לפחות 3 דקות.
    4. הוסף 50 μl של תקשורת SOC על צינור אחד microcentrifuge וצלחת כל תגובת השינוי על LB-צלחות אגר טמפרטורת חדר בתוספת 100 / מ"ל ​​מיקרוגרם של אמפיצילין.
    5. העברת צלחות לC חממת 30 מעלות ולצאת ל20 שעה, או עד מושבות בבירור נוצרות.
  6. פיק מושבות מבודדות ולגדול ב 4 מ"ל של LB עם 100 מיקרוגרם / מ"ל ​​אמפיצילין ב30 מעלות צלזיוס במשך 22 + שעות.
  7. ספין למטה תרבויות ב3,200 XG במשך 15 דקות, לשפוך את המרק, ולחלץ DNA פלסמיד.
  8. כדי לאשר שיבוט נאמנות, לחתוך DNA miniprep עם NgoMIV ואנזימי הגבלת HPAI בכפול לעכל ב37 מעלות צלזיוס למשך 2 שעות. לנתח על 1% agarose ג'ל-טה (ראה טבלה 5 ג).
  9. רצף האזור להכניס LTR-איסור הפרסום של כל פלסמיד באמצעות פריימרים הבאים: GagInnerF1, GagF2, Rev1, Rev3, וGagR6 (לוח 6) כדי לאשר את זהות רצף.
  10. השווה את הרצפים המשובטים שהושגו עם der רצפי אוכלוסייהived מamplicon המטוהר הראשוני מ1.5.1. שים לב: חשוב להעריך סופו של דבר את יכולת השכפול של שני שיבוטים עצמאיים על מנת להבטיח שפנוטיפים שכפול במבחנה כולם לא בשל טעויות עמוד השדרה הציגו במהלך תהליך השיבוט.

.4 דור וtitering של-MJ4 Gag וירוסים המוסמך שכפול כימרי

  1. צור וירוס מוסמך שכפול על ידי transfecting 1.5 מיקרוגרם של DNA miniprep פלסמיד MJ4 chimeric לתאי 293T באמצעות 4: 1 יחס של Fugene HD כפי שתואר על ידי הנסיך et al 39.
  2. מניות כייל נגיף שנקטפו בתאי TZM-bl כמפורט להלן ובנסיך et al 39.
    1. תאי TZM-bl צלחת 24 שעות לפני ההדבקה בוירוס על מנת שיהיה 30-40% monolayer תא ומחוברות ביום הבא. בדרך כלל זה יכול להיות מושגת על ידי הוספת 5 x 10 4 תאים בנפח כולל של 800 μl בכל טוב בצלחת 24 גם.
    2. לאחר הוספת תאים לטובים, בעדינות להזיז את הצלחת 24 גם קדימה ואחורה, ואז מצד לצד כדי להפיץ ביעילות תאים. אף פעם לא מערבולת - זה יגרום לתאים מצטברים במרכז הצלחת.
    3. למחרת, להכין 1% FBS בDMEM; זה ישמש כדי לדלל DEAE-Dextran ולדלל מניות וירוס. מניית DEAE-Dextran הוא 10 מ"ג / מ"ל ​​או 125x, וריכוז סופי של 80 מיקרוגרם / מ"ל ​​או 1x הוא רצוי.
    4. קחו את מניות וירוס להיבדק ממקפיא -80 מעלות צלזיוס ומקום על שייקר להפשיר בטמפרטורת חדר.
    5. בעזרת פיפטה רבה, סדרנו לדלל מניות וירוס בתרבית רקמה עגולה תחתית טופל 96 גם צלחת עם מכסה. זהו פרוטוקול דילול של פי 3. ראה לוח 7 לתכנית הדילול.
    6. הסר את המדיה מ24 גם צלחות TZM-bl זורעים באמצעות aspirator ואקום כדי לוודא שלא להפריע monolayer תא. להסיר רק את התקשורת מצלחת אחד 24 גם בכל פעם, כך שתאים לעשותלא יתייבש.
    7. הוסף 150 μl של 1x DEAE-Dextran + 1% FBS בתערובת DMEM זה היטב בעזרת פיפטה 1,000 μl. אל תשתמש בפיפטה החוזרת כמו זה משבש את השכבה.
    8. הוסף 150 μl של דילול כל וירוס גם המתאים. להוסיף וירוס למרכז היטב ולערבל בעדינות כדי לפזר באופן שווה על פני וירוס monolayer התא. דגירה תאים נגועים לשעה 2 בתרבית רקמת חממה ב 37 ° C ו 5% CO 2.
    9. לאחר הדגירה שעה 2, להוסיף FBS 0.5 מ"ל 10% בDMEM זה היטב ולהחזיר צלחות לחממה ל48 שעות נוספות.
    10. לאחר 48 שעה, תאים צריכים להיות 100% ומחוברות. בגלל MJ4 הוא וירוס מוסמך שכפול, יהיה כמה מוות של תאים, אבל זה היה צפוי.
    11. הסר את המדיה מכל הטוב ולהוסיף 400 μl / גם של תיקון פתרון (ראה לוח 8 א למתכון). תקן אחד בלבד צלחת בכל פעם. הוספת תיקון פתרון באמצעות פיפטה 1,000 μl, ולתת לשבת במשך 5 דקות בטמפרטורת חדר.
    12. הסר פתרון תיקון ולשטוף 3x עם PBS עם Ca 2 + / Mg 2 +. השתמש בבקבוק להשפריץ להוסיף PBS בעדינות לצד השני של הבאר, כדי למנוע שיבוש monolayer. לאחר לשטוף השלישי, למחוק יבש צלחת על נייר סופג.
    13. הוספת 400 μl / גם של פתרון מכתים (ראה הטבלה 8B למתכון) היטב בכל הצלחת 24 גם, ולדגור על 37 מעלות צלזיוס לפחות 2 שעות. פעמים דגירה כבר מקובלות, אבל צריכה להיות כל הזמן עקבית בין ניסויי titering פעמים דגירה.
    14. לשטוף 2x עם PBS עם Ca 2 + / Mg 2 + ולהבקיע לזיהום, או להוסיף PBS ולאחסן ב 4 מעלות צלזיוס למשך הניקוד מאוחר יותר. יכולות להיות כל הזמן צלחות ב 4 מעלות צלזיוס למשך עד ארבעה ימים, כל עוד monolayer נשמר התייבשות.
    15. להבקיע לזיהום, להשתמש בטוש בלתי מחיק לחלק בארות של צלחת 24 גם לרביעים. לספור את כל התאים הכחולים בתוך שדה הראייה, באמצעות הגדלה כוללת של 200X, פעם אחת בכל אחד מארבעת הרבעים של היטב.
    16. לחשב יחידות זיהומיות לכל μl כדלקמן: [(# תאים כחולים / 4) x 67] / = IU / μl (μl וירוס הוסיף). עיין בטבלה 8C עבור נפח בμl של וירוס מתווסף גם כל. כמה בארות ממוצעת יחד; המספרים צריכים להיות דומים יחסית לטיטרציה מדויקת.

.5 הכנת תרבות מדיה והרבייה של תאי GXR25 במבחנת Assay שכפול

  1. הכן RPMI המלא (cRPMI) לריבוי של תאי GXR25. הערה: זה מאוד חשוב לתאי התרבות GXR25 לפחות 4 חודשים לפני ניסויי שכפול מתוכננים (ראה לוח 9).
  2. פיצול תאי 01:10 פעמיים בשבוע ולשמור על צפיפות תאים בין 1 x 05-02 אוקטובר x 10 6 / תאים למ"ל.

.6 בשכפול במבחנה של Gag-MJ4 מפלצות בGXR25 (CEM-CCR5-GFP) תאים

  1. היום לפני אניnfection, לפצל תאים לריכוז בין 2-3 x 10 5 תאים / מ"ל, כך שהם נמצאים בצמיחת לוגריתמים ביום של הזיהום.
  2. ביום של זיהום, להסיר מניות וירוס ממקפיא -80 מעלות צלזיוס והפשרה. חשב את הנפח של הווירוס דרוש מכל מניה המבוסס על IU / כייל μl מassay תא TZM-bl כדי להדביק 5 x 10 5 GXR25 תאים בריבוי של זיהום של 0.05, תוך שימוש בנוסחה:
    μl נפח של וירוס לזיהום (μl) = 1 / X IU x 0.05 x 500,000
    הערה: יש לנו נבחרו משרד הפנים של 0.05 כזה תוצאות בשלב צמיחת לוגריתמים לכל הווירוסים שאנחנו צריכים לבדוק. חשוב לבצע ניסויים ראשוניים על מנת לקבוע את משרד הפנים האופטימלי כדי ללכוד צמיחת לוגריתמים עבור להיבדק הווירוס.
  3. לדלל וירוס בcRPMI בהיקף של 100 μl (על מנת להשיג 0.05 משרד הפנים) ולהוסיף לתוך באר של תרבית רקמת V-תחתון טופל 96 גם צלחת. הערה: כלול שני positive שליטה (MJ4 WT נגועה) ושלילית (תאים נגועים מדומים) בכל סט של ניסויי שכפול. הגדר את הצלחת כך שכל עמודה אחרת היא ריקה כדי להגביל את הזיהום צולב בין בארות. הביקורת החיובית היא הכרחית, כפי שישמש מאוחר יותר כסטנדרט לנרמל את מדרונות השכפול, שהם מדד לקצב השכפול של משכפל ניסיוני.
  4. ספירת תאי GXR25 באמצעות דלפק תא אוטומטי. לחשב את מספר התאים הדרושים בסך הכל לכל הזיהומים (5 x 10 5 # x זיהומים). Aliquot הנפח הנדרש ל50 מ"ל צינור צנטריפוגות כדי גלולה תאי חרוטי. תמיד לחשב ליותר זיהומי 25% מהדרוש.
  5. תקשורת לשאוב בזהירות וגלולה בcRPMI בריכוז של 5 x 10 5 תאים / 100 μl.
  6. תאי פיפטה לתוך שוקת סטרילי ומערבבים היטב. בעזרת פיפטה רב ערוצית, להוסיף תאי 100 μl לבאר כל הצלחת 96 היטב המכילה את הנגיף בדילול מלא. Mix ביסודיות.
  7. הוסף 2 μl של פתרון 5 מ"ג / מ"ל ​​(100x) של polybrene היטב כל אחד ומערבבים תאים ביסודיות.
  8. דגירה על 37 מעלות צלזיוס בתרבית רקמת חממה עם 5% CO 2 למשך 3 שעות.
  9. כדי לשטוף את התאים נגועים, צלחת V-תחתון 96 היטב צנטריפוגות כדי גלולה תאים. לאחר מכן להסיר בזהירות 150 μl של המדיום ולהחליף עם 150 μl הטרי של cRPMI מבלי להפריע גלולה התא. חזור על 2 יותר פעמים (כולל צנטריפוגה) כדי לשטוף מספיק תאים.
  10. לאחר צנטריפוגה ותוספת של 150 μl cRPMI האחרונות, resuspend התא גלולה עם פיפטה רבה ולהוסיף את תערובת כולה תא / וירוס (כ 200 μl) מכל טוב באופן עצמאי ל800 μl של cRPMI בטוב של רקמה 24 גם צלחת תרבות.
  11. צלחת מקום ב5% חממת תרבות CO רקמה 2 על 37 מעלות צלזיוס.
  12. כל יומיים, להסיר של supernatant 100 μl מפני שטח של התרבות היטב ולהעביר להיטב 96 Uצלחת וחנות -bottom קפוא ב -80 מעלות צלזיוס עד לריצת assay quantitation וירוס. הערה: הסדר זהיר של supernatants בצלחות 96 היטב יאפשר להעברה רב ערוצית פיפטה של ​​supernatants התרבות בכימות virion באמצעות assay radiolabeled טרנסקריפטאז (RT). כל צלחת צריכה להכיל דגימות מסטנדרטיות זיהום כדי לנרמל וריאציה בין צלחת בקריאת assay RT.
  13. לאחר הסרת כל דגימת 100 μl, תאי פיצול 1: 2 על ידי תאי resuspending ביסודיות והסרת מחצית מהנפח שנותר (450 μl). לשחזר את עוצמת קול מקורי (1 מ"ל) על ידי הוספת 550 μl של cRPMI הטרי היטב כל אחד.

.7 ניתוח ההפוך transcriptase (RT) בתא Supernatants התרבות

פרוטוקול מותאם מאוסטרובסקי et al 40.

  1. הגדר את מכסה המנוע בטיחות ביולוגית בBSL-3 מתקן לשימוש עם חומרים רדיואקטיביים.
    1. הנח נייר סופג בהוaspirator ד ולהחליף לaspirator מיועד לשימוש רדיואקטיבי. הערה: כל פסולת רדיואקטיבית חייבת להיות מסולקת כראוי של עם בהתאם לתקנות בטיחות.
  2. להוסיף 1-2 μl של 10 mCi / מ"ל של [α- 33 P] dTTP ו4 μl של 1 M dithiothreitol (DTT) לכל aliquot 1 מ"ל של תערובת אב RT (ראה טבלה 10 ואוסטרובסקי et al. 40).
  3. לערבב בזהירות כל צינור 1.5 מ"ל microcentrifuge של תמהיל RT אדון, DTT, ו[ α- 33 P] dTTP עם טפטפת 1,000 μl והעברה לשוקת סטרילי.
  4. לוותר 25 μl של RT שכותרתו לערבב היטב לתוך כל אחד מ96, גם צלחת PCR דק דופן. הערה: כלול מקום לביקורת חיובית (זיהום WT MJ4) ובקרה שלילית (זיהום מוק).
  5. הוסף 5 μl של כל supernatant לצלחת PCR המכילה תערובת מאסטר RT.
  6. לאטום צלחת PCR עם כיסוי נייר כסף דבק ודגירה עבור שעה 2 ב 37 מעלות צלזיוס בthermocycler. מטעמי בטיחות, ריןטיפים se פיפטה עם Amphyl ולהיפטר מעצות במכל קטן המכילות פסולת Amphyl, אשר מאוחר יותר להיות מסולקים בפסולת רדיואקטיבית.
  7. לאחר דגירה, לעשות חורים קטנים בעטיפת נייר הכסף באמצעות פיפטה רב ערוצית 200 μl. הערה: אם טיפים פיפטה לגעת נוזל היטב, להחליף טיפים לפני שעברתם לעמודה או השורה הבאה.
  8. מיקס דגימות 5x והעברת 5 μl של כל דגימה לנייר DE-81. אוויר יבש 10 דקות.
  9. כתמי שטפי 5x עם 1x SSC (נתרן כלורי, נתרן ציטרט), ולאחר מכן 2x עם 90% אתנול ב5 דקות לכל לשטוף. לאפשר לאוויר יבש.
    1. מניחים כל כתם במכל שטיפה נפרד, כגון תיבת אחסון כריך, להוסיף מספיק לשטוף חיץ (1x SSC או 90% EtOH) כדי לכסות את הכתם, ולנער במשך 5 דקות.
    2. יוצקים את החיץ לשטוף לתוך מיכל וחזור על פעולה נפרד. הערה: 3 שוטף הראשון נחשב רדיואקטיביים וצריך להיות מסולק כראוי. יכולות להיות מסולקים 2 שטיפות האחרונות באופן קבוע.
  10. ברגע שיבש, מכוניתefully לעטוף כתם בניילון נצמד ולחשוף לphosphoscreen בקלטת סגורה היטב לילה בטמפרטורת חדר.
  11. לנתח phosphoscreens עם phosphorimager ולכמת תמלילי רדיואקטיבי.
  12. צייר עיגול מסביב לכל אות רדיואקטיביים באמצעות תוכנת OptiQuant. גרף הערכים הדיגיטלי Light Unit (DLU) כדי ליצור עקומות שכפול.
  13. על מנת ליצור ציוני שיכולת שכפול, ערכי DLU היו יומן 10 -transformed ומדרונות חושבו באמצעות היום 2, 4, ו -6 נקודות זמן. לאחר מכן מדרונות שכפול מחולקים על ידי השיפוע של WT MJ4 בציוני שיכולת שכפול כדי ליצור. חשוב לנרמל המבוסס על ערכי MJ4 WT המתקבלים מאותה צלחת RT להפחית שונות התוך assay.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

על מנת לבצע פרוטוקול זה, אשר יוצר פלסמיד proviral מסוגלים להרכיב מפלצות מתפקדים במלואה, זיהומיות Gag-MJ4 כראוי, יש לנקוט בזהירות רבה על מנת ליצור את amplicons PCR המתאימה. קביעה אם PCR יצר amplicon איסור הפרסום בגודל המתאים היא קריטית. מוצרים צריכים להיות בתוך 100 זוגות בסיסים (bp) של amplicon כ 1,700 נ"ב מתואר באיור 1 א. אורכו של קטע זה המדויק משתנה בהתאם לגן איסור הפרסום תחת מחקר. בשלב בא, חלק 5 חוזר מסוף ארוך '(LTR) של השיבוט המולקולרי MJ4 חייב להיות מוגבר ושחבור לamplicon איסור הפרסום על מנת להפוך אותו מתאים לשיבוט שלאחר מכן. Amplicon MJ4 LTR צריך להיות 1,474 נ"ב באורך. איור 1 מציג תמונת ג'ל נציג לאשר גדלי להקה נכונים מסומנות. לאחר אחוי-החפיפה ההארכה PCR 41, מוצרי איסור פרסום LTR- שילוב צריכים להיותכ 3,200 נ"ב באורך, כמתואר באיור 1 ג.

ברגע שגן איסור הפרסום נעשה מתאים לשיבוט על ידי היתוך ל5 'LTR מMJ4, המכיל את האתר הדרוש NgoMIV הגבלה, שני הווקטור ולהכניס איסור הפרסום חייב להיות מעוכל עם אנזימי הגבלת NgoMIV וBclI ונכרת מן agarose ג'ל לאחר electrophoretic הפרדה. זה הכרחי שיחתוך את להקות וקטור ולהכניס המתאימות. ג'ל נציג מוצג באיור 2. חלק הווקטור של פלסמיד MJ4 צריך להיות כ 10,000 נ"ב באורך, תוך הוספת איסור פרסום LTR- צריכה להישאר בכ 3,000 נ"ב באורך, כאתרי הגבלה נמצאים בקצוות הקיצוניים של amplicon. כל ירידה משמעותית בגודל תציין לחתוך אתר נוסף בתוך גן איסור הפרסום תחת מחקר.

בעקבות קשירה של שני ברים, שינוי בקטריאלי,nd בידוד של DNA פלסמיד, מפלצות Gag-MJ4 יש לבדוק לגודל מתאים על ידי ביצוע כפול לעכל עם אנזימי הגבלת NgoMIV וHPAI. באורך מלא מפלצות-MJ4 Gag שלא נגרמו כל אירועי מחיקה בעת שכפול חיידקים צריכים להיות תבנית הגבלה דומה לזו מתוארת באיור 3, עם שתי להקות של כ 8,700 ו4,300 נ"ב.

הבחנה חשובה של פרוטוקול זה בהשוואה לגישות קודמות, היא השימוש בשיבוט C תת סוג HIV-1 זיהומיות המולקולריים, MJ4, ולא וירוס NL4-3 מותאם מעבדה נפוצה יותר. עם זאת, הגישות שתוארו בסעיף הקודם יכולות להיות שונה לשיבוט של רצפים תת סוג B איסור פרסום לpNL4-3.

אופטימיזציה של הריבוי של זיהום (משרד הפנים) לשימוש בניסויים הבאים בוצעה על מנת לבחור את משרד הפנים האידיאלי שהראה צמיחת לוגריתמים של רוב הווירוסים שנבדקו.איור 4 מתאר עקומות נציג שכפול משלושה MOIs שונה (0.01, 0.05, ו0.25) לMJ4 (איור 4 א), כמו גם לNL4.3 (איור 4). MJ4 משכפל הרבה פחות יעיל בתאי GXR25 מאשר NL4-3, שחשוב לקחת בחשבון, כמתאים משרד הפנים לשכפול NL4-3 עלול להיות נמוך מדי כדי לזהות שכפול MJ4 יעיל. כפי שניתן לראות באיור 4 א, ​​משרד הפנים של 0.05 בניגוד ל0.01 או 0.25, היה הבחירה האידיאלית, משום שצמיחת לוגריתמים נצפתה בין הימים 2-6 לMJ4. למשרד הפנים נמוכים יותר, 0.01, יום 6 ערכי DLU בקושי לזיהוי, ואנו צפויים הדור של וירוסי chimeric Gag-MJ4 שהמשוכפל נמוכים מMJ4. לכן משרד הפנים זה לא ללכוד את הצמיחה של מפלצות Gag-MJ4 המוחלשות יותר, שיכול להיות גם מבחינה ביולוגית הקריטי ביותר. בנוסף, משרד הפנים של 0.25 לא היה אידיאלי, כי קינטיקה המהירה של שכפול נגיפי נהרגה amou משמעותיnt של תאים אפילו ביום .4 זה גורם לעקומת השכפול לרמה, וחישוב מדרון המבוסס על עקומה כגון זה היה להמעיט בערכו את יכולת השכפול. בהתבסס על עקומות שנוצרו עבור NL4-3, אפילו במשרד פנים של 0.01, מטרות תא זמינות מוצו ניכרת יום 6 לאחר זיהום על ידי. לסיכום, משרד הפנים של 0.05 נמצאו אופטימלי עבור פנל גדול של וירוסי chimeric Gag-MJ4, אשר כולם היו רצפי Gag מגוונים ודרגות שונות של שכפול.

כולל של 149 וירוסי chimeric Gag-MJ4 נגזרים מרצפי C Gag תת סוג אקוטי נבדק עבור שכפול במבחנה באמצעות assay זה. ערכי RC מנורמלים נע בין 0.01 ליותר מ 3.5 עם כמה וירוסים משכפלים יותר מ -100 פעמים ביעילות רבה יותר מאשר MJ4 wild-type. איור 5 מראה את עקומות שכפול מתשעה וירוסי chimeric Gag-MJ4 נציג, עם MJ4 wild-type המתוארות באדום, ומדגים את מגוון הרחב של השכפול גapacities נצפה. לפיכך, גיוון הרצף בתוך גני איסור הפרסום לבדו יכול באופן דרסטי משפיע על יכולתו של הנגיף לשכפל במבחנה. בזמן הזה הוא נציג של וירוסי chimeric Gag-MJ4 נגזרים מZambians חריפות הנגוע, רצפי C תת סוג אחרים לא נבדקו באופן מקיף, ועשויים להפגין קינטיקה שכפול שונה. לכן, יש לנקוט בזהירות רבה כדי לייעל את משרד הפנים כדי שיתאים לשכפול הספציפי של הווירוסים של מחקר מסוים, כי לא יכול להיות במגוון רחב ברמות של שכפול בין עמוד השדרה HIV-1 שונה וGag מבודד.

אחד היתרונות של שימוש בקו T-cell כגון שורת תאי GXR25, שתומכת בשכפול של MJ4, הוא ברמה של שחזור נצפתה ביחס לניסויי שכפול באמצעות גירוי תאי הדם היקפיים mononuclear כמטרות. בניסויי אופטימיזציה ראשוניים, MJ4 סוג בר הציג שונות התוך assay של .8.7%, וdiffereשיבוטים NT של אותו השתנות נגיף chimeric Gag-MJ4 הוצג בשכפול של .8.5%. משום תערובות אמן שונות וחשיפות phosphoscreen עשויות לתת ערכי DLU ששונים במקצת בגודל, השתנות התוך assay יכולות עוד להיות נשלטו על ידי פועל באותה סטנדרטית וירוס (במקרה MJ4 wild-type שלנו) בכל צלחת assay RT. איור 6 גרפים ערכי DLU נגזרים מאותו הזיהום MJ4, לכמת בשמונה צלחות RT שונות. נרמול לוירוס שמשותף לכל מבחני RT יכול לעזור כדי להקל על שגיאה פוטנציאלית הנגרמת על ידי שינויים קלים אלו בגודל אות בין מבחני.

variably Inter-assay גם נבדק ומשכפל חוזר ונשנה בימים שונים נמצאו בהתאמה גבוהה. איור 7 מגרשי ערכי ציון RC מנורמלים משני ניסויים בלתי תלויים שבוצעו בנפרד כשנה. רמה גבוהה של מתאם עם היעדר החריגים גדול (R 2 = 0.873) נצפתה betwEen שתי חזרות בלתי תלויות.

למרות מתאם גבוה, יש כמה השתנות בגודל הכולל של קינטיקה שכפול בין שני ניסויים בלתי תלויים. זו ניתן לייחס בחלקו להבדלים במספרי מעבר בין מניות תאי GXR25 משמשות בכל ניסוי. באופן כללי, GXR25 מניות תאים שהיו passaged לתקופה של זמן רב יותר מאשר 6 חודשים נוטות לתמוך שכפול יעיל יותר של מפלצות Gag-MJ4. לכן, כדאי להעריך את יכולת שכפול בין קבוצות של מפלצות בתוך מסגרת זמן של חודש אחד. כאשר השלבים הקודמים הם אחריו מקרוב, assay זה הוא מסוגל לייצר תוצאות חזקות ומאוד לשחזור, אשר חלות על מגוון רחב של מחקרים.

איור 1
מתאר לעצמי ג'ל .1 נציג איורes מתאר הפרדת electrophoretic של מוצרי PCR. לכל מוצרי PCR, 5 μl של כל תגובת 50 μl היה מעורב עם 3 μl של צבע טעינת 5x, נטענת לתוך 1% agarose ג'ל-טה בתוספת כתם ג'ל DNA 1X SYBR בטוח, ו מופרד על ידי אלקטרופורזה ב120 V 45 דקות. סולם DNA kb 1 Promega (הנתיב 1) שימש לקירוב גדלי amplicon.) גן איסור הפרסום היה מוגבר מרנ"א הנגיפי באמצעות גישת PCR מקוננת. בשל הוספות והשמטות, amplicon איסור הפרסום עשוי להשתנות מ1,600-1,700 נ"ב באורך ומופיע מעט מעל סמן סולם DNA 1,500 נ"ב. נתיבים 2-5 מתארים הגברה גן איסור פרסום מוצלחת. ב ') 5' LTR של MJ4 היה מוגבר מפלסמיד MJ4 wild-type ו דמיין באמצעות הפרדת electrophoretic. נתיבים 2-5 מתארים הגברה מוצלחת של מוצר LTR 1,474 נ"ב, המופיע מעט מתחת לסמן סולם DNA 1,500 נ"ב. C) 5R17; LTR נגזר מwild-type MJ4 וגן איסור הפרסום המוגבר של פלזמה חולה הם התמזגו יחד באמצעות אחוי-חפיפה ההארכה PCR ומדמיין באמצעות הפרדת electrophoretic. נתיבי 2-5 מתארים התמזגו בהצלחה amplicons כי הם כ 3,200 נ"ב בגודל, ואשר מופיעים מעט מעל סמן סולם DNA 3,000 נ"ב.

איור 2
הפרדת איור 2 תמונת ג'ל נציג המתארת ​​electrophoretic של הגבלה מעכלת לשיבוט גני איסור פרסום מטופל לMJ4. מוצרי היתוך איסור פרסום LTR- פלסמיד MJ4 Wild-type והיו מתעכלים עם BclI ל1.5 שעות על 50 מעלות צלזיוס וNgoMIV לשעה 1 ב37 ° ג שברי וקטור ולהוסיף היו דמיינו באמצעות הפרדת electrophoretic על 1% agarose ג'ל-טה בתוספת גרם DNA 1X SYBR בטוח כתם אל לשעה 2 100 V ושימוש בפנס אור כחול על מנת להקטין את הנזק לדנ"א הנגרם על ידי UV. שברי הווקטור ולהכניס מתאימים לשלבי שיבוט שלאחר מכן מופיעים בכ 10,000 נ"ב ו2,900 נ"ב, בהתאמה.

איור 3
איור 3 תמונת ג'ל נציג המתארת ​​הפרדת electrophoretic של מעכל הגבלה של פלסמיד דנ"א הכימרה Gag-MJ4 המטוהר. מזוקק Gag-MJ4 הכימרה פלסמיד דנ"א שמתעכל כפול עם NgoMIV והגבלת HPAI אנזימים לשעה 2 ב 37 מעלות צלזיוס. מעכלי הגבלה היו דמיינו באמצעות הפרדת electrophoretic על 1% agarose ג'ל-טה בתוספת כתם ג'ל DNA SYBR בטוח 1X ב120 V 45 דקות. פלסמידים ללא מחיקות גדולות יפתרו לשתי להקות שונות בכ 8,700 ו4,300 נ"ב.

ogether.within-page = "תמיד"> איור 4
איור 4 כפול של MJ4 וNL4-3 מבודד של HIV-1 בשורת תאי GXR25 בmultiplicities שונה של זיהום (משרד הפנים). 5 x 10 5 GXR25 תאים נגועים כפי שתוארו בפרוטוקול השיטה עם 5 פי הגדלת משרד הפנים של כל מניות וירוס. Supernatants נאסף בימים 2, 4, 6, וייצור זיהום וvirion 8 הודעה היה לכמת באמצעות assay טרנסקריפטאז radiolabeled. זיהומים היו לרוץ בשלושה עותקים וברים שגיאה לציין את סטיית התקן לשלוש חזרות. () MJ4 (B) NL4-3.

איור 5
איור 5 טווח נציג של שכפול למפלצות Gag-MJ4 שונות. 5 GXR25 תאים נגועים במפלצות MJ4 wild-type או Gag-MJ4 במשרד פנים של 0.05, supernatants נאסף בשני מרווחי יום שלאחר זיהום, וייצור virion לכמת ידי radiolabeled assay RT. החדרת גני איסור פרסום נגזר שונים תת סוג C יכולה להיות השפעה דרמטית על יכולת השכפול של MJ4. שכפול MJ4 wild-type מסומן באדום.

איור 6
השוואת .6 איור של וריאציה התוך assay בטרנסקריפטאז radiolabeled assay כימות (RT). הגרף מתארת ​​השתנות התוך assay הטבועות על ידי התוויית ערכי DLU של אותו supernatants מזיהום MJ4 wild-type אחד בשמונה assay RT שונה צלחות. הווריאציה בעקומות משקפת את השינויים קלים בהימור בסדר גודל אותצלחות Ween, אשר ניתן לתקן על ידי הפעלה סטנדרטית על כל צלחת RT, אשר ניתן להשתמש בי לאחר מכן לנרמל את המדרונות של מפלצות Gag-MJ4 assayed על אותה הצלחת.

איור 7
איור 7 שחזור של assay השכפול לאורך זמן בשורת תאי GXR25. וירוסי chimeric Gag-MJ4 אותו שמשו להדביק תאי GXR25 בשני ניסויים בלתי תלויים שבוצע כ הפרש של שנה אחת. ציוני שכפול נוצרו על ידי חישוב השיפוע של ערכי DLU-הפך יומן ונרמול מדרון שלMJ4 wild-type. יש לי מפלצות-MJ4 איסור פרסום שלשכפל ביעילות רבה יותר מאשר wild-type MJ4 ציוני שכפול גדולים מ -1, ואלה המחקים בצורה פחות יעיל מאשר MJ4 wild-type יש עשרות שכפול פחות מ -1 שתי המדידות עצמאיות מתואמות חזקות ( R 2 = 0.87, רגרסיה ליניארית) ולהדגיש את שחזור של מבחני שבוצעו בזמנים שונים ועם תאים במעברים שונים.

)

מגיב נפח לתגובת 1x (μl)
תגובת 2x המיקס (Invitrogen) 25
H nuclease ללא 2 O 17
GOF פריימר קדימה (20 מיקרומטר ריכוז) 1
פריימר ההפוך VifOR (20 ריכוז מיקרומטר) 1
עילי III צעד אחד האנזימים Mix 1
תבנית RNA 5
נפח כולל 50

B)

p-together.within-page = "תמיד" = = cellspacing גבול cellpadding "0" "0" = "0">
מספר מחזורים זמן (שעות: דקות: שניות) טמפרטורה (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 שניות + 5 / מחזור 68
1 00:00 68
1 4
END

טבלת 1) מיקס מאסטר 'וב') איסור פרסום בסיבוב ראשון. * הערה: רצף פריימר GOF: 5'-ATTTGACTAGCGGAGGCTAGAA-3 ". רצף VifOR פריימר: 5'-TTCTACGGAGACTCCATGACCC-3 ".

)

מגיב נפח לתגובת 1x (μl)
H nuclease ללא 2 O 35.5
5x Phusion HF מאגר 10
dNTPs (40 deoxynucleotides מ"מ) 1
פריימר קדימה GagInnerF1 (20 ריכוז מיקרומטר) 1
BclIDegRev2 פריימר הפוכה (20 ריכוז מיקרומטר) 1
פולימראז Phusion חם התחל השני 0.5
סיבוב ראשון כתבנית PCR 1
נפח כולל 50

B)

מספר מחזורים זמן (שעות: דקות: שניות) טמפרטורה (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
END

טבלה 2) מיקס מאסטר 'וב') תנאי thermocycler להגברת איסור פרסום בסיבוב השני מקוננת. * Nרצף GagInnerF1 פריימר:: OTE 5'-AGGCTAGAAGGAGAGAGATG-3 ". רצף BclIDegRev2 פריימר: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 ".

)

מגיב נפח לתגובת 1x (μl)
H nuclease ללא 2 O 35.5
5x Phusion HF מאגר 10
dNTPs (40 deoxynucleotides מ"מ) 1
פריימר קדימה MJ4For1b (20 ריכוז מיקרומטר) 1
MJ4Rev פריימר הפוכה (20 ריכוז מיקרומטר) 1
פולימראז Phusion חם התחל השני 0.5
MJ4 פלסמיד כתבנית (10 ng / ul) 1
נפח כולל 50

B)

מספר מחזורים זמן (שעות: דקות: שניות) טמפרטורה (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
END

לוח 3) מיקס מאסטר 'וב') תנאי thermocycler ל5 הגברה 'MJ4 LTR. * הערה: פריימר MJ4For1b רצף: 5'-CGAAATCGGCAAAATCCC-3 ". רצף MJ4Rev פריימר: 5 '-CCCATCTCTCTCCTTCTAGC-3 ".

)

מגיב נפח לתגובת 1x (μl)
H nuclease ללא 2 O 34.5
5x Phusion HF מאגר 10
dNTPs (40 deoxynucleotides מ"מ) 1
פריימר קדימה MJ4For1b (20 ריכוז מיקרומטר) 1
BclIRev פריימר הפוכה (20 ריכוז מיקרומטר) 1
amplicon kb 1.3 MJ4 LTR (, ~ 50 ng ג'ל מטוהר) 1
פולימראז Phusion חם התחל השני 0.5
amplicon איסור הפרסום (ג'ל מטוהר, ~ 100 ng) 1
נפח כולל 50

B)

מספר מחזורים זמן (שעות: דקות: שניות) טמפרטורה (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
END

לוח 4) מיקס מאסטר 'וב') תנאי thermocycler לאחוי-חפיפה ההארכה PCR ליצירה מוסיף איסור פרסום LTR-. * הערה: רצף פריימר BclIRev: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 "

)

מגיב נפח לתגובת 1x (μl) דגירה זמן (שעות) טמפרטורת דגירה (° C)
1.5 מיקרוגרם של 3 kb amplicon איסור פרסום LTR- או פלסמיד MJ4 x μl ל1.5 מיקרוגרם
חוד CutSmart חוצץ (בעבר חוד מאגר מס '4) 2
אנזים הגבלת BclI 1
H nuclease ללא 2 O x
נפח כולל 19 1.5 50
NgoMIV אנזים הגבלה 1
נפח כולל 20 1 37

B)

מגיב נפח לתגובת 1x (μl) דגירה זמן (שעות) טמפרטורת דגירה (° C)
וקטור פלסמיד MJ4 לחתוך 50 ng x μl ל50 ng
להוסיף 45 ng לחתוך LTR- איסור פרסום (3: 1 יחס) x μl ל45 ng
חיץ האנזים רוש 10x 2
רוש T4 DNA האנזים (5 U / μl) 1
H nuclease ללא 2 O
נפח כולל 20 18+ (לילה) 4

C)

מגיב נפח לתגובת 1x (μl) דגירה זמן (שעות) טמפרטורת דגירה (° C)
450 ng של פלסמיד Gag-MJ4 x μl ל450 ng
חוד CutSmart חוצץ (בעבר חוד מאגר מס '4) 2
NgoMIV אנזים הגבלה 0.5
אנזים הגבלת HPAI 0.5
H nuclease ללא 2 O x
נפח כולל 20 2 37

הגבלת .5 טבלה) לעכל תערובת מאסטר 'וב') תגובת קשירה לדור של provirus chimeric Gag-MJ4.) הגבלת אבחון C לעכל כדי להבטיח נאמנות שיבוט Gag-MJ4.

שם פריימר רצף נוקליאוטידים (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

רשימת .6 שולחן של פריימרים רצף דרושים כדי לאשר 5 זהות "LTR ורצף איסור פרסום של provirus chimeric Gag-MJ4.

ובכן 8 וירוס μl FBS + 232 μl 1% בDMEM
ובכן B 80 μl מובכן + 160 μl FBS 1% בDMEM
ובכן C 80 μl מובכן B + 160 μl FBS 1% בDMEM
ובכן D 80 μl מובכן C + 160 μl FBS 1% בDMEM
ובכן E 80 μl מובכן D + 160 μl FBS 1% בDMEM
ובכן F 80 μl מובכן E + 160 μl FBS 1% בDMEM

לוח 7: תכנית דילול (3לקפל) לtitering וירוסים מדבקים בתאי TZM-bl.

)

מגיב נפח
PBS ללא Ca 2 + או Mg 2 + 500 מ"ל
Gluteraldehyde 4 מ"ל
פורמלדהיד 11 מ"ל

* הערה: החנות ב 4 ° C..

B)

מגיב נפח
PBS ללא Ca 2 + או Mg 2 + 4.75 מ"ל
ferricyanide אשלגן (0.2 M) 100 μl
פרוציאני אשלגן (0.2 M) 100 μl
מגנזיום כלוריד (M 1) 20 μl
X-gal (50 מ"ג / מ"ל) 40 μl

* הערה: הפוך טרי ולאחסן הרחק מאור עד לשימוש.


ג

גם דילול מקורי B C D E F
נפח של הווירוס (μl) הוסיף לבארות של שורת 24 גם צלחת 5 1.6667 .5556 .1852 .06173 .02057

לוח 8) ') תיקון לtitering של וירוסי chimeric Gag-MJ4 על קו תא מחוון TZM-bl. C) הנפח של וירוס הוסיף לכל גם לחישוב יחידות / μl זיהומיות.

מגיב נפח
סרום שור העובר (FBS), מוגדר 55 מ"ל
פניצילין, סטרפטומיצין, גלוטמין (100x) 6 מ"ל
חיץ HEPES (M 1) 6 מ"ל

לוח 9: מתכון למדיום RPMI מלא לריבוי של תאי GXR25.

מגיב נפח (מ"ל)
NucleaseH 2 O -חינם 419.5
טריס-Cl, pH 7.8 (M 1) 30
פוטסיום כלוריד (M 1) 37.5
מגנזיום כלוריד (M 1) 2.5
Nonidet P-40 (10%) 5
EDTA (0.5 M) 1.02
חומצת Polyadenylic, מלח אשלגן (2 מ"ג / מ"ל) 1.25
פריימר אוליגו-DT (25 מיקרוגרם / מ"ל) 3.25
נפח כולל 500

שולחן מתכון 10. לתערובת אב assay radiolabeled ההפוך transcriptase. * הערה: חנות כaliquots 1 מ"ל ב -20 מעלות צלזיוס.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בשל האורך והאופי טכני של פרוטוקול זה, ישנם מספר צעדים שהם קריטיים עבור שתי הבנייה המוצלחת של פלסמידים Gag-MJ4 chimeric כמו גם לכימות של קיבולת שכפול נגיפית. למרות שאסטרטגית השיבוט מבוססת אנזים הגבלה על כניסתה של גני איסור פרסום הזר לMJ4 המפורטים בפרוטוקול זה יש יתרונות רבים על פני שיטות המבוססות רקומבינציה השתמשו בעבר, הפרוטוקול יכול להיות מאתגר מבחינה טכנית, אם צעדים קריטיים אינם בדיוק אחריו.

ראשית, כי יש הכרח להשתמש בפלסמיד דנ"א MJ4 שכבר נוצר בזן חיידקים מוסמך חסר methylases DNA DCM והסכר. זה הכרחי כפעילות האנזימטית של endonuclease הגבלת BclI, בו נעשה שימוש כדי לשבט גני איסור פרסום לשדרת MJ4, הוא סכר / מתילציה DCM רגישה. JM110 וSCS110 (נגזר JM110 שלילי ינדה ') א' coli זניםמחדש מתאים להפקת פלסמיד דנ"א MJ4 unmethylated. בנוסף, לכריתה של להקות וקטור ולהוסיף, זה מאוד מומלץ כי הפנס אור כחול לשמש לשם ויזואליזציה. זה יקטין נזק לדנ"א באורך גל תלוי UV ואופן דרסטי להגביר את יעילות שיבוט. אם הפנס אור כחול אינו זמין, יעילות שיבוט יכול להיות מוגדל על ידי הדמיה DNA עם כתם ג'ל SYBR הבטוח DNA במקום רומיד ethidium וצמצום זמן חשיפה לקרינת UV.

לבסוף, שיבוט מולקולרי עם גדול (> 10kb) ו / או פלסמידים retroviral כגון MJ4 היה קשה באופן מסורתי עבור מגוון רחב של סיבות. פלסמידים גדולים להפחית את יעילות טרנספורמציה של זני חיידקים המוסמכים 42 בעוד מוסיף retroviral, המכילים חוזר מסוף ארוך (LTR) רצפים, להפחית יציבות של נאמנות שכפול פלסמיד ופשרה של DNA פלסמיד בתוך המאכסן המוביל למחיקות של הגנום retroviral 43 בE. JM109 זן coli על זן DH5α, בידיים שלנו. בשל אופי בלתי יציב של פלסמיד, מוצרי פלסמיד מטוהרים תמיד צריכים להיבדק לגודל פלסמיד נכון על ידי עיכול אנזים הגבלה; כאן, כפול לעכל עם endonucleases הגבלת NgoMIV וHPAI ב37 מעלות צלזיוס למשך 2 שעות.

ברגע שדור מוצלח של פלסמידים Gag-MJ4 chimeric הושג, וירוס שנוצר באמצעות transfection של 293T תאים, titered על שורת חיווי תא, תאי TZM-bl, ושיכולת שכפול נמדדים באמצעות שורת תאי T המבוסס על CEM. שורת תאי GXR25 מבוססת CEM המשמשת למחקרים שכפול אלה היא אחד משורות התאים כמה T הוקם מסוגלת לתמוך כניסה ושכפול של זני CCR5-הטרופי של HIV-1. זו הושגה על ידי התמרה retroviral כדי לאפשר ביטוי יציב של CCR5 האנושי 37. קו זה התא באופן טבעי מבטא CXCR4 ויתמוך שכפול של CXCR4 טרופי HIV-1, כגון המתח מותאם המעבדה NL4-3. עם זאת, על מנת לתמוך בשכפול יעיל של זני CCR5-טרופי, כגון MJ4, תאי GXR25 חייבים להיות מופצים במשך לא פחות מ -4 חודשים שקדם לזיהום. כראוי תרבויות passaged יכולות לתמוך שכפול גם לאחר passaging עד 1 שנה. ניטור קפדני של שכפול CCR5 טרופי ברחבי passaging חיוני לניסויים מוצלחים.

כמו בכל טכניקה, יש מגבלות לפרוtocol שיש לקחת בחשבון. בשל מיקומו של אתרי הגבלה בפלסמיד MJ4 כמו גם את הזמינות של אתרי הגבלה נשמרים באופן טבעי HIV-1 מבודד, אתר '3 דיסטלי הגבלה, BclI, ממוקם 137 נוקלאוטידים מקודון עצירת איסור פרסום. למרות שזה יוצר גן פרוטאז chimeric, אזור זה הוא 96.5% נשמרו בקבוצה זו, ואנחנו לא רואים שפע של וירוסי chimeric מתים או פגומים.

אחד היתרונות של שימוש בשיבוט מולקולרי זיהומיות C תת סוג MJ4 עם רצפים נגזרים תת סוג C הוא שהיא מפחיתה את הסיכון לזיווג גן הכי מוצלח בין גני איסור פרסום ווקטורי עמוד השדרה של תת שונים. עם זאת, כמות מסוימת של גיוון בתוך-clade קיימת כפי שמעידים האשכולות של HIV-1 רצפים על ידי מדינה או באזור גם כאשר נמצאו בתוך אותו תת הסוג 31 ב. זה יכול לתרום לזיווג הכי מוצלח בין גני איסור פרסום דערived מZambians חריפות נגועה ואת עמוד השדרה MJ4 זיהומיות המולקולרית השיבוט, אשר נגזר מפרט נגוע כרוני מבוצואנה 38. עם זאת, רוב מכריע של המבנים ניתחו מיוצר וירוס צאצאים זיהומיות. כשיבוטים מולקולריים זיהומיות C תת סוג שונה של HIV-1 הופכים ליותר זמין לציבור רחב, זה יהיה חשוב כדי לאמת את המערכת הזו עוד יותר על ידי שיבוט בגנים איסור פרסום אלה C clade HIV-1 לתוך עמוד השדרה אחרת על מנת להבטיח כי יש הטיה מינימאלית הציגה עקב לתאימויות עמוד השדרה.

שורת תאי GXR25 היא שורת תאים ייחודית, במיוחד בזכות יכולתו לתמוך הן בCXCR4 וזני CCR5-טרופי וכתב GFP מושרה HIV-1 שלה 37. עם זאת, חלק מהמגבלות קיימות ויש לשקול בזהירות לפני השימוש בשורות התאים לניסויים מותאמים מפרוטוקול זה. שורת תאי GXR25 אינה מופיעה כדי לתמוך בכניסתם של רוב C תת סוג או, CCR5-טרופי, יחסי ציבורimary מבודד אנחנו צריכים לבדוק. בנוסף, שורת תאי הורה CEM ממנו שורת תאי GXR25 נגזרה תערוכות רמות גבוהות של cyclophilin, עד 2 עד 4 פי ביטוי גבוה משורת תאי Jurkat 44. בשל רמות גבוהות של cyclophilin, הפגם שכפול קשורים בדרך כלל עם HLA-B * הקנונית 57 קשור בריחת המוטציה, T242N, המיוחס לירידה ביכולת של הקופסית להיקשר cyclophilin, לא ניתן לאתר בקלות בשורת תאים המסוים הזה 25. כך שורת תאי GXR25 מבוססת CEM היא לא אידיאלית ללימוד פגמי שכפול קשורים למוטציות בלולאה מחייב cyclophilin קפסיד HIV-1.

לבסוף, בזמן שפרוטוקול זה הוא אידיאלי לניתוח שיכולת השכפול של רצפי איסור פרסום נובעים מנקודות זמן אקוטיות, יש לבצע את השינויים שנעשו במטרה ללמוד את יכולת השכפול של להקיא גנים נגזרים מאנשים נגועים כרוני. פרוטוקול זה כרוך בבוקרplification של רצפי אוכלוסייה מנקודות זמן אקוטיים (45 ימי חציון הודעה מוערכים מועד הזיהום), כאשר הגיוון נגיפי הוא מוגבל. גן איסור הפרסום מכל הכימרה לאחר מכן רצף ובהשוואה לamplicon PCR האוכלוסייה הראשוני כדי להבטיח שיבוט נאמנות. בשל גיוון רצף מוגבל בנקודות זמן אקוטיות, שיבוט ממוצרי PCR אוכלוסייה הוא אפשרי. עם זאת, גיוון רצף קיים בתוך quasispecies הנגיפי של פרט באופן כרוני נגוע; לכן, על מנת להעריך את יכולת השכפול של quasispecies הכרוני במדויק, הגברה הגנום יחידה חייבת להיות מועסקת על מנת ללכוד כמה גרסאות נציג. כל אחד מהמשתנים הללו לאחר מכן יש assayed עבור שכפול במבחנה.

טכניקה זו יש מספר יישומים רחבים יותר, הנובעים מיתרונותיה על פני שיטות קיימות. מכיוון שתהליך זה גורם לפלסמיד מוסמך שכפול משובט, זה הוא פשוט לשימוש בונה למ 'נוסףמחקרי utagenesis, מה שיכול לעזור על מנת להבהיר את תרומתם של שאריות ספציפיות לשכפול נגיפי. יתר על כן, על ידי שיבוט בגנים איסור פרסום מנקודות זמן אורך, אחד יכול להעריך את ההתפתחות של יכולת שכפול נגיפית לאורך זמן וכיצד שינויים אלה עשויים להשפיע על הפתוגנזה באדם שנדבק HIV-1.

טכניקה זו יכולה להיות שונה על מנת להרחיב את השירות שלה ליישומים שונים. יכולים להיות מהונדסים HIV-1 חלבונים נגיפיים נוספים לפלסמיד MJ4 כדי להעריך את ההשפעות שלהם על שכפול נגיפי או האינטראקציות שלהם עם חלבוני מארח. זה יכול להיות מושלם על ידי הנדסת אתרי מגבלות נוספות באזורים רצויים בגנום באמצעות ההקדמה של שינויי נוקלאוטיד שקטים. עם זאת, יש לקחת בחשבון מיוחד, כאשר הנדסת אתרי רומן הגבלה למחצית 3 'של הגנום HIV-1 כמה שיותר חלבוני אבזר רשומים במסגרות קריאה חלופיות, ושינויים שקטים באחדחלבון עלול להוביל להחלפות חומצת אמינו באחר. במקרה זה, שיטות אתר הגבלה עצמאיות שיבוט כגון אלה שנדונו על ידי אל דאדלי et. 45 עשויים להתגבר על מגבלה זו. רצפי ויראלי נגזרים מאוכלוסיות שונות עשויים להיות טווחים שונים של יכולות שכפול, ויכול להיות מותאמים משרד הפנים בהתאם כדי ללכוד את רוב הבידודים נגיפיים בתוך שלב לוגריתמים שלהם לצמיחה. לבסוף, שורת תאי GXR25 כבר transfected ביציבות עם GFP תחת אמרגן מונע-LTR, תאת מושרה, והתפשטות נגיפית ניתן למדוד כפונקציה של תאי GFP חיוביים באמצעות cytometry זרימת 37 כחלופה לassay RT המתוארת כאן או p24 מסורתי ELISA.

לסיכום, פרוטוקול זה מספק טכניקה יעילה ורבה עוצמה להערכת HIV-1 שכפול נגיפי שכמעניק גן איסור הפרסום, אשר מקודד חלבון מבני שמורה הכרחיות להיווצרות virion נכונה, ניצנים, התבגרות, ופירוק 46-48. יתר על כן, טכניקה זו יוצרת פלסמיד שכפול מוסמך משובט, שהוא אידיאלי ללימודי mutagenesis ו, ובכך, מספקת שיטה להבהרת גורמי חומצת אמינו הספציפי של כושר ויראלי. מחקרים כגון אלה הם הכרחיים כדי לשפר את ההבנה של איך אבולוציה נגיפית המונע על ידי החיסון משפיעה פתוגנזה והתקדמות מחלה בנגיף HIV-1 אנשים נגועים.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
הגבלת אנזים מבוסס שיבוט שיטה להערכה<em&gt; במבחנה</em&gt; יכולת שכפול של HIV-1 Gag-MJ4 וירוסי כימרי C סוג משנה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter