HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
호스트와 HIV-1 병인과 병의 진행이 합리적인 백신 설계를위한 가장 중요하다 영향을 바이러스의 특성을 모두 결정. 세포 성 면역 반응은 HIV-1 감염에 대한 인간의 면역 반응의 핵심 구성 요소입니다. 세포 독성 T 림프구 (CTL)는 급성 바이러스 혈증의 초기 제어에 필요한, 및 호스트가 정상 상태 (설정치) 1,2 바이러스 부하를 확립 할 수있다. 이 이펙터 세포의 실험 고갈 바이러스 제어 3,4의 손실이 발생합니다. 그럼에도 불구하고, 돌연변이가 바이러스처럼 감염된 세포 5-9의 CTL 인식을 파괴하는 바이러스 게놈 내에서 발생 탈출.
특정 HLA 대립 유전자는 낮은 바이러스 부하와 B * 57, B * 27와 B * 81 ~ 15를 포함하여 느린 질병의 진행과 관련이있다. HLA 클래스 I 대립 유전자의 보호 효과의 부분들은 같은 개그 같은 게놈의 기능적 제한 지역을 대상으로한다는 사실에 기인 할 수있다체외 16-21에 복제하는 바이러스의 능력을 감소 탈출 돌연변이 선택합니다. 세포 면역 시스템으로부터의 탈출 내가 대립 선택 HLA 클래스의 맥락에서 바이러스에 유익하지만, 이러한 돌연변이의 효과는 HLA-일치하지 않는 22, 23 개인에게 전송시 호스트에 대한 차등 결과를 초래할 수 있습니다. 따라서, 바이러스 복제 능력에 전송 HLA 관련 탈출 돌연변이의 영향을 이해하는 것은 초기 HIV-1 병인에 대한 우리의 이해를 증진하는 것이 중요 할 것입니다.
많은 진전이 나는 24-29을 대립 유전자 특정 HLA 클래스와 연관된 개별 탈출 돌연변이의 피트니스 결함을 식별하고 특성화하기 위해 만든 하였지만, 자연적으로 HIV-1 균주는 HLA-관련 유전자 다형성의 독특하고 복잡한 발자국 가능성이 HLA에서 발생, 한 발생 다른 immunogenetic 배경 30 – 매개 면역 압력. AP에서revious 분석, Goepfert 등. 88 심하게 감염된 잠비아 유래의 개그 송신 시퀀스에서 HLA-관련 돌연변이의 축적이 설정치 바이러스 부하 (31)의 감소와 연관된 것으로 나타났다. 이 HLA-일치하지 않는받는 사람에게 특히 개그에 해로운 탈출 돌연변이의 전송, 임상 적 혜택을 제공하고, 바이러스 복제를 감쇠로 인해 수 있다는 것을 제안했다. 나아가, 이러한 복제 용량, 초기 복제가 차례로 HIV-1 임상 매개 변수와 마지막 단계에 영향을 미칠 수있는 방법으로 전송 된 바이러스의 특성을 정의하는 콘서트에서 작동하는 방법을 복잡 개그 다형성의 조합 자연적으로 발생하는 균주 내에서 공부하는 것이 필수적입니다 병인.
브록 등은. 첫번째 서브 타입 C와 B 모두에서 감염의 만성 감염 단계 및 바이러스 부하 중에 고립 개그 프로 서열의 복제 능력 사이의 링크를 입증32 ~ 35. 이 연구에서 제시하는 실험적인 접근 방식, 만성적으로 감염된 사람에서 파생 된 시퀀스의 체외 복제 능력을 조사하기위한 있지만 적절한은 심하게 감염된 개인 어려운 서브 타입 C에서 HIV-1 증식 및 용량을 공부 할 수있는 여러 가지 기술주의 사항 및 제한 사항이 있습니다. 이 방법은 LAV에서 일부 파생 된 서브 타입 B NL4-3의 프로 바이러스로 인구 기반의 PCR 증폭 시퀀스의 재결합에 의존 연구소는 바이러스 스톡 (36)을 적용. 바이러스의 생성은 PCR 증폭 산물과 CEM 기반 T 세포 라인 (37)의 공동 형질 감염에 의해 달성 및 델타 개그 프로 NL4-3 DNA를 소화시켰다. 이 방법은 잠재적으로 생체 내에서 바이러스 quasispecies 관련 회수 바이러스 스톡의 성격을 기울이기 때문에 생체 외에서 복제 능력의 측정을 변경, 주 개월의 기간에 걸쳐 바이러스의 파생물을 필요로한다. 이 방법의 난만성적으로 감염된 개인의 다수로부터 다수의 상이한 바이러스 변이체를 복제 효과적으로 증식 및 높은 용량 바이러스를 선택하는 경우, 만성적으로 감염된 개인을 연구하고, 여기서 더 적합한 s의 것은 가능하므로 상당히 노동 집약적이고 아니다. 그러나, 심하게 감염된 개인에서, 일반적으로 1-2 변형이 존재하며, 따라서, 생체 외 선택 압력을 통해 회수 된 바이러스 스톡의 성격을 기울일의 위험을 제거하는, 시험 관내 복제 능력의 더 정확한 평가를 허용한다. 둘째,이 방법은 하위 B 파생 백본으로 서브 타입 C 개그 프로 시퀀스를 재결합이 필요하며, 분석에 백본 호환성 편견을 소개 할 수있다. 이러한 한계로 인해, 다수 서열이 도입 잠재적 인 편견을 극복하기 위해 분석되어야한다.
여기에서 우리는 또 다른 실험 아프로을 설명서브 타입 C 심하게 감염된 개체로부터 유래 된 서열을 연구 적절한 ACH. 우리는 서브 타입 C의 프로 바이러스 백본, MJ4에 HIV-1 아형 C 감염된 개인의 급성 감염 시점에서 파생 된 개그 유전자를 도입하는 제한 효소 기반의 복제 전략을 사용합니다. 개그 유전자를 복제하는의 일반적인 백본 MJ4의 사용은 서브 타입 C 파생 시퀀스의 분석을 위해 매우 중요합니다. MJ4 인해 백본 및 개그 유전자 사이의 하위 호환성에 바이어스를 소개하는 거의 없을 것입니다 따라서 기본 분리 38에서 유래하고있다. 프로 바이러스를 293T 세포에 직접 형질 감염 될 구축하고, 클로닝 개그 서열 동일한 클론 바이러스 스톡의 복구를위한 또, 제한 효소 기반 복제를 사용하는 방법은 허용한다.
아래에 제시된 방법은 유도 개그-MJ4 서브 타입 C의 복제 능력을 평가하기위한 높은 처리 방법키메라 바이러스. 293T 세포로 형질 간단하고 바이러스의 회수는 단지 세 일이 걸린다. 관내 복제 용량. 브록 등에 의해 작성된 동일 CEM-CCR5 기반 T 세포 라인 (37)을 정량하지만, 성공적인 복제를 위해 필요한 중요한 프로토콜의 수정을 사용 서브 타입 C MJ4 키메라 바이러스. 오히려 PBMC를보다 적절한 T-세포주의 사용은 높은 분석 재현성 테스트되는 서브 타입 C-MJ4의 키메라 바이러스의 다수 허용한다. 마지막으로, 상청액에서 바이러스의 정량화를위한 방사성 표지 된 역전사 효소 분석을 사용하여 시판 P24 ELISA 키트를 사용하는 것보다 더 비용 효율적이다. 또한 동일한 분석 내에서 모두 좋지 높은 복제 바이러스를 검출하고 분리 복제 사이에 미묘한 차이를 검출하기위한 중요한 높은 동적 범위를 제공한다.
결론적으로, 여기에 제시된 방법은 허용하고있다HIV-1 아형 C에서 파생 된 개그 시퀀스의 복제 능력에 대한 심층적 인 연구는 급성 잠비아에서 개인을 감염, 및 서면으로, 또한 C는 인구를 감염 다른 하위 유형을 연구하기 위해 확장 될 수있다. 다른 개그 균주 간의 복제 용량의 변화의 높은 수준이 관찰되었다. 또한, 우리는 3 년 동안 39 이상 CD4 + 하락 전송 개그의 복제 용량 및 설정치 바이러스 부하 사이뿐만 아니라와 통계적 연관성을 보여줄 수 있었다. 이러한 결과는 복제, 용량 등의 방법에 전송 된 바이러스의 특성을 공부의 중요성을 강조 초기 감염시 발병에 영향을 미칠 수있는 호스트의 면역 시스템과 상호 작용하고 효과적인 백신 개입뿐만 아니라 치료를 개발하기위한 통합 될 것입니다.
인해 길이 및이 프로토콜의 기술적 특성상 키메라 개그-MJ4 플라스미드의 성공적인 구조 모두에 중요뿐만 아니라 바이러스 복제 용량의 정량 용으로 여러 가지 방법이 있습니다. 이 프로토콜에 설명 MJ4에 외국 개그 유전자의 도입에 대한 제한 효소 기반의 복제 전략은 이전에 사용 된 재조합 기반 방법에 비해 많은 장점을 가지고 있지만 중요한 단계가 정확하게 준수하지 않을 경우, 프로토…
The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |