Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

제한 효소 기반의 복제 방법을 평가하기 위해 doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

호스트와 HIV-1 병인과 병의 진행이 합리적인 백신 설계를위한 가장 중요하다 영향을 바이러스의 특성을 모두 결정. 세포 성 면역 반응은 HIV-1 감염에 대한 인간의 면역 반응의 핵심 구성 요소입니다. 세포 독성 T 림프구 (CTL)는 급성 바이러스 혈증의 초기 제어에 필요한, 및 호스트가 정상 상태 (설정치) 1,2 바이러스 부하를 확립 할 수있다. 이 이펙터 세포의 실험 고갈 바이러스 제어 3,4의 손실이 발생합니다. 그럼에도 불구하고, 돌연변이가 바이러스처럼 감염된 세포 5-9의 CTL 인식을 파괴하는 바이러스 게놈 내에서 발생 탈출.

특정 HLA 대립 유전자는 낮은 바이러스 부하와 B * 57, B * 27와 B * 81 ~ 15를 포함하여 느린 질병의 진행과 관련이있다. HLA 클래스 I 대립 유전자의 보호 효과의 부분들은 같은 개그 같은 게놈의 기능적 제한 지역을 대상으로한다는 사실에 기인 할 수있다체외 16-21에 복제하는 바이러스의 능력을 감소 탈출 돌연변이 선택합니다. 세포 면역 시스템으로부터의 탈출 내가 대립 선택 HLA 클래스의 맥락에서 바이러스에 유익하지만, 이러한 돌연변이의 효과는 HLA-일치하지 않는 22, 23 개인에게 전송시 호스트에 대한 차등 결과를 초래할 수 있습니다. 따라서, 바이러스 복제 능력에 전송 HLA 관련 탈출 돌연변이의 영향을 이해하는 것은 초기 HIV-1 병인에 대한 우리의 이해를 증진하는 것이 중요 할 것입니다.

많은 진전이 나는 24-29을 대립 유전자 특정 HLA 클래스와 연관된 개별 탈출 돌연변이의 피트니스 결함을 식별하고 특성화하기 위해 만든 하였지만, 자연적으로 HIV-1 균주는 HLA-관련 유전자 다형성의 독특하고 복잡한 발자국 가능성이 HLA에서 발생, 한 발생 다른 immunogenetic 배경 30 - 매개 면역 압력. AP에서revious 분석, Goepfert 등. 88 심하게 감염된 잠비아 유래의 개그 송신 시퀀스에서 HLA-관련 돌연변이의 축적이 설정치 바이러스 부하 (31)의 감소와 연관된 것으로 나타났다. 이 HLA-일치하지 않는받는 사람에게 특히 개그에 해로운 탈출 돌연변이의 전송, 임상 적 혜택을 제공하고, 바이러스 복제를 감쇠로 인해 수 있다는 것을 제안했다. 나아가, 이러한 복제 용량, 초기 복제가 차례로 HIV-1 임상 매개 변수와 마지막 단계에 영향을 미칠 수있는 방법으로 전송 된 바이러스의 특성을 정의하는 콘서트에서 작동하는 방법을 복잡 개그 다형성의 조합 자연적으로 발생하는 균주 내에서 공부하는 것이 필수적입니다 병인.

브록 등은. 첫번째 서브 타입 C와 B 모두에서 감염의 만성 감염 단계 및 바이러스 부하 중에 고립 개그 프로 서열의 복제 능력 사이의 링크를 입증32 ~ 35. 이 연구에서 제시하는 실험적인 접근 방식, 만성적으로 감염된 사람에서 파생 된 시퀀스의 체외 복제 능력을 조사하기위한 있지만 적절한은 심하게 감염된 개인 어려운 서브 타입 C에서 HIV-1 증식 및 용량을 공부 할 수있는 여러 가지 기술주의 사항 및 제한 사항이 있습니다. 이 방법은 LAV에서 일부 파생 된 서브 타입 B NL4-3의 프로 바이러스로 인구 기반의 PCR 증폭 시퀀스의 재결합에 의존 연구소는 바이러스 스톡 (36)을 적용. 바이러스의 생성은 PCR 증폭 산물과 CEM 기반 T 세포 라인 (37)의 공동 형질 감염에 의해 달성 및 델타 개그 프로 NL4-3 DNA를 소화시켰다. 이 방법은 잠재적으로 생체 내에서 바이러스 quasispecies 관련 회수 바이러스 스톡의 성격을 기울이기 때문에 생체 외에서 복제 능력의 측정을 변경, 주 개월의 기간에 걸쳐 바이러스의 파생물을 필요로한다. 이 방법의 난만성적으로 감염된 개인의 다수로부터 다수의 상이한 바이러스 변이체를 복제 효과적으로 증식 및 높은 용량 바이러스를 선택하는 경우, 만성적으로 감염된 개인을 연구하고, 여기서 더 적합한 s의 것은 가능하므로 상당히 노동 집약적이고 아니다. 그러나, 심하게 감염된 개인에서, 일반적으로 1-2 변형이 존재하며, 따라서, 생체 외 선택 압력을 통해 회수 된 바이러스 스톡의 성격을 기울일의 위험을 제거하는, 시험 관내 복제 능력의 더 정확한 평가를 허용한다. 둘째,이 방법은 하위 B 파생 백본으로 서브 타입 C 개그 프로 시퀀스를 재결합이 필요하며, 분석에 백본 호환성 편견을 소개 할 수있다. 이러한 한계로 인해, 다수 서열이 도입 잠재적 인 편견을 극복하기 위해 분석되어야한다.

여기에서 우리는 또 다른 실험 아프로을 설명서브 타입 C 심하게 감염된 개체로부터 유래 된 서열을 연구 적절한 ACH. 우리는 서브 타입 C의 프로 바이러스 백본, MJ4에 HIV-1 아형 C 감염된 개인의 급성 감염 시점에서 파생 된 개그 유전자를 도입하는 제한 효소 기반의 복제 전략을 사용합니다. 개그 유전자를 복제하는의 일반적인 백본 MJ4의 사용은 서브 타입 C 파생 시퀀스의 분석을 위해 매우 중요합니다. MJ4 인해 백본 및 개그 유전자 사이의 하위 호환성에 바이어스를 소개하는 거의 없을 것입니다 따라서 기본 분리 38에서 유래하고있다. 프로 바이러스를 293T 세포에 직접 형질 감염 될 구축하고, 클로닝 개그 서열 동일한 클론 바이러스 스톡의 복구를위한 또, 제한 효소 기반 복제를 사용하는 방법은 허용한다.

아래에 제시된 방법은 유도 개그-MJ4 서브 타입 C의 복제 능력을 평가하기위한 높은 처리 방법키메라 바이러스. 293T 세포로 형질 간단하고 바이러스의 회수는 단지 세 일이 걸린다. 관내 복제 용량. 브록 등에 의해 작성된 동일 CEM-CCR5 기반 T 세포 라인 (37)을 정량하지만, 성공적인 복제를 위해 필요한 중요한 프로토콜의 수정을 사용 서브 타입 C MJ4 키메라 바이러스. 오히려 PBMC를보다 적절한 T-세포주의 사용은 높은 분석 재현성 테스트되는 서브 타입 C-MJ4의 키메라 바이러스의 다수 허용한다. 마지막으로, 상청액에서 바이러스의 정량화를위한​​ 방사성 표지 된 역전사 효소 분석을 사용하여 시판 P24 ELISA 키트를 사용하는 것보다 더 비용 효율적이다. 또한 동일한 분석 내에서 모두 좋지 높은 복제 바이러스를 검출하고 분리 복제 사이에 미묘한 차이를 검출하기위한 중요한 높은 동적 범위를 제공한다.

결론적으로, 여기에 제시된 방법은 허용하고있다HIV-1 아형 C에서 파생 된 개그 시퀀스의 복제 능력에 대한 심층적 인 연구는 급성 잠비아에서 개인을 감염, 및 서면으로, 또한 C는 인구를 감염 다른 하위 유형을 연구하기 위해 확장 될 수있다. 다른 개그 균주 간의 복제 용량의 변화의 높은 수준이 관찰되었다. 또한, 우리는 3 년 동안 39 이상 CD4 + 하락 전송 개그의 복제 용량 및 설정치 바이러스 부하 사이뿐만 아니라와 통계적 연관성을 보여줄 수 있었다. 이러한 결과는 복제, 용량 등의 방법에 전송 된 바이러스의 특성을 공부의 중요성을 강조 초기 감염시 발병에 영향을 미칠 수있는 호스트의 면역 시스템과 상호 작용하고 효과적인 백신 개입뿐만 아니라 치료를 개발하기위한 통합 될 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

감염에서 HIV-1 개그 유전자의 1 증폭, 냉동 혈장

  1. 추출 키트를 사용하여 HIV-1 감염 플라즈마를 해동 140 μL에서 바이러스 성 RNA를 추출합니다.
    1. 가능하면 즉시 RNA 추출이 같은 고정되지 않은 바이러스 성 RNA 최고의 증폭 결과를 얻을 후 cDNA 합성을 진행합니다. 가능하면 이전에 바이러스 성 RNA 추출에 4 ° C에서 1 라운드 DNA 증폭 및 저장소에 대한 PCR 마스터 믹스를 설정합니다.
  2. RNA로부터의 cDNA를 역 전사 및 역전사 및 한 단계 RT-PCR의 내열성 DNA 중합 효소를 사용하여 1 라운드 DNA 제품을 증폭.
    1. 실온에서 -80 ° C 냉동고 (동결이 필요한 경우) 간단히 녹여 밖으로 RNA를 가지고하는 것은 다음 차가운 블록에 배치합니다. 마스터 믹스를 45 ㎕의 PCR를 포함하는 각 튜브에 5 ㎕의 RNA 전사는 50 μL의 최종 부피를 얻었다. 즉시 C 냉동고 °에 -80 RNA 샘플을 나머지 놓습니다.
    2. 효소가되면원하는 반응의 수에 대한 각각의 얇은 PCR 증폭 관에 1 차 PCR 마스터 믹스 (표 1A), 분취 액 45 μL에 dded. 샘플 사이의 최소한의 교차 오염을 보장하기 위해 제거 캡을 개별 캡 PCR 튜브를 사용하지해야합니다. 온도에 민감한 RT 효소와 RNA 템플릿을 보호하기 위해 추운 블록에 PCR 튜브를 놓습니다. 참고 : 시료는 적절히 바이러스 quasispecies을 샘플링하기 위해 세중에서 실행되어야합니다. 또한 PCR-misincorporation 도입을 최소화하기 위해 높은 충실도 DNA 중합 효소 생성물을 활용하는 것도 중요하다. 권장 제품에 대한 시약의 목록을 참조하십시오.
    3. RNA 템플릿은 모든 반응 튜브에 첨가 한 후, 표 1B에 기재된 순환기 프로그램을 이용하여 증폭을 위해 열 순환기 PCR 튜브에 옮긴다. 주 :이 증폭 생성물은 PCR 중첩 2 라운드에서 사용될 것이다.
  3. 수행 중첩 된 자체DNA의 템플릿으로 첫 라운드 PCR 증폭 (1.2)의 1 μl를 사용하여 응축 라운드 PCR 증폭.
    1. 분취 원하는 반응의 수에 대한 각각의 얇은 PCR 튜브에 2 라운드 PCR 마스터 믹스 (표 2A)의 49 μL. 전사 각 반응 관에 1 라운드 PCR 증폭의 1 ㎕의 50 μL의 최종 부피를 얻었다. 참고 :이 두 번째 라운드 증폭 등의 템플릿 DNA를 제공합니다. 또한 PCR-misincorporation 도입을 최소화하기 위해 매우 높은 충실도 및 교정 기능을 DNA 중합 효소를 이용하는 것이 중요하다. 권장 제품에 대한 시약의 목록을 참조하십시오.
    2. 열 순환기하는 2 라운드 PCR 반응 믹스와 표 2b에 설명 된 실행 프로그램을 전송합니다. 주 : 프로그램의 종료 후, 본 반응의 제품은 제품의 생산을 확인하는 아가로 오스 겔상에서 실행된다.
  4. 5 &​​ #에 5 배 로딩 염료의 3 μl를 추가181, 50 ㎕의 2 라운드 반응 볼륨의 리터와 밴드가 해결 될 때까지 UV 형광 DNA 염색을 포함하는 1 % 아가로 오스 - TAE 젤에 120 V에서 실행합니다. 푸른 빛 조명에 1.6 킬로바이트 밴드를 시각화 (그림 1A 참조).
  5. DNA 얼룩을 함유하는 1 % 아가 로스-TAE 겔에서 잔여 45 ㎕의 반응 부피를 실행하고 깨끗한 면도날 적절한 밴드를 절제.
    1. , 클레아없는 물에 용출, 겔 정제 키트를 사용하여 겔 슬라이스로부터 DNA를 추출 개별 당 세 개의 긍정적 인 반응을 결합하여, 후속 사용을 위해 -20 ° C에 냉동 제품.

필요한 제한 사이트의 소개에 의한 복제에 대한 2 준비 개그 증폭 산물

  1. 긴 터미널 반복 (LTR) MJ4 플라스미드 / 5 'UTR의 일부분을 증폭하기 (표 3 참조).
  2. 정화 1.3 킬로바이트 PCR 조명에 대한 제품, 소비세 긍정적 증폭 산물 젤을 시각화하고 이전에 동결기술 (1.4,1.5, 그림 1B 참조).
  3. "스플 라이스 - 중첩 확장"을 통해 MJ4 LTR- 개그 증폭 산물을 융합 만들기 PCR (표 4 참조).
  4. , 소비세, 시각화 정화하고, 1.4,1.5에서와 같이 3.2 킬로바이트 증폭 산물 (그림 1C 참조) 동결.

MJ4, 서브 타입 C, 감염성 분자 클론에 3 복제 증폭 개그 유전자

  1. 1.5 MJ4 플라스미드 ㎍의 50 ° C (표 5A 참조)에서 1.5 시간 동안 BclI (메틸화 구분) 제한 효소와 정제 LTR- 개그 PCR 제품의 1.5 μg 다이제스트.
  2. 소화 반응에 NgoMIV의 1 μl를 추가하고 1 시간 동안 37 ° C에서 배양한다.
  3. 이전에 내림차순으로 복제를 위해 표시 밴드 반응을 소화 제한에 5 배 로딩 염료를 추가하고 천천히 100 V. 시각화, 소비세에서 1-2 시간 동안 DNA 젤 얼룩을 포함하는 1 % 아가로 오스 - TAE 겔의 총 볼륨을 electrophorese 및 정화ribed (그림 2 참조).
  4. 벡터 비율 1 삽입 : 3에서 정제 LTR- 개그 삽입 및 MJ4 벡터 DNA를 이용하여 결찰 반응을 준비합니다. 4 ° C에서 하룻밤 결찰 반응을 품어 (표 (b) 참조).
  5. 결찰 제품 JM109 화학적으로 유능한 박테리아를 변환 및 100 μg / ml의 암피실린와 LB 아가 플레이트 상에 확산 22 + 시간 동안 30 ° C에서 성장한다.
    1. 15 분 동안 JM109에게 얼음에 유능한 세포를 해동. 얼음에 1.5 ML의 microcentrifuge 튜브 및 진정 레이블.
    2. JM109 세포의 나누어지는 50 ~ 100 ㎕를 미리 냉장 1.5 ML의 microcentrifuge 튜브. 가볍게 섞어 튜브를 가볍게 치면 즉시 얼음에 반환 JM109 세포에 연결 반응의 2.5-5 μl를 추가합니다. 30 분 동안 얼음에 결찰 생성물과 적격 세포를 배양한다.
    3. 열충격 JM109 적격 세포를 45 초 동안 42 ° C의 열 블록의 연결 반응을 포함하고, 적어도 3 분 동안 얼음으로 되돌아 1.5 ml의 마이크로 원심 튜브.
    4. 각 microcentrifuge 관에 SOC 미디어의 50 μl를 추가 암피실린의 100 μg / ㎖를 첨가하여 실온 LB-한천 플레이트에 전체 변환 반응을 접시.
    5. 30 ° C에서 인큐베이터로 전송 접시와 식민지 명확하게 형성되어 20 시간 동안, 또는 때까지 둡니다.
  6. 고립 된 식민지를 선택하고 22 + 시간 동안 30 ° C에서 100 μg / ml의 암피실린와 LB의 4 ㎖에 성장합니다.
  7. 15 분 동안 3,200 XG에 문화를 스핀 다운 국물을 부어, 플라스미드 DNA를 추출합니다.
  8. 충실도를 복제 확인하기 위해 2 시간 동안 37 ° C에서 소화 이중에 NgoMIV 및 HpaI 제한 효소 미니 프렙 DNA를 잘라. 1 % TAE-아가 로스 겔상에서 분석 (표 5C 참조).
  9. 순서는 다음 프라이머를 사용하여 각 플라스미드의 LTR-개그 삽입 지역 : GagInnerF1, GagF2, REV1, Rev3 및 GagR6 (표 6) 시퀀스의 신원을 확인합니다.
  10. 인구 시퀀스 데르 얻은 복제 시퀀스를 비교1.5.1에​​서 초기 정제 된 앰플 리콘에서 ived. 주 : 모든 궁극적 관내 복제 표현형은 클로닝 과정 중에 도입 된 백본 에러에 기인하지 못하도록하기 위해서 두 개의 독립적 인 클론의 복제 능력을 평가하는 것이 중요하다.

복제 관할 개그 - MJ4 키메라 바이러스의 4 세대 및 Titering

  1. 프린스 39에 의해 설명 된대로 트랜 스펙 션을 위하여 Fugene HD : 1 비율 4를 사용 293T 세포에 키메라 MJ4 플라스미드 미니 프렙 DNA의 1.5 μg을 형질 전환에 의해 복제 가능 바이러스를 생성합니다.
  2. 39 이하와 프린스 등의 설명에 따라 TZM-BL 세포에 대한 역가 수확 바이러스 주식입니다.
    1. 플레이트 TZM-BL 세포 다음 날에 30-40% 합류 세포 단층을하기 위해 바이러스에 감염 전에 24 시간. 이것은 일반적으로 24 - 웰 플레이트에 웰당 800 ㎕의 총 부피에 5 × 104 세포를 첨가함으로써 달성 될 수있다.
    2. 우물에 셀을 추가 한 후, 부드럽게 효율적으로 세포를 배포하기 위해 좌우로 다음 앞으로 뒷면을 24 웰 플레이트를 이동합니다. 소용돌이하지 마십시오 -이 플레이트의 중앙에 축적 세포에서 발생합니다.
    3. 다음 일, DMEM에 1 % FBS를 준비; 이 DEAE-덱스 트란을 희석하고 바이러스 축적량을 희석하는 데 사용된다. DEAE-덱스 트란 콘텐츠는 10 ㎎ / ㎖ 또는 125x, 80 μg / ㎖ 또는 1X이 요구되는 최종 농도이다.
    4. 바이러스 주식을 꺼내 것은 실온에서 해동 통에 -80 ° C 냉동고 및 장소에서 테스트 할 수 있습니다.
    5. 멀티 채널 피펫을 사용하여 연속적으로 둥근 바닥 조직 배양에 바이러스 주식을 희석는 뚜껑을 96 웰 플레이트를 처리 하였다. 이 세 배 희석 프로토콜입니다. 희석 방식은 표 7을 참조하십시오.
    6. 확인 세포 단층을 방해하지 만드는 진공 흡입기를 사용하여 시드 TZM-BL 24 웰 플레이트에서 용지를 제거합니다. 한 번에 하나의 24 웰 플레이트에서 매체를 제거 세포 않도록건조하지.
    7. 각 웰 1,000 μL 피펫을 사용하여 DMEM 혼합물에 1 배 DEAE-덱스 트란 + 1 % FBS 150 μl를 추가합니다. 이 단층을 방해으로 반복 피펫을 사용하지 마십시오.
    8. 적절한 아니라 각 바이러스 희석 150 μl를 추가합니다. 웰의 중심에 바이러스를 첨가하고 균일하게 세포 단층에 걸쳐 바이러스를 분산 부드럽게 소용돌이 친다. 37 ° C에서 조직 문화 인큐베이터에서 2 시간 5 % CO 2에 감염된 세포를 품어.
    9. 2 시간 배양 한 후, 각 웰에 DMEM에 0.5 ㎖의 10 % FBS를 추가하고 추가로 48 시간 동안 인큐베이터에 번호판을 반환합니다.
    10. 48 시간 후, 세포를 100 % 융합 성이어야한다. MJ4는 복제 가능 바이러스이기 때문에, 거기에 어떤 세포 사멸 수 있지만이 예상 될 것이다.
    11. 각에서 미디어를 잘 제거하고 400 μL / 웰 솔루션 (레시피 표 8A 참조) 고정으로 추가합니다. 한 번에 하나의 플레이트를 고정합니다. 1000 μL 피펫을 사용하여 솔루션을 고정 추가하고 5 분에서 방치실내 온도.
    12. 정착액을 제거하고 칼슘 / 마그네슘 2 +와 PBS로 3 회 씻는다. 부드럽게 단층을 방해하지 않도록 잘의 측면에 PBS를 추가 물총 병을 사용합니다. 셋째 세척 한 후, 흡수 종이에 접시를 건조시킨다.
    13. 400 μL / 웰의 24 웰 플레이트의 각 웰에 염색 용액 (레시피 표 8B 참조), 그리고 최소 2 시간 동안 37 ° C에서 배양 추가합니다. 긴 배양 시간은 허용하지만, 배양 시간은 titering 실험 사이의 일관성 유지되어야한다.
    14. 워시 2 + / 마그네슘 칼슘 2와 PBS로 2 배 및 감염, 점수 이상 득점 4 ° C에서 PBS와 저장소를 추가합니다. 플레이트 한 단층 수화 유지되는 한, 최대 사일 4 ° C로 유지 될 수있다.
    15. 감염의 점수로 사분면으로 24 웰 플레이트의 우물을 나눌 영구 마커를 사용합니다. 한 번에, 200X의 배율을 사용하여 전체, 시야 내의 모든 청색 셀 카운트잘의 네 사분면의 각.
    16. 다음과 같이 μL 당 전염성 단위를 계산 : / (바이러스가 추가 μL) = IU가 / μL [(# 파란색 셀 / 4) 67 X]를 선택합니다. 각 웰에 첨가 바이러스 ㎕의 부피 표 8C를 참조하십시오. 평균 몇 우물 함께; 숫자는 정확한 적정 상대적으로 유사해야합니다.

체외 복제 분석을위한 문화 미디어 및 GXR25 세포의 전파의 5 준비

  1. GXR25 세포의 전파에 대한 완전한 RPMI (cRPMI)를 준비합니다. 참고 : 최소 4 개월 전에 계획 복제 실험에 문화 GXR25 세포에 매우 중요하다 (표 9 참조).
  2. 스플릿 셀 1시 10분 회 주당 유지하고 세포 밀도 6 10 × 10월 5일부터 2일까지 × 1 사이 세포 / ml.

GXR25 (CEM-CCR5-GFP)의 개그 - MJ4 키메라의 체외 복제에 6 셀

  1. 내가 전에 일그들이 감염 날 대수 증식에 있도록 nfection, 농도 5 ~ 10 × 2-3 간 세포 / ml의 세포를 분할.
  2. 감염의 날, C의 냉동고 해동 -80 °에서 바이러스 주식을 제거합니다. 수식을 이용하여 0.05의 감염 다중도에서 5 × 5 GXR25 세포를 감염시키기 위해 TZM BL-세포 분석에서 IU / μL 역가에 기초하여 각각의 콘텐츠에서 필요한 바이러스의 양을 계산한다 :
    감염 (μL)에 대한 바이러스의 볼륨 = 1 μL / X IU X 0.05 X 500000
    참고 :이 우리가 테스트 한 바이러스의 모든 대수 성장 단계 결과로 우리는 0.05의 MOI를 선택했습니다. 이는 바이러스가 시험되어야하는 대수 증식을 캡처하는 최적의 MOI를 측정하기 위해 초기 실험을 수행하는 것이 중요하다.
  3. 및 V-바닥 조직 배양의 우물에 추가 (0.05 MOI를 달성하기 위하여) 100 μL의 부피 cRPMI에서 바이러스를 희석하여 96 - 웰 플레이트를 처리 하였다. 참고 : positi을 모두 포함복제 실험의 각 세트 (MJ4 WT 감염)과 음 (모의 감염된 세포) 컨트롤을했습니다. 다른 모든 열 우물 사이에 교차 오염을 제한 비어 있도록 판을 설정합니다. 이 실험의 복제물 복제 속도 측정 한 복제 슬로프, 정규화 이후 표준으로 사용되는 바와 같이, 포지티브 제어가 필수적이다.
  4. 자동 세포 계수기를 사용하여 세포 GXR25 횟수. 모든 감염 (5 × 5 × # 1 감염)을 위해 필요한 총 세포 수를 계산한다. 50 ML 원뿔 튜브 및 펠릿 세포 원심 분리기에 필요한 볼륨을 나누어지는. 필요한 것보다 항상 25 % 이상 감염 계산합니다.
  5. 5 × 105 세포 / 100 ㎕의 농도의 cRPMI 기음에 신중 미디어에 resuspend.
  6. 살균 통에 피펫 세포와 철저하게 섞는다. 멀티 채널 피펫을 사용하여, 희석 된 바이러스를 함유하는 96 - 웰 플레이트의 각 웰에 세포를 100 ㎕를 추가한다. 미X 철저.
  7. 각 폴리 브렌의 5 ㎎ / ㎖ (100 배) 솔루션 2 μl를 잘 첨가하고 잘 세포를 섞는다.
  8. 3 시간 동안 5 % CO 2 조직 문화 인큐베이터에서 37 ° C에서 품어.
  9. 감염된 세포를 세척하기 위해 원심 분리기 96 웰 V-바닥 판은 세포 펠렛. 그런 다음 조심스럽게 매체의 150 μl를 제거하고 세포 펠렛을 방해하지 않고 cRPMI의 신선한 150 μL로 교체합니다. 충분히 세포를 씻어 원심 분리 (포함) 2 번 더 반복합니다.
  10. 마지막 원심 150 μL cRPMI 첨가 한 후, 다 채널 피펫 세포 펠렛을 재현 탁하고 24 - 웰 조직이 잘 cRPMI의 각 웰 독립적 800 μL에서 전체 셀 / 바이러스 혼합물 (약 200 μL)을 추가 배양 접시입니다.
  11. 37 ° C에서 5 % CO 2 조직 문화 인큐베이터에 넣어 판.
  12. 모든 이일은 문화의 표면으로부터 상층 액 100 ㎕를 잘 제거하고 96 웰 U로 전송-bottom 판과 상점은 바이러스 정량 분석​​을 실행 할 때까지 -80 ° C에서 동결. 참고 : 96 - 웰 플레이트에서 상층 액을주의 깊게 배치는 방사성 동위 원소 표지 역전사 효소 (RT) 분석을 통해 비리 정량 동안 배양 상층 액의 멀티 채널 피펫 전송을 허용합니다. 모든 판은 RT 분석 판독에 간 판의 변화를 정상화하기 위해 감염 표준의 샘플을 포함해야합니다.
  13. 철저하게 재현 탁 세포에 의해이 나머지 볼륨 (450 μL)의 절반을 제거 : 분할 세포 1을 각각 100 ㎕의 샘플을 제거한 후. 각 웰에 신선한 cRPMI의 550 μl를 추가하여 원래의 볼륨 (1 ml)에 복원합니다.

세포 배양 상층 액의 역전사의 7 분석 (RT)

프로토콜 Ostrowski 40에서 적응.

  1. 방사성 물질과 함께 사용할 수있는 BSL-3 시설에서 생물학적 안전 후드를 설정합니다.
    1. 출동에서 흡수 용지를 배치흡입기에 대한 개발과 대체 흡입기 방사성 용으로 지정된. 참고 : 모든 방사성 폐기물이 제대로 안전 규정에 따라 함께 처리해야합니다.
  2. RT 마스터 믹스의 각 1 ㎖의 분취에 [33 P α-] dTTP의 10 mCi의 / ㎖와 1 M 디티 오 트레이 톨 (DTT)의 4 μL의 1-2 μl를 추가합니다 (표 10 및 Ostrowski 등. 40 참조).
  3. 조심스럽게 살균 통에 1,000 μL 피펫 및 전송과 RT 마스터 믹스, DTT, 그리고 [33 P α-] dTTP 각 1.5 ml의 microcentrifuge 관을 섞는다.
  4. 레이블 RT의 25 μl를 96 웰 얇은 벽으로 둘러싸인 PCR 플레이트의 각 웰에 혼합 분배. 참고 : 양성 대조군 (MJ4 WT 감염) 및 음성 대조군 (모의 감염)를위한 공간을 포함합니다.
  5. RT 마스터 믹스를 포함하는 PCR 플레이트에 각 상층 액 5 μl를 추가합니다.
  6. 접착 호일 커버 PCR 플레이트를 밀봉하고 열 순환기에 37 ° C에서 2 시간 동안 배양한다. 안전을 위해, 린자체 피펫 Amphyl와 팁 이후 방사성 폐기물 처분됩니다 Amphyl 폐기물을 포함하는 작은 용기에 팁, 폐기하십시오.
  7. 배양 후, 200 ㎕의 멀티 채널 피펫을 사용하여 호일 커버의 작은 구멍을합니다. 참고 : 피펫 팁 잘 액체를 터치하면 다음 열 또는 행으로 이동하기 전에 팁을 교체합니다.
  8. 믹스 샘플 5 배와 DE-81 종이 각 샘플의 양도 5 μL. 공기는 10 분을 건조.
  9. 워시 말은 1X SSC (염화나트륨, 시트르산 나트륨)로 5 배, 및 세척 당 5 분간 90 % 에탄올로 한 다음 2X. 공기 건조 할 수 있습니다.
    1. 오점을 포함하고, 5 분 동안 흔들어 충분히 세척 버퍼 (1X SSC 또는 90 %의 EtOH)을 추가, 같은 샌드위치 저장 상자와 같은 별도의 세척 용기의 각 오점을 놓습니다.
    2. 별도의 용기와 반복으로 세척 버퍼를 붓고. 참고 : 처음 3 세척 방사성 고려하고 적절하게 처리해야합니다. 마지막 세척이 정기적으로 폐기 될 수있다.
  10. 일단 건조, 자동차efully 사란의 오점 싸서 실온에서 밤새 단단히 밀봉 카세트에 phosphoscreen에 노출 포장.
  11. phosphorimager와 phosphoscreens를 분석하고 방사성 성적 증명서를 정량화.
  12. OptiQuant 소프트웨어를 사용하여 각 방사성 신호 주위에 원을 그립니다. 복제 곡선을 생성하는 디지털 라이트 단위 (DLU) 값을 그래프.
  13. 복제 능력 점수를 생성하기 위해, DLU 값은 로그 10 -transformed이었고 경사 2, 4 및 6 시간 일 지점을 이용하여 계산 하였다. 복제 슬로프는 다음 순서로 생성 복제 능력 점수에 WT MJ4의 기울기에 의해 분할된다. 그것은 내부 분석 변동을 줄이기 위해 동일한 RT 플레이트로부터 수득 MJ4 WT 값에 기초하여 정규화하는 것이 중요하다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

제대로 완전한 기능, 전염성 개그 - MJ4의 키메라를 조립 할 수있는 프로 바이러스 플라스미드를 생성이 프로토콜을 실행하기 위해 큰 관심은 적절한 PCR 증폭 산물을 생성하기 위해주의해야합니다. PCR은 적절한 크기의 개그 앰플 리콘을 생성 여부를 결정하는 것은 매우 중요합니다. 제품도 1a에 도시 된 약 1,700 bp의 증폭 물 100 염기쌍 (bp의) 내에 있어야합니다. 이 조각의 정확한 길이는 연구중인 개그 유전자에 따라 달라질 수 있습니다. 다음에, MJ4 분자 클론의 5 '긴 말단 반복 (LTR)는 증폭 부와 후속 클로닝에 적합하게하기 위해 개그 앰플 리콘에 접합되어야한다. MJ4 LTR의 amplicon의 길이는 1,474 bp의이어야한다. 그림 1B는 올바른 밴드 크기가 표시되어있는 대표적인 젤 이미지를 보여줍니다. 스플 라이스 - 중첩 연장 PCR (41) 후, 결합 LTR- 개그 제품이어야한다도 1c에 도시 된 바와 같이 길이가 약 3200 염기쌍.

개그 유전자가 필요한 NgoMIV 제한 부위를 포함 MJ4부터 5 'LTR, 벡터 및 개그 인서트 모두에 융합하여 클로닝을 위해 적합한 이루어지면 NgoMIV 및 BclI 제한 효소로 절단하고, 전기 영동 후의 아가 로스 겔로부터 절제해야 분리. 그것은 적절한 벡터와 인서트 밴드를 절제하는 것이 필수적입니다. 대표 젤은 그림 2에 나타내었다. 제한 사이트가의 극단에 위치로 LTR- 개그 삽입, 길이 약 3,000 bp의 유지되어야하는 동안 MJ4 플라스미드 벡터 부분은 길이가 약 10,000 BP해야 앰플 리콘. 크기의 모든 유의 한 감소는 연구중인 개그 유전자 내에서 추가 컷 사이트를 표시합니다.

두 조각의 결찰 후, 세균 변형,차 플라스미드 DNA의 분리는 개그 - MJ4의 키메라는 두 번 NgoMIV 및 HpaI 제한 효소로 소화 수행하여 적절한 크기를 검사해야합니다. 전체 길이 약 8,700 및 4,300 bp의 두 밴드와 함께 그림 3에 묘사 된 것과 유사한 제한 패턴을 가져야한다 박테리아 복제 중에 삭제 이벤트를 발생하지 않은 개그 - MJ4의 키메라.

이전 방법에 비해이 프로토콜의 중요한 차이는, HIV-1 서브 타입 C 전염성 분자 복제, MJ4보다는보다 일반적인 실험실 적응 NL4-3 바이러스의 사용이다. 그러나, 이전 섹션에 설명 된 방법은 pNL4-3에 서브 타입 B 개그 시퀀스의 복제를 위해 수정할 수 있습니다.

후속 실험에 사용하기 위해 감염 (MOI)의 다수의 최적화 테스트 바이러스의 대부분의 대수 성장을 보여 주었다 이상적인 MOI를 선택하기 위해 수행되었다.그림 4는 대표 복제 MJ4 (그림 4A)에 대한 세 가지 다른 MOIS (0.01, 0.05, 0.25)에서 곡선뿐만 아니라 NL4.3 (그림 4B)에 대해를 보여줍니다. NL4-3 복제를위한 MOI의 적절한 가능성이 효율적 MJ4 복제를 검출하기 위해 너무 낮은 것으로 MJ4은 고려하는 것이 중요하다 NL4-3보다 GXR25 세포에서 훨씬 더 효율적으로 복제합니다. 그림 4A, 0.01 또는 0.25 대조적으로 0.05의 MOI에서 보는 바와 같이 대수 성장은 MJ4에 2-6 일 사이에 관찰 되었기 때문에, 이상적인 선택이었다. 낮은 MOI, 0.01를 들어, 일 6 DLU 값은 거의 감지 할 수 있으며, 우리는 MJ4보다 낮은 복제 개그 - MJ4 키메라 바이러스의 발생을 예상. 따라서 본 MOI 또한 생물학적으로 가장 중요 할 수있다 더 약독 개그-MJ4의 키메라의 성장을 캡쳐하지 않을 것이다. 바이러스 복제의 빠른 반응 속도는 상당한 아모을 살해하기 때문에 또한, 0.25의 MOI는 적합하지 않았다심지어 4 일이 기준 셀 NT는 고원 복제 곡선을 일으키고, 이와 같은 곡선에 기초하여 슬로프를 계산하는 복제 능력을 과소 평가하는 것이다. 심지어 0.01의 MOI에서 NL4-3에 대해 생성 곡선에 따라, 사용 가능한 셀 대상은 눈에 띄게 일 6 게시물 감염에 의해 소진되고있다. 결론적으로, 0.05의 MOI는 다양한 개그 시퀀스 및 복제의 변화도 있었다 모두 개그 - MJ4 키메라 바이러스의 큰 패널에 최적 인 것으로 밝혀졌다.

급성 서브 타입 C 개그 시퀀스에서 파생 된 149 개그 - MJ4 키메라 바이러스의 총이 분석을 사용하여 체외 복제를 위해 테스트되었습니다. 정규화 된 RC 값은 야생형 MJ4보다 효율적으로 100 회 이상 복제 일부 바이러스 3.5 이상 0.01에서 ranged. 5 레드에 도시 된 야생형 MJ4 함께 구 대표 개그-MJ4 키메라 바이러스로부터 복제 곡선을 보여주고있다, 및 복제 C의 넓은 범위를 보여apacities 관찰. 따라서, 혼자 개그 유전자 내의 서열 다양성이 크게 체외에서 복제하는 바이러스의 능력에 영향을 미칠 수 있습니다. 이 심하게 감염된 잠비아에서 파생 된 개그 - MJ4 키메라 바이러스의 대표 인 반면, 다른 서브 타입 C 서열은 광범위하게 테스트되지 않은, 다른 복제 속도론을 보일 수 있습니다. 다른 HIV-1 백본과 마개 사이의 분리가 복제의 수준에서 다양한있을 수 있기 때문에 세심한주의가 특정 연구의 특정 바이러스 복제에 맞게 MOI를 최적화하기 위해주의해야한다.

이러한 MJ4의 복제를 지원 GXR25 세포주로서 T 세포 라인을 사용하는 장점 중 하나는, 재현성의 레벨이 목표로서 말초 혈액 단핵 세포를 자극하여 복제 실험에 대하여 관찰된다. 초기 최적화 실험에서 MJ4은 야생형 8.7 %의 인트라 세이 변이성을 나타냈다 및 differe8.5 %의 복제 같은 개그 - MJ4 키메라 바이러스 전시 변동 NT 클론. 다른 마스터 믹스 및 phosphoscreen 노출의 크기가 약간 다를 DLU 값을 제공 할 수 있기 때문에, 내부 분석 가변성 상기 각 RT 분석 접시 (우리의 경우 야생형 MJ4에서) 동일한 바이러스 표준 실행에 의해 제어 될 수있다.도 6은 그래프 DLU 값은 8 개의 서로 다른 RT 판 수치화 같은 MJ4 감염에서 파생. 분석 사이의 신호 크기에 이러한 약간의 변화에​​ 의해 유발 된 잠재적 인 오류를 완화하는 데 도움이 될 수 있습니다 모든 RT 분석에 공통적 인 바이러스에 정규화.

간 분석 가변적으로도 테스트하고 높은 상관 관계를 보였다 다른 일에 반복 복제합니다. 약 일년 떨어져 수행이 독립적 인 실험에서 7 플롯에게 표준화 된 RC 점수 값을줍니다. 특이점의 주요 부재 (R 2 = 0.873)과 높은 상관 관계가 관찰되었다 betw두 개의 독립적 인 반복 실험을 EEN.

고도의 상관 관계가 있지만, 두 개의 독립적 인 실험 간의 복제 동역학의 전반적인 크기에 약간의 변화가있다. 이것은 각각의 실험에 사용 GXR25 세포 축적량 간의 통로 번호의 차이에 부분적으로 기인 할 수있다. 일반적으로 6 개월을 초과하는 시간 동안 계대 배양 된 세포 GXR25 주식 개그-MJ4의 키메라의보다 효율적인 복제를 지원하는 경향이있다. 따라서, 한 달 기간 내에 키메라 그룹 중에서 복제 능력을 평가하는 것이 바람직하다. 이전 단계 밀접 따르는 경우,이 분석은 연구의 넓은 범위에 적용 할 수있는 매우 견고하고 재생 가능한 결과를 생성 할 수있다.

그림 1
그림 1 대표 젤 IMAGPCR 제품의 전기 영동 분리를 묘사하는 말이지. 모든 PCR 제품의 경우, 각 50 μL 반응의 5 μL가 1X SYBR 안전 DNA 젤 얼룩 보충 1 % 아가로 오스 - TAE 겔에로드 5 배 로딩 염료의 3 μL와 혼합 된 45 분 동안 120 V에서 전기 영동에 의해 분리. 프로 메가 1킬로바이트의 DNA 사다리 (레인 1) amplicon의 크기.) 개그 유전자는 중첩 된 PCR 방식을 사용하여 바이러스 성 RNA에서 증폭에 근접 하였다. 삽입과 삭제로 인해, 개그의 amplicon의 길이는 1,600-1,700 BP에 따라 다를 수 있으며, 1,500 bp의 DNA 사다리 마커 약간 위에 나타납니다. 레인 2-5 MJ4의 5 'LTR이 야생형 MJ4 플라스미드로부터 증폭 및 전기 영동 분리를 통해 가시화 하였다. B) 성공적인 개그 유전자 증폭을 도시한다. 레인 2-5은 1500 bp의 DNA 사다리 마커. C) 5R 아래에 약간 나타나는 1474 bp의 LTR 제품의 성공적인 증폭을 묘사17; LTR은 야생형 MJ4에서 파생 된 환자의 혈장에서 증폭 된 개그 유전자 스플 라이스 - 중첩 연장 PCR을 통해 융합 및 전기 영동 분리를 통해 시각화된다. 레인 2-5들을 도시가 성공적으로 크기는 약 3,200 bp의 아르 증폭 산물을 융합, 약간 3000 bp의 DNA 사다리 마커 위에 나타납니다.

그림이
제한의 그림 2 대표 젤 이미지 묘사 전기 영동 분리 MJ4로 환자 개그 유전자 복제를위한 소화. 야생 형 MJ4 플라스미드 및 LTR- 개그 융합 제품은 37 ℃에서 1 시간 동안 50 ° C 및 NgoMIV에서 1.5 시간 동안 BclI로 소화했다 C. 벡터 및 삽입 단편 1X SYBR 안전 DNA의 g 보충 1 % 아가로 오스 - TAE 겔에서 전기 영동 분리를 통해 시각화했다엘 2 시간 동안 100 V로 염색하고 UV-유도 된 DNA 손상을 감소시키기 위해 청색광을 사용하는 일루미네이터. 이후의 복제 단계에 적합한 벡터 및 삽입 조각이 약 10,000 bp의 각각 2,900 bp의 나타납니다.

그림 3
그림 정제 개그 - MJ4 키메라 플라스미드 DNA의 제한 다이제스트의 전기 영동 분리를 묘사 3 대표 젤 이미지. 정화 개그 - MJ4 키메라 플라스미드 DNA는 NgoMIV으로 두 번 소화하고 HpaI 제한은 37 ° C에서 2 시간 동안 효소. 제한 다이제스트는 45 분 동안 120 V에서 1X의 SYBR 안전 DNA 젤 얼룩 보충 1 % 아가로 오스 - TAE 겔에서 전기 영동 분리를 통해 시각화 하였다. 큰 결실없이 플라스미드는 약 8,700 및 4,300 bp의 두 개의 서로 다른 대역에 해결됩니다.


MJ4 및 NL4-3의도 4 복제 감염의 다양한 다중성에서 GXR25 세포주 (MOI)에서 HIV-1 분리. 5 배의 MOI를 증가 메소드 프로토콜에 기재된 바와 같이 5 × 5 GXR25 세포 감염된 각 바이러스 주식입니다. 상청액 일 2, 4, 6 일에 회수하고, 8 작성자 감염 및 비리 온의 생산은 방사성 표지 된 역전사 효소 분석을 통해 정량 하였다. 감염은 회 반복 실행하고, 오차 막대는 세 복제물에 대한 표준 편차를 나타낸다. (A) MJ4 (B)를 NL4-3.

그림 5
그림 다른 개그 - MJ4의 키메라에 대한 복제의 5 대표 범위. 5 GXR25 셀은 0.05의 MOI에서 야생형 MJ4 또는 개그-MJ4 키메라 감염되었고, 상청액 게시물 감염 이틀 간격으로 수집하고, 비리 온 생산은 방사성 표지 정량화 RT 분석. 다양한 서브 타입 C 파생 개그 유전자의 삽입은 MJ4의 복제 능력에 큰 영향을 미칠 수 있습니다. 야생 형 MJ4 복제는 빨간색으로 표시된다.

그림 6
방사성 표지 된 역전사 효소 (RT) 정량 분석법. 인트라 분석 변동도 6의 비교 그래프는 8 개의 서로 다른 RT 분석에서 단일 야생형 MJ4 감염으로부터 동일 상청액의 DLU 값을 플로팅하여 고유 인트라 분석 변동을 도시 접시. 곡선의 변화는 신호 크기 내기에 약간의 변화를 반영이어서 동일한 접시에 정량 개그-MJ4의 키메라의 경사면을 정상화하는 데 사용될 수있는 각 RT 플레이트에 표준 실행에 의해 보정 될 수 싸우는 판.

그림 7
도 GXR25 세포주 경시 복제 분석 항 재현성. 동일 개그-MJ4 키메라 바이러스는 두 개의 독립적 인 실험에서 GXR25 세포를 감염시키기 위해 사용 하였다는 일년 정도 떨어져 수행. 복제 점수는 로그 변환 DLU 값의 기울기를 계산 및 야생형 MJ4 해당 경사면을 정규화함으로써 생성 하였다. 야생 형 MJ4보다 더 효율적으로 복제 개그 - MJ4의 키메라는 1보다 큰 복제 점수를 가지고 있고, 야생 형 MJ4보다 덜 효율적으로 복제하는 사람들은 (두 개의 독립적 인 측정이 강하게 상관 관계가 적은 1보다 복제 점수가R 2 = 0.87, 선형 회귀)과 서로 다른 시간에 서로 다른 구절에서 세포를 수행 분석의 재현성을 강조 표시합니다.

A)

시약 1X 반응을위한 양 (μL)
배 반응 믹스 (인비 트 로젠) 25
뉴 클레아 제 무 H 2 O 17
앞으로 프라이머 GOF (20 μM 농도) 1
역방향 프라이머 년 Vifor (20 μM 농도) 1
첨자 III 한 단계 효소 믹스 1
RNA 템플릿 5
총 볼륨 50

B)

사이클의 수 시간 (시간 : 분 : 초) 온도 (° C)
1 1시 0분 0초 50
1 2시 94
10 0시 15분 94
0시 반 56
5시 68
40 0시 15분 94
0시 반 56
5시 + 5 초 / 사이클 68
1 12시 68
1 4
END

표 1 A) 마스터 믹스 및 B) 개그 증폭 strong>을 열 순환기 조건. * 참고 : GOF 프라이머 서열 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. 년 Vifor 프라이머 서열 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

시약 1X 반응을위한 양 (μL)
뉴 클레아 제 무 H 2 O 35.5
5 배 Phusion HF 버퍼 10
의 dNTPs (40 MM의 데 옥시 뉴클레오티드) 1
앞으로 프라이머 GagInnerF1 (20 μM 농도) 1
역방향 프라이머 BclIDegRev2 (20 μM 농도) 1
Phusion 핫 스타트 II 중합 효소 0.5
템플릿으로 1 라운드 PCR 1
총 볼륨 50

B)

사이클의 수 시간 (시간 : 분 : 초) 온도 (° C)
1 0시 반 98
29 0시 10분 98
0시 반 53
1시 72
1 10시 72
1 4
END

표 2) 마스터 믹스와 B) 중첩 된 2 라운드 개그 증폭을위한 열 순환기 조건. * NOTE : GagInnerF1 프라이머 서열 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 프라이머 서열 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

시약 1X 반응을위한 양 (μL)
뉴 클레아 제 무 H 2 O 35.5
5 배 Phusion HF 버퍼 10
의 dNTPs (40 MM의 데 옥시 뉴클레오티드) 1
앞으로 프라이머 MJ4For1b (20 μM 농도) 1
역방향 프라이머 MJ4Rev (20 μM 농도) 1
Phusion 핫 스타트 II 중합 효소 0.5
MJ4 플라스미드와 같은 템플릿 (10 NG / UL) 1
총 볼륨 50

B)

사이클의 수 시간 (시간 : 분 : 초) 온도 (° C)
1 0시 반 98
29 0시 10분 98
0시 반 58
0시 45분 72
1 10시 72
1 4
END

표 3 A) 마스터 믹스 및 B) 5 'LTR MJ4 증폭 용 열 순환기 조건. * 참고 : MJ4For1b 프라이머 서열 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev 프라이머 순서 : 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

시약 1X 반응을위한 양 (μL)
뉴 클레아 제 무 H 2 O 34.5
5 배 Phusion HF 버퍼 10
의 dNTPs (40 MM의 데 옥시 뉴클레오티드) 1
앞으로 프라이머 MJ4For1b (20 μM 농도) 1
역방향 프라이머 BclIRev (20 μM 농도) 1
MJ4 LTR 1.3 킬로바이트의 앰플 리콘 (젤 정제 ~ 50 NG) 1
Phusion 핫 스타트 II 중합 효소 0.5
개그 앰플 리콘 (젤 정제 ~ 100 NG) 1
총 볼륨 50

B)

사이클의 수 시간 (시간 : 분 : 초) 온도 (° C)
1 0시 반 98
29 0시 10분 98
0시 반 58
1시 반 72
1 10시 72
1 4
END

표 4) 마스터 믹스와 B) 스플 라이스 - 중첩 연장 PCR에 대한 열 순환기 조건은 LTR- 개그 삽입을 생성합니다. * 참고 : BclIRev 프라이머 서열 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

시약 1X 반응을위한 양 (μL) 보육 시간 (시간) 배양 온도 (° C)
3킬로바이트 LTR- 개그의 증폭 또는 MJ4 플라스미드의 1.5 μg 1.5 μg에 대한 X μL
NEB CutSmart 버퍼 ​​(이전 NEB 버퍼 # 4)
BclI 제한 효소 1
뉴 클레아 제 무 H 2 O X
총 볼륨 19 1.5 50
NgoMIV 제한 효소 1
총 볼륨 20 1 37

B)

시약 1X 반응을위한 양 (μL) 보육 시간 (시간) 배양 온도 (° C)
50 NG 컷 MJ4 플라스미드 벡터 50 NG에 대한 X μL
45 NG 컷 LTR- 개그 인서트 (3 : 1 비율) 45 NG에 대한 X μL
로슈 10 배 리가 버퍼
로슈 T4 DNA 리가 아제 (5 U / μL) 1
뉴 클레아 제 무 H 2 O
총 볼륨 20 18 세 이상 (야간) 4

C)

시약 1X 반응을위한 양 (μL) 보육 시간 (시간) 배양 온도 (° C)
개그-MJ4 플라스미드 450 NG 450 NG에 대한 X μL
NEB CutSmart 버퍼 ​​(이전 NEB 버퍼 # 4)
NgoMIV 제한 효소 0.5
HpaI 제한 효소 0.5
뉴 클레아 제 무 H 2 O X
총 볼륨 20 37

표 5) 제한 마스터 믹스와 B) 개그 - MJ4 복제 충실도를 보장하기 위해 개그 - MJ4 키메라 프로 바이러스. C) 진단 제한 다이제스트의 생성을위한 연결 반응을 소화.

프라이머 이름 뉴클레오타이드 서열 (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
REV1 AATTTTTCCAGCTCCCTGCTTGCCCA

개그 - MJ4 키메라 프로 바이러스의 5 'LTR과 개그 순서 신원을 확인하는 데 필요한 시퀀싱 프라이머의 표 6 목록.

DMEM 8 μL 바이러스 + 232 ㎕의 1 % FBS
그럼 B DMEM에서 음 + 160 ㎕의 1 % FBS에서 80 μL
그럼 C DMEM에서 음 B + 160 ㎕의 1 % FBS에서 80 μL
음 D DMEM에서 음 C + 160 ㎕의 1 % FBS에서 80 μL
음 E DMEM에서 음 D + 160 ㎕의 1 % FBS에서 80 μL
그럼 F DMEM에서 음 E + 160 ㎕의 1 % FBS에서 80 μL

표 7 희석 방식 (3TZM-BL 세포에 감염 바이러스를 titering 용)을 접습니다.

A)

시약 볼륨
PBS 칼슘 또는 마그네슘없이 2 + 500 ml의
글루 타르 4 ML
포름 알데히드 11 ML

* 참고 : 저장 4 ° C에서.

B)

시약 볼륨
PBS 칼슘 또는 마그네슘없이 2 + 4.75 ML
페리 시안화 칼륨 (0.2 M) 100 μL
페로 시안화 칼륨 (0.2 M) 100 μL
마그네슘 클로라이드 (1 M) 20 μL
X-갤런 (50 ㎎ / ㎖) 40 μL

* 참고 : 신선한 확인하고 사용할 때까지 빛으로부터 저장합니다.


C.

원래 희석 잘 B C D E F
바이러스 (μL) 부피는 24 웰 플레이트 행의 웰에 첨가 5 1.6667 0.5556 0.1852 0.06173 0.02057

표 8) C) 감염성 단위 / μl를 계산하기 위해 잘 당 추가 바이러스의 볼륨 개그 - MJ4 키메라 바이러스의 titering에 대한 강력한> 염색 및 B) 고정 솔루션을 제공합니다.

시약 볼륨
소 태아 혈청 (FBS), 정의 55 ML
페니실린, 스트렙토 마이신, 글루타민 (100 배) 6 ML
HEPES 완충액 (1 M) 6 ML

GXR25 세포의 전파에 대한 완전한 RPMI 매체에 대한 9 레시피.

시약 볼륨 (ML)
클레아- 무료 H 2 O 419.5
트리스 염소, pH가 7.8 (1 M) 30
염화칼륨 (1 M) 37.5
마그네슘 클로라이드 (1 M) 2.5
Nonidet P-40 (10 %) 5
EDTA (0.5 M) 1.02
Polyadenylic 복실 산, 칼륨 염 (2 ㎎ / ㎖) 1.25
올리고 DT 프라이머 (25 μg / ㎖) 3.25
총 볼륨 500

방사성 표지 역전사 분석 마스터 믹스 표 (10) 레시피. * 참고 : 저장 온도 -20 ° C에서 1 ㎖의 분취 등.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

인해 길이 및이 프로토콜의 기술적 특성상 키메라 개그-MJ4 플라스미드의 성공적인 구조 모두에 중요뿐만 아니라 바이러스 복제 용량의 정량 용으로 여러 가지 방법이 있습니다. 이 프로토콜에 설명 MJ4에 외국 개그 유전자의 도입에 대한 제한 효소 기반의 복제 전략은 이전에 사용 된 재조합 기반 방법에 비해 많은 장점을 가지고 있지만 중요한 단계가 정확하게 준수하지 않을 경우, 프로토콜은 기술적으로 문제가 될 수 있습니다.

첫째, DCM 및 댐 DNA의 methylases 결여 유능한 균주 생성 된 MJ4 플라스미드 DNA를 사용하는 것이 절대적으로 필수적이다. 이것은 MJ4 백본에 개그 유전자를 복제하는 데 사용되는 BclI의 제한 효소의 효소 활성 등 필요 댐 / DCM 메틸화를 구분합니다. JM110와 SCS110 (ENDA 부정적인 JM110 유도체) E. 대장균 균주MJ4 메틸화 플라스미드 DNA를 생성하기에 적합한 재. 또한, 벡터 및 삽입 밴드의 절제, 그것은 매우 푸른 빛 조명이 시각화에 사용하는 것이 좋습니다. 이는 UV 파장 의존적 DNA 손상을 대폭 감소시키고 복제 효율성을 증가한다. 청색광 일루미네이터를 사용할 수없는 경우, 복제 효율 SYBR 안전 DNA 겔 얼룩 대신 에티 디움 브로마이드로 DNA를 시각화 및 UV 노출 시간을 최소화함으로써 최대화 될 수있다.

마지막으로, 대형 (> 10킬로바이트) 및 / 또는 MJ4와 같은 레트로 바이러스 플라스미드와 분자 복제는 전통적으로 다양한 이유로 어려웠다. 큰 플라스미드 유능한 균주 (42)의 변환 효율을 감소하면서 긴 말단 반복 (LTR) 시퀀스, 레트로 바이러스 게놈 (43)의 삭제로 이어지는 세균성 호스트 내의 플라스미드 DNA의 플라스미드와 타협 복제 충실도의 안정성을 감소를 포함하는 레트로 바이러스 인서트 E. JM109을 사용하는 경우 또한, MJ4 플라스미드의 복제가 더 안정 우리의 손에 DH5α 균주를 통해 대장균 균주. 인해 플라스미드의 불안정한 특성으로 정제 된 플라스미드 제품은 항상 제한 효소 소화에 의해 올바른 플라스미드의 크기를 검사하여야한다; 여기, 이중 2 시간 동안 37 ° C에서 NgoMIV 및 HpaI 제한 엔도 뉴 클레아 제 다이제스트.

일단 키메라 개그-MJ4 플라스미드의 생성이 성공적으로 이루어진 것으로,이 바이러스의 형질 감염을 통해 생성된다표시기 세포주, TZM BL-세포 및 복제 능력에 titered 93T 균체 CEM 기반 T 세포주를 사용하여 측정된다. 이러한 복제 연구에 사용 CEM 기반 GXR25 세포주는 HIV-1의 CCR5-트로픽 균주의 진입 및 복제를 지원할 수있는 몇 확립 T 세포주이다. 이것은 인간 CCR5 (37)의 안정한 발현을 허용하는 레트로 바이러스 형질 도입에 의해 달성되었다. 이 세포주는 자연적으로 CXCR4를 표현하고 실험실 적응 변형 NL4-3으로 CXCR4 - 열대 HIV-1의 복제를 지원합니다. 그러나, 순서 등 MJ4로, GXR25 세포는 이전에 감염에 더 적은 4 개월간 전파해야하는, CCR5 - 열대 균주를 효율적으로 복제를 지원합니다. 제대로 계대 배양에도 최대 일년에 계대 후 복제를 지원할 수 있습니다. 계대에 걸쳐 CCR5 - 열대 복제를주의 깊게 모니터링은 성공적인 실험에 필수적입니다.

모든 기술과 마찬가지로 제한은 프로에있다고려되어야한다 로토콜. 때문에 MJ4 플라스미드에 제한 부위의 위치뿐만 아니라 자연적으로 HIV-1 균주 발생의 보존 제한 사이트의 가용성에, 3 '말단 제한 사이트 BclI는 개그 정지 코돈에서 137 뉴클레오티드에 위치해 있습니다. 이 키메라 단백질 분해 효소 유전자를 생성하지만,이 지역은이 일대에 보존 96.5 %이며, 우리는 죽었거나 결함이 키메라 바이러스의 풍요 로움을 준수하지 않았다.

서브 타입 C 유래 시퀀스 MJ4 아형 C 전염성 분자 복제를 사용하는 장점 중 하나는 개그 유전자와 다른 아형의 백본 벡터 사이 차선 유전자 페어링의 위험을 줄일 수 있다는 것이다. 동일한 서브 타입 (31) 내에있는 경우에도 국가 또는 지역에 HIV-1 서열의 클러스터링에 의해 입증하지만 이내-clade 다양성 일정량 존재한다. 개그 유전자 데르 사이에이 최적 페어링에 기여할 수심하게 감염된 잠비아와 보츠와나 (38)에서 만성적으로 감염된 개인으로부터 파생 된 MJ4 감염성 분자 클론 백본에서 ived. 그러나, 분석 된 구조의 대부분은 감염 자손 바이러스를 생산했다. 로 다른 HIV-1 아형 C 감염성 분자 클론을 더 널리 사용할 수있게, 그것은 더 때문에 도입 최소한의 편견이 있는지 확인하기 위해 다른 백본에이 HIV-1 clade의 C 개그 유전자 복제하여이 시스템의 유효성을 확인하는 것이 중요 할 것입니다 백본 비 호환성.

GXR25 세포주 구체적으로 인해 CXCR4 및 CCR5-트로픽 균주 및 HIV-1 유도 GFP 리포터 (37)를 모두 지원하는 능력에 고유 세포주이다. 그러나, 몇 가지 제한이 존재 조심스럽게이 프로토콜에서 적응 실험이 세포주를 사용하기 전에 고려되어야한다. GXR25 세포주 서브 타입 C 또는 A, CCR5-트로픽, PR의 대부분의 항목을 지원하기 위해 나타나지 않는다imary 우리가 테스트 한 분리합니다. 또한, 상위 CEM 세포 라인이있는 GXR25 세포주 전시 2 행까지 cyclophilin의 높은 수준의 파생 된 Jurkat 세포 라인 (44)보다 더 높은 발현을 4 배. 인해 cyclophilin의 높은 수준으로 복제 결함이 정상적으로 cyclophilin의 바인딩 캡시드의 감소 능력에 기인 정규 HLA-B의 * 57 연관된 탈출 돌연변이, T242N,과 연관된 쉽게 특정 세포주에서 검출 할 수없는 25. 따라서, CEM 기반 GXR25 세포주는 HIV-1 캡시드 cyclophilin 결합 루프의 돌연변이와 관련된 복제 결함을 연구하는데 적합하지 않다.

이 프로토콜은 급성 시점으로부터 유도 개그 서열의 복제 능력을 분석하기위한 이상적인 상태에서 마지막으로, 변형은 만성적으로 감염된 개체로부터 유래 된 유전자를 개그의 복제 능력을 연구하기 위하여 이루어져야한다. 이 프로토콜은 오전을 포함바이러스 성 다양성이 제한되는 경우는 급성 시점에서 인구 시퀀스 긴밀히은 (중간 사십오일은 감염의 날짜를 추정 POST). 각 키메라에서 개그 유전자는 염기 서열과 충실도를 복제하기 위해 초기 인구 PCR 증폭 물과 비교됩니다. 급한 시점에서 한정된 서열 다양성, 인구 PCR 제품으로부터 복제하는 것은 가능하다. 그러나, 순서의 다양성은 만성적으로 감염된 개인의 바이러스 quasispecies 내에 존재; 따라서, 정확하게 만성 quasispecies의 복제 능력을 평가하기 위해, 단일 게놈 증폭 몇몇 대표적인 변형을 캡처하기 위해 사용되어야한다. 이러한 변형은 각각 다음 체외 복제을 분석해야합니다.

이 기술은 기존 방법에 비해 장점에 기인 여러 광범위한 응용 프로그램을 가지고 있습니다. 이 프로세스가 클론 된 플라스미드 복제 능력을 초래하기 때문에, 추가 m위한 구조를 사용하는 간단한바이러스 복제에 특정 잔류의 기여를 명료하게하는 데 도움이 될 수 있습니다 utagenesis 연구. 또한, 세로 시점에서 개그 유전자 복제하여, 하나는 시간이 지남에 바이러스 복제 능력의 발전을 평가하고 이러한 변화는 HIV-1에 감염된 개인의 발병에 영향을 미칠 수있는 방법에 대해 설명합니다.

이 기술은 다양한 애플리케이션에 대한 유틸리티를 확장하기 위해 수정 될 수있다. 추가의 HIV-1 바이러스 성 단백질은 바이러스 복제하거나 숙주 단백질과의 상호 작용에 미치는 영향을 평가하기 위해 MJ4 플라스미드로 설계 될 수있다. 이 침묵 뉴클레오티드 변화를 도입하여 게놈 원하는 영역에 추가 제한 사이트를 엔지니어링하여 달성 될 수있다. 많은 액세서리 단백질이 다른 독서 프레임으로 인코딩 된 HIV-1 유전자의 3 '의 절반에 새로운 제한 사이트, 하나의 침묵의 변화를 설계하는 경우에는 특별한주의를 기울여야합니다다른 단백질에서 아미노산 치환을 초래할 수있다. 이때, 이러한 더들리 외하여 논의 된 것과 같이 제한 부위 독립적 클로닝 방법. 45은 이러한 한계를 극복 할 수있다. 개체군으로부터 유도 바이러스 서열은 복제 용량 가변 범위를 가질 수 있고, MOI는 그들의 대수 성장 단계 내에서 바이러스 균주의 대다수를 캡처하기 위해 적절하게 조정될 수있다. 마지막 GXR25 세포주 안정적 LTR 구동, 타트 - 유도 성 프로모터 하에서 GFP로 형질 감염되었고, 바이러스 전파 여기 또는 설명 RT 분석의 대안으로 37 유세포 통해 GFP 양성 세포의 함수로서 측정 될 수있다 기존의 P24 ELISA.

결론적으로,이 프로토콜은 적절한 비리 형성을 위해 필요한 보존 구조 단백질을 코딩 개그 유전자에 의해 부여 된 바와 같이 HIV-1 바이러스의 복제를 평가하기위한 효율적이고 강력한 방법을 제공한다, 신진, 성숙, 분해 46-48. 또한,이 기술은, 따라서, 돌연변이 연구에 이상적이며 유능한 클론 복제 플라스미드, 바이러스 생성의 적합성 특정 아미노산 결정을 해명하기위한 방법을 제공한다. 이와 같은 연구는 면역 기반의 바이러스 성 진화는 HIV-1에 감염된 개인의 발병 기전 및 질병의 진행에 미치는 영향에 대한 이해를 향상시키기 위해 필수적이다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
제한 효소 기반의 복제 방법을 평가하기 위해<em&gt; 시험관</em&gt; HIV-1 서브 타입 C 개그 - MJ4 키메라 바이러스의 복제 능력
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter