Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Una enzima de restricción método basado clonación para evaluar la doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Determinar el host y características virales que influyen en el VIH-1 patogénesis y progresión de la enfermedad es de suma importancia para el diseño racional de vacunas. La respuesta inmune celular es un componente clave de la respuesta inmune humana a la infección VIH-1. Los linfocitos T citotóxicos (CTL) son necesarios para el control inicial de la viremia aguda, y permiten al ordenador establecer un estado de equilibrio (set point) de la carga viral 1,2. Experimental agotamiento de estas células efectoras se traduce en la pérdida de control viral 3,4. A pesar de esto, escapan mutaciones surgen dentro del genoma viral que subvertir reconocimiento de CTL de las células infectadas viralmente 5-9.

Ciertos alelos HLA se han asociado con cargas virales más bajas y más lenta progresión de la enfermedad, incluido el B * 57, B * 27 B * 81 y 10-15. Parte de los beneficios de protección de los alelos HLA de clase I se puede atribuir al hecho de que se tengan en regiones funcionalmente limitados del genoma, tales como Gagy seleccionar para mutaciones de escape que disminuyen la capacidad del virus para replicarse in vitro 16-21. Aunque escape del sistema inmune celular es beneficioso para el virus en el contexto de la selección de HLA de clase I alelo, el efecto de estas mutaciones puede tener consecuencias diferenciales para el huésped tras la transmisión a un individuo HLA no coincidentes 22,23. Por lo tanto, la comprensión de los efectos de la transmisión mutaciones de escape HLA-asociada a la capacidad de replicación viral será importante para mejorar nuestra comprensión de los principios de VIH-1 patogénesis.

Si bien se ha avanzado mucho para identificar y caracterizar los defectos de la aptitud de mutaciones de escape individuales asociados a una clase de HLA I alelos 24-29, de origen natural aislados HIV-1 han huellas únicas y complejas de los polimorfismos asociados-HLA, probablemente derivado de la HLA presión inmune mediada de diferentes orígenes immunogenetic 30. En apanálisis de la mera existencia, Goepfert et al. mostró que una acumulación de mutaciones asociadas a HLA en las secuencias de la mordaza de transmisión derivados de 88 Zambianos infectadas de forma aguda se asoció con una reducción en la carga viral del punto de ajuste 31. Esto sugirió que la transmisión de mutaciones de escape nocivos, específicamente en Gag, a los destinatarios-HLA no coincidentes proporciona un beneficio clínico, y puede ser debido a la replicación viral atenuada. De cara al futuro, es imprescindible para estudiar cómo las combinaciones de los polimorfismos de la mordaza del complejo dentro de los aislamientos naturales trabajan en conjunto para definir las características del virus de transmisión, tales como la capacidad de replicación, y cómo la replicación temprana podría a su vez afectar el VIH-1 parámetros clínicos y de la última etapa patogénesis.

Brockman et al. Demostró por primera vez un vínculo entre la capacidad de replicación de secuencias-gag pro aislado durante la infección etapa crónica y la carga viral tanto en el subtipo C y las infecciones B32-35. El enfoque experimental se presenta en estos estudios, aunque apropiado para examinar la capacidad de replicación in vitro de secuencias derivadas de individuos con infección crónica, tiene varias advertencias y limitaciones técnicas que hacen que estudian el VIH-1 capacidad replicativa en el subtipo C individuos infectados de forma aguda difícil. Este método se basa en la recombinación de secuencias basadas población amplificados por PCR en el subtipo B NL4-3 provirus, que se deriva en parte de LAV, un laboratorio adaptado stock de virus 36. Generación de virus se realizó por co-transfección de una línea de células T CEM basada en 37 con amplicones de PCR y se digirió ADN NL4-3 delta pro-gag. Este método requiere la consecuencia de virus durante un período de semanas a meses, potencialmente sesgar la naturaleza del stock de virus recuperado en relación con las cuasiespecies virales in vivo, y por lo tanto alterar la medición de la capacidad de replicación in vitro. Este método is más apropiado para el estudio de los individuos infectados crónicamente, donde se selecciona de manera efectiva para el virus de la más alta capacidad replicativa, y donde la clonación de numerosos diferentes variantes virales a partir de un gran número de individuos infectados crónicamente es bastante mano de obra intensiva y por lo tanto no es factible. Sin embargo, dentro de un individuo infectado de forma aguda, hay generalmente uno y cincuenta y nueve variantes presentes, y eliminando así el riesgo de sesgo de la naturaleza del stock de virus recuperado, a través de presiones de selección in vitro, permite una evaluación más precisa de la capacidad de replicación in vitro. En segundo lugar, este método requiere la recombinación de secuencias gag-pro subtipo C en una columna vertebral derivada subtipo B, y podría introducir sesgos de incompatibilidad columna vertebral en el análisis. Debido a estas limitaciones, un gran número de secuencias deben ser analizados con el fin de superar las posibles sesgos introducidos.

Aquí describimos una apro experimental alternativoach apropiada para el estudio de secuencias derivadas del subtipo C individuos con infección aguda. Utilizamos una estrategia de clonación basada en la enzima de restricción para introducir el gen gag derivado de puntos de tiempo infección aguda de los individuos infectados por VIH-1 subtipo C en la cadena principal proviral subtipo C, MJ4. El uso de MJ4 como una red troncal común en el que para clonar genes gag es crucial para el análisis de subtipo C secuencias derivadas. MJ4 se deriva de un aislado primario 38, y por lo tanto sería menos probable que introducir un sesgo debido a la incompatibilidad subtipo entre la columna vertebral y el gen gag. Además, el enfoque de la utilización de la clonación restricción basada enzima permite la proviral construye a transfectar directamente en células 293T, y para la recuperación de un virus clonal de stock idéntica a la secuencia gag clonado.

El método presentado a continuación es un método de alto rendimiento para evaluar la capacidad de replicación del subtipo C derivada Gag-MJ4virus quiméricos. La transfección en células 293T es sencillo y recuperación de virus toma sólo tres días. In vitro la capacidad de replicación se ensayó en la misma línea de células T basado CEM-CCR5 creado por Brockman et al. 37, pero utilizando importantes modificaciones de protocolo necesaria para la replicación exitosa del subtipo C MJ4 virus quiméricos. El uso de una línea de células T apropiada en lugar de PBMC permite un gran número de virus quimérico MJ4 subtipo C de la prueba con alta reproducibilidad del ensayo. Por último, utilizando un ensayo radiomarcado de la transcriptasa inversa para la cuantificación de virus en el sobrenadante es más rentable que el uso de kits de ELISA de p24 disponibles comercialmente. También le da un rango dinámico más alto, lo cual era importante para la detección de los virus de mal y altamente replican dentro del mismo ensayo y para detectar diferencias sutiles en la replicación entre los aislados.

En conclusión, el método que aquí se presenta ha permitidoel estudio en profundidad de la capacidad de replicación de secuencias gag derivados de VIH-1 subtipo C infecta de forma aguda las personas de Zambia, y tal como está escrita, también podría ampliarse para estudiar otro subtipo C poblaciones infectadas. Se observó un alto grado de variación en las capacidades de replicación entre los diferentes aislados de la mordaza. Además, hemos sido capaces de demostrar una asociación estadística entre la capacidad de replicación del Gag transmitida y el punto de ajuste de la carga viral, así como con CD4 + descenso durante un período de tres años 39. Estos resultados destacan la importancia de estudiar las características virales cómo transmitidos, tales como la capacidad de replicación, interactúan con el sistema inmune del huésped para influir en la patogénesis durante la infección temprana y serán integrales para el desarrollo de intervenciones de vacunas eficaces, así como el tratamiento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. amplificación del VIH-1 gag gene de Infected, Frozen Plasma

  1. Extracto de ARN viral a partir de 140 l descongelado del VIH-1 en plasma infectado utilizando un kit de extracción.
    1. Cuando sea posible, proceder de inmediato a la síntesis de ADNc después de la extracción de RNA como ARN viral no congelada produce los mejores resultados de la amplificación. Si es posible, establezca mezcla maestra de PCR para la amplificación de primera ronda de ADN y se almacenan a 4 ° C antes de la extracción de ARN viral.
  2. Transcribir inversa de ADNc a partir de ARN y amplificar productos de ADN de la primera ronda usando transcriptasa inversa y una ADN polimerasa termoestable en un solo paso RT-PCR.
    1. Tome ARN de -80 ° C congelador (si la congelación era necesario) y deshielo brevemente a temperatura ambiente y luego coloque en el bloque frío. Transferencia de 5 l de ARN a cada tubo de PCR que contiene 45 l de mezcla maestra para dar un volumen final de 50 l. Colocar inmediatamente muestras de ARN restante en -80 ° C congelador.
    2. Después de enzima es unadded a la primera ronda de PCR Master Mix (Tabla 1A), alícuota de 45 l en cada tubo de pared delgada amplificación por PCR para el número de reacciones deseadas. Asegúrese de utilizar tubos de PCR con tapas individuales y no despojar tapas para garantizar la contaminación cruzada entre las muestras mínimas. Colocar tubos de PCR en un bloque frío para proteger el sensible enzima y ARN plantilla RT temperatura. Nota: Las muestras deben ser manejados por triplicado con el fin de probar adecuadamente las cuasiespecies virales. También es importante que se utilice un producto con una alta fidelidad de la enzima ADN polimerasa con el fin de reducir al mínimo la incorporación errónea introducido-PCR. Por favor, consulte la lista de reactivos para el producto recomendado.
    3. Después de plantilla de ARN ha sido añadido a todos los tubos de reacción, tubos de PCR para transferir un termociclador para la amplificación utilizando el programa ciclador se describe en la Tabla 1B. Nota: El producto de esta amplificación se puede utilizar en una segunda ronda de PCR anidada.
  3. Realizar un sí anidadocond-ronda de amplificación por PCR, usando 1 l de la primera ronda de amplificación por PCR (1,2) como la plantilla de ADN.
    1. Alícuota de 49 l de mezcla de segunda ronda de PCR maestro (Tabla 2A) a cada tubo de PCR de paredes finas para el número de reacciones deseadas. Transferencia de 1 l de la amplificación por PCR de primera ronda a cada tubo de reacción para dar un volumen final de 50 l. Nota: Esto servirá de ADN como molde para la amplificación de la segunda ronda. También es importante utilizar una ADN polimerasa con capacidades muy alta fidelidad y corrección de pruebas con el fin de reducir al mínimo la incorporación errónea introducido-PCR. Por favor, consulte la lista de reactivos para el producto recomendado.
    2. Traslado de segunda ronda mezcla de reacción PCR para termociclador y el programa de ejecución se describe en la Tabla 2B. Nota: Después de la finalización del programa, los productos de esta reacción se ejecutan en un gel de agarosa para confirmar la producción del producto.
  4. Añadir 3 l de tinte 5x carga en 5 & #181; l del volumen de reacción de segunda ronda 50 l y correr a 120 V en un gel de agarosa-TAE al 1% que contiene un ADN a las manchas UV fluorescente hasta que se resuelvan las bandas. Visualice 1,6 kb bandas sobre un iluminador de luz azul (véase la Figura 1A).
  5. Ejecute el volumen de reacción de 45 l que queda en un gel de agarosa-TAE al 1% que contiene una mancha de ADN, y extirpar las bandas apropiadas con una hoja de afeitar limpia.
    1. Extraer ADN de la porción de gel usando un kit de purificación de gel, eluir en agua libre de nucleasa, combinar tres reacciones positivas por individuo, y congelar el producto a -20 ° C para su uso posterior.

2. Preparación Amplicones mordaza para la clonación mediante la introducción de los sitios de restricción necesarios

  1. Amplificar la repetición terminal larga (LTR) / 5 parte de 'UTR del plásmido MJ4 (véase la Tabla 3).
  2. Visualice 1,3 kb productos de PCR en iluminador, sobre consumos específicos amplificados positivos, gel de purificar y congelar previamentedescrito (1.4,1.5; véase la Figura 1B).
  3. Crear fusionado amplicones gag MJ4 LTR través de "empalme de superposición-extensión" PCR (véase la Tabla 4).
  4. Visualice, impuestos especiales, purificar, y congelar los 3,2 kb amplicones como en 1.4,1.5 (ver Figura 1C).

3. Clonación Amplified Los genes gag en el MJ4, subtipo C, clon molecular infeccioso

  1. Digerir 1,5 g de plásmido MJ4 y 1,5 g de producto purificado LTR gag PCR con la endonucleasa de restricción BclI (sensible a la metilación) durante 1,5 horas a 50 ° C (véase la Tabla 5A).
  2. Añadir 1 l de NgoMIV a la reacción de digestión y se incuba a 37 ° C durante 1 hr.
  3. Añadir colorante de carga 5x a reacciones de digestión de restricción y lentamente el volumen total a electroforesis en un gel de agarosa-TAE al 1% que contiene una mancha de gel de ADN durante 1-2 horas a 100 V. Visualizar, el consumo, y purificar bandas indicadas anteriormente para la clonación como descRibed (ver Figura 2).
  4. Preparar reacciones de ligación utilizando purificada inserto gag LTR y el ADN vector MJ4 a 3: inserción 1 al cociente vector. Incubar reacciones de ligación durante la noche a 4 ° C (véase la Tabla 5B).
  5. Transformar bacterias JM109 competentes químicamente con productos de ligación y se extendió sobre placas de agar LB con 100 mg / ml de ampicilina y crecer a 30 ° C durante 22 + horas.
    1. Descongele JM109 células competentes en hielo durante 15 min. Etiquetar 1,5 ml tubos de microcentrífuga y se enfría en hielo.
    2. Alícuota 50-100 l de células JM109 para enfriados previamente 1,5 ml tubos de microcentrífuga. Añadir 2,5-5 l de reacción de ligación a células JM109, agitando suavemente el tubo para mezclar y volver inmediatamente a hielo. Se incuban las células competentes con producto de ligación en hielo durante 30 min.
    3. Heat shock 1,5 ml tubos de microcentrífuga que contenían células competentes JM109 y reacción de ligación en un bloque de calor C 42 ° durante 45 segundos y volver a hielo durante al menos 3 min.
    4. Añadir 50 l de medio SOC a cada tubo de microcentrífuga y la placa de toda la reacción de transformación a temperatura ambiente en placas de agar LB-suplementadas con 100 g / ml de ampicilina.
    5. Placas de transferencia a un 30 ° C incubadora y dejar durante 20 horas, o hasta que las colonias están configurados de forma clara.
  6. Escoja colonias aisladas y crecer en 4 ml de LB con 100 mg / ml de ampicilina a 30 ° C durante 22 + horas.
  7. Centrifugar los cultivos a 3.200 xg durante 15 min, verter el caldo, y extraer el ADN plásmido.
  8. Para confirmar la clonación de fidelidad, cortar el ADN miniprep con NgoMIV y enzimas de restricción HpaI en una doble digestión a 37 ° C durante 2 horas. Analizar el 1% de agarosa TAE-gel (véase la Tabla 5C).
  9. Secuencia de la región de inserción LTR-gag de cada plásmido utilizando los siguientes cebadores: GagInnerF1, GagF2, Rev1, Rev3 y GagR6 (Tabla 6) para confirmar la identidad de secuencia.
  10. Comparación de las secuencias clonadas obtenidas con las secuencias población derIVED del amplicón purificado inicial a partir de 1.5.1. Nota: Es importante evaluar en última instancia, la capacidad de replicación de dos clones independientes con el fin de garantizar que ningún fenotipos de replicación in vitro no se deben a errores troncales introducidas durante el proceso de clonación.

4. Generación y Titulación de replicación competentes Gag-MJ4 quiméricos virus

  1. Generar virus de replicación competente mediante la transfección de 1,5 g del ADN del plásmido miniprep MJ4 quimérico en células 293T usando una proporción de 4: 1 de Fugene HD como se describe por Prince et al 39.
  2. Titulación cosechado reservas de virus en las células TZM-bl, como se describe a continuación y en Prince et al 39.
    1. Placa TZM-bl células 24 h antes de la infección con el virus con el fin de tener un 30-40% monocapa de células confluentes en el día siguiente. Esto por lo general se puede lograr mediante la adición de 5 x 10 4 células en un volumen total de 800 l por pocillo en una placa de 24 pocillos.
    2. Después de la adición de células al pozo, mover suavemente la placa de 24 pocillos hacia adelante y atrás, a continuación, lado a lado con el fin de distribuir las células de manera eficiente. Nunca Swirl - esto se traducirá en las células que se acumulan en el centro de la placa.
    3. El día siguiente, preparar 1% de FBS en DMEM; esto se utiliza para diluir DEAE-dextrano y para diluir las reservas de virus. Stock DEAE-dextrano es 10 mg / ml o 125x, y una concentración final de 80 mg se desea / ml o 1x.
    4. Saque de virus a ensayar desde -80 ° C congelador y el lugar en un agitador para descongelar a temperatura ambiente.
    5. Usando una pipeta multicanal, diluir en serie reservas de virus en un cultivo tisular de fondo redondo tratados placa de 96 pocillos con tapa. Este es un protocolo de dilución de 3 veces. Ver Tabla 7 para el esquema de dilución.
    6. Retire el medio de placas de 24 pocillos de TZM bl sembradas utilizando un aspirador de vacío, asegurándose de no perturbar la monocapa celular. Sólo retire el medio de una placa de 24 pocillos en un momento de forma que las células hacenNo seque.
    7. Añadir 150 l de la 1x DEAE-dextrano + FBS al 1% en mezcla de DMEM a cada pocillo usando una pipeta de 1000 l. No utilice la pipeta de repetición, ya que esto altera la monocapa.
    8. Añadir 150 l de cada dilución de virus al pocillo apropiado. Añadir virus al centro del pozo y agitar suavemente para distribuir uniformemente virus a través de la monocapa de células. Se incuban las células infectadas durante 2 horas en una incubadora de cultivo de tejidos a 37 ° C y 5% de CO 2.
    9. Después de la incubación de 2 horas, añadir 0,5 ml de 10% de FBS en DMEM a cada pocillo y las placas volver a la incubadora durante 48 h adicionales.
    10. Después de 48 horas, las células deben ser 100% de confluencia. Debido MJ4 es un virus de replicación competente, habrá alguna muerte celular, pero esto es de esperar.
    11. Retire el medio de cada pocillo y añadir 400 l / pocillo de solución de fijación (véase la Tabla 8A para la receta). Fijar sólo un plato a la vez. Añadir solución de fijación utilizando una pipeta de 1.000 l, y deje reposar durante 5 minutos atemperatura ambiente.
    12. Retire la solución de fijación y lavar 3 veces con PBS con Ca 2 + / Mg 2 +. Utilice una botella con atomizador para agregar suavemente PBS al lado del pozo para evitar la interrupción de la monocapa. Después del tercer lavado, seque la placa seca sobre papel absorbente.
    13. Añadir 400 l / pocillo de solución de tinción (véase la Tabla 8B para la receta) a cada pocillo de la placa de 24 pocillos, y se incuban a 37 ° C durante al menos 2 horas. Tiempos de incubación más largos son aceptables, pero los tiempos de incubación deben mantenerse coherente entre los experimentos titulación.
    14. Lavar 2 veces con PBS con Ca 2 + / Mg 2 + y la puntuación de la infección, o añadir PBS y se almacena a 4 º C para la puntuación más tarde. Las placas pueden mantenerse a 4 ° C durante hasta cuatro días, siempre y cuando la monocapa se mantiene hidratada.
    15. Para puntuar para la infección, utilice un marcador permanente para dividir a los pocillos de la placa de 24 pocillos en cuadrantes. Contar todas las células de color azul dentro de un campo de visión, mediante una ampliación total de 200X, una vez encada uno de los cuatro cuadrantes de un pozo.
    16. Calcule unidades infecciosas por l de la siguiente manera: [(# células azules / 4) x 67] / (l virus añadido) = UI / l. Remítase a la Tabla 8C para el volumen en l de virus a cada pocillo. Promedio de varios pozos juntos; los números deben ser relativamente similar para una valoración precisa.

5 Preparación de Medios de Cultivo y Propagación de células GXR25 para vitro Ensayo de replicación en

  1. Preparar RPMI completo (cRPMI) para la propagación de las células GXR25. NOTA: Es muy importante para las células cultura GXR25 al menos 4 meses antes de los experimentos de replicación planificadas (véase el cuadro 9).
  2. Dividir celdas 1:10 dos veces por semana y mantener la densidad celular entre 1 × 10 5 2 x 10 6 células / ml.

6. En la replicación in vitro de Gag-MJ4 Quimeras en GXR25 (CEM-CCR5-GFP) Células

  1. El día antes de la iNFECCIÓN, las células entre 2-3 x 10 5 células / ml dividir a una concentración de manera que estén en crecimiento logarítmico en el día de la infección.
  2. En el día de la infección, retirar las reservas de virus de -80 ° C congelador y descongelación. Calcular el volumen de virus necesaria de cada población en base a la UI / l título de ensayo de células TZM-bl para infectar 5 x 10 5 GXR25 células a una multiplicidad de infección de 0,05, utilizando la fórmula:
    Volumen de virus para la infección (l) = 1 l / X IU x 0.05 x 500.000
    NOTA: Hemos elegido una MOI de 0,05, ya que esto resulta en una fase de crecimiento logarítmica para todos los virus que hemos probado. Es importante llevar a cabo experimentos iniciales con el fin de determinar la óptima para capturar MOI de crecimiento logarítmico para el virus a ensayar.
  3. Diluir virus en cRPMI a un volumen de 100 l (para alcanzar un 0,05 de MOI) y añadir en un pocillo de un cultivo de tejido de fondo en V tratados placa de 96 pocillos. Nota: Incluya una positicinco de control (WT MJ4 infectada) y un negativo (células infectadas simuladas) en cada conjunto de experimentos de replicación. Configure la placa de tal manera que todos los demás la columna está en blanco para limitar la contaminación cruzada entre los pozos. El control positivo es imperativo, ya que se utilizará más adelante como un estándar para normalizar las pistas de replicación, que son una medida de la tasa de replicación de réplicas experimentales.
  4. Contar las células GXR25 utilizando un contador de células automatizado. Calcular el número de células necesarias en total para todas las infecciones (5 x 10 5 Infecciones x #). Alícuota el volumen necesario en un 50 ml tubo cónico y de centrifugación para sedimentar las células. Siempre calcular el 25% más infecciones de lo necesario.
  5. Medios Aspirar cuidadosamente y volver a suspender en cRPMI a una concentración de 5 x 10 5 células / 100 mL.
  6. Células Pipetear en una cubeta estéril y mezclar bien. Usando una pipeta multicanal, añadir 100 l de células en cada pocillo de la placa de 96 pocillos que contenía el virus diluido. Mix a fondo.
  7. Añadir 2 l de solución de 5 mg / ml (100x) de polibreno a cada pocillo y mezclar a fondo las células.
  8. Se incuba a 37 ° C en cultivo de tejidos incubadora con CO2 al 5% durante 3 horas.
  9. Con el fin de lavar las células infectadas, centrífuga placa de 96 pocillos de fondo en V para sedimentar las células. A continuación, retire con cuidado 150 ml de medio y reemplazar con fresco 150 ml de cRPMI sin alterar el sedimento celular. Repite 2 veces más (incluyendo centrifugación) para lavar suficientemente células.
  10. Después de la última centrifugación y adición de 150 l cRPMI, resuspender el sedimento celular con una pipeta multicanal y añadir toda la mezcla de células / virus (aproximadamente 200 l) de cada pocillo de forma independiente a 800 l de cRPMI en un pozo de un tejido de 24 pocillos placa de cultivo.
  11. Colocar la placa en 5% de CO 2 tejido cultura incubadora a 37 ° C.
  12. Cada dos días, retire 100 l de sobrenadante de la superficie de la cultura así y lo transfieren a una U de 96 pocillosplaca -fondo y almacenar congeladas a -80 ° C hasta realizar el ensayo de cuantificación de virus. NOTA: La disposición cuidadosa de los sobrenadantes en placas de 96 pocillos permitirá la transferencia de pipeta multicanal de sobrenadantes de cultivo durante la cuantificación a través de un virión de la transcriptasa inversa (RT) de ensayo radiomarcado. Cada plato debe contener muestras de un estándar de la infección con el fin de normalizar la variación inter-placa en el ensayo de lectura RT.
  13. Después de retirar cada muestra de 100 l, dividir celdas 1: 2 por las células se resuspenden a fondo y la eliminación de la mitad del volumen restante (450 l). Restaurar volumen original (1 ml) mediante la adición de 550 l de cRPMI fresco a cada pocillo.

7. Análisis de la transcriptasa inversa (RT) en sobrenadantes de cultivo de células

Protocolo adaptado de Ostrowski et al 40.

  1. Configure campana de seguridad biológica en una instalación BSL-3 para su uso con materiales radiactivos.
    1. Coloque papel absorbente en hood y reemplazar aspirador para aspirador designado para el uso radiactivo. Nota: Todos los residuos radiactivos debe deshacerse del mismo con arreglo a las normas de seguridad.
  2. Añadir 1-2 l de 10 mCi / ml de [α- 33 P] dTTP y 4 l de 1 M de ditiotreitol (DTT) a cada alícuota de 1 ml de mezcla maestra RT (ver Tabla 10 y Ostrowski et al. 40).
  3. Mezclar cuidadosamente cada tubo de 1.5 ml de la mezcla RT maestro, TDT, y [α- 33 P] dTTP con una pipeta 1.000 l y traslado a un canal estéril.
  4. Vierta 25 l de la etiqueta RT mezclan en cada pocillo de placas de 96 pocillos PCR de paredes finas. Nota: incluir espacio para un control positivo (infección MJ4 WT) y control negativo (infección simulada).
  5. Añadir 5 l de cada sobrenadante a la placa de PCR que contiene la mezcla maestra RT.
  6. Sellar la placa de PCR con cubierta de lámina adhesiva e incubar durante 2 horas a 37 ° C en un termociclador. Por razones de seguridad, rinpuntas de pipeta se con Amphyl y disponer de consejos en pequeño recipiente que contienen residuos Amphyl, que posteriormente serán desechadas con la basura radiactiva.
  7. Después de la incubación, hacer pequeños agujeros en la cubierta de aluminio usando un 200 l pipeta multicanal. Nota: Si las puntas de pipeta tocan líquido en el pozo, sustituyen las puntas antes de pasar a la siguiente columna o fila.
  8. Mix muestras 5x y la transferencia de 5 l de cada muestra de papel a la DE-81. Deje secar al aire 10 min.
  9. Blots Lavado 5x con 1x SSC (cloruro de sodio, citrato de sodio), y luego 2 veces con etanol al 90% a 5 min por lavado. Deje que se seque al aire.
    1. Coloque cada blot en un recipiente de lavado separado, tal como una caja de almacenamiento sandwich, añadir una cantidad suficiente de tampón de lavado (1x SSC o 90% de EtOH) para cubrir blot, y agitar durante 5 min.
    2. Retirar el tampón de lavado en un recipiente separado y repetir. Nota: Los 3 primeros lavados se consideran radiactivos y deben desecharse adecuadamente. Los últimos 2 lavados pueden ser eliminados con regularidad.
  10. Una vez seco, el cocheefully envolver blot en Saran Wrap y exponer a un phosphoscreen en un casete cerrado herméticamente durante la noche a temperatura ambiente.
  11. Analizar phosphoscreens con un PhosphorImager y cuantificar las transcripciones radiactivos.
  12. Dibuja un círculo alrededor de cada señal radiactiva usando software OptiQuant. Grafica los valores de unidad de luz digital (UCD) para generar curvas de replicación.
  13. Con el fin de generar puntuaciones capacidad de replicación, los valores de registro se DLU 10-transformado y las pendientes se calcularon utilizando el día 2, 4, y 6 puntos de tiempo. Pendientes de replicación se dividen por la pendiente de WT MJ4 con el fin de generar las puntuaciones de capacidad de replicación. Es importante normalizar basado en los valores MJ4 WT obtenidos a partir de la misma placa de RT para reducir la variabilidad intra-ensayo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Para ejecutar correctamente este protocolo, lo que crea un plásmido proviral capaz de ensamblar completamente funcionales, infecciosas quimeras Gag-MJ4, el gran cuidado se debe tomar para generar los amplicones PCR apropiados. Determinación de si la PCR ha generado el amplicón de la mordaza de tamaño adecuado es crucial. Los productos deben estar dentro de 100 pares de bases (pb) de la amplificación de aproximadamente 1700 pb se muestra en la Figura 1A. La longitud exacta de este fragmento variará dependiendo del gen gag en estudio. A continuación, la porción 5 'de repetición terminal larga (LTR) del clon molecular MJ4 debe ser amplificada y empalmado con el amplicón de la mordaza con el fin de que sea adecuado para la clonación subsiguiente. El amplicón MJ4 LTR debe ser 1474 pb de longitud. Figura 1B muestra una imagen representativa de gel para el que se indican tamaños de las bandas correctas. Después de que el empalme de superposición-extensión PCR de 41 años, los productos de la mordaza LTR combinados deben seraproximadamente 3200 pb de longitud, como se representa en la Figura 1C.

Una vez que el gen gag se ha hecho adecuado para la clonación por fusión a la 5 'LTR de MJ4, que contiene el sitio necesario NgoMIV restricción, tanto vector y el inserto de la mordaza debe ser digerido con enzimas de restricción BclI y NgoMIV y escindido a partir de un gel de agarosa después de electroforesis separación. Es imperativo para extirpar las bandas vectoriales y de inserción adecuados. Un gel representativo se muestra en la Figura 2. La porción del vector del plásmido MJ4 debe ser de aproximadamente 10.000 pb de longitud, mientras que el inserto gag LTR debería mantenerse en aproximadamente 3000 pb de longitud, como los sitios de restricción están situados en los extremos de el amplicón. Cualquier disminución significativa en el tamaño indicará un corte de sitio adicional en el gen gag bajo estudio.

Después de la ligación de los dos fragmentos, transformación bacteriana, unand aislamiento de ADN plásmido, las quimeras Gag-MJ4 Debe comprobar el tamaño adecuado mediante la realización de una doble digestión con enzimas de restricción NgoMIV y HpaI. De larga duración quimeras Gag-MJ4 que no han incurrido en ningún evento de eliminación durante la replicación bacteriana debe tener un patrón de restricción similar al representado en la figura 3, con dos bandas de aproximadamente 8.700 y 4.300 pb.

Una distinción importante de este protocolo en comparación con los enfoques anteriores, es el uso del clon molecular del VIH-1 subtipo C infecciosa, MJ4, en lugar de que el virus más común NL4-3 laboratorio adaptado. Sin embargo, los enfoques descritos en la sección anterior pueden ser modificados para la clonación de secuencias de subtipo B de la mordaza en pNL4-3.

Una optimización de la multiplicidad de infección (MOI) para su uso en experimentos posteriores se realizó con el fin de seleccionar la MOI ideal que mostró crecimiento logarítmico de la mayoría de los virus probados.La figura 4 representa las curvas de replicación representativos de tres MOI diferentes (0,01, 0,05, y 0,25) para MJ4 (Figura 4A), así como para NL4.3 (Figura 4B). MJ4 replica mucho menos eficiente en las células GXR25 que NL4-3, que es importante tener en cuenta, como una adecuada MOI para la replicación NL4-3 sería probablemente demasiado bajo para detectar replicación MJ4 eficiente. Como se ve en la figura 4A, una MOI de 0,05 en lugar de 0,01 o 0,25, era la opción ideal, ya que se observó un crecimiento logarítmico entre los días 2-6 de MJ4. Para el MOI menor, 0,01, día 6 valores DLU son apenas detectables, y que prevé la generación de Gag-MJ4 virus quiméricos que replican menor que MJ4. Por tanto, esta MOI no capturar el crecimiento de las quimeras Gag-MJ4 más atenuadas, que también pueden ser biológicamente más crítico. Además, una MOI de 0,25 no era ideal, porque los rápidos cinética de replicación viral mataron a un amou sustancialnt de las células incluso por día 4. Esto hace que la curva de la replicación a la meseta, y el cálculo de una pendiente sobre la base de una curva como esta sería subestimar la capacidad de replicación. Sobre la base de curvas generadas para NL4-3, incluso a una MOI de 0,01, dianas celulares disponibles han sido notablemente agotado por día 6 después de la infección. En conclusión, una MOI de 0,05 se encontró que era óptima para un gran panel de Gag-MJ4 virus quiméricos, todos los cuales tenían diversas secuencias gag y diversos grados de replicación.

Un total de 149 de la mordaza-MJ4 virus quiméricos derivados de subtipo C aguda secuencias de Gag se han probado para la replicación in vitro utilizando este ensayo. Los valores normalizados RC variaron de 0,01 a más de 3,5 con algunos virus que se replican más de 100 veces más eficiente que los de tipo salvaje MJ4. Figura 5 muestra las curvas de replicación de nueve representativas-gag MJ4 virus quiméricos, con de tipo salvaje MJ4 representadas en rojo, y demuestra la amplia gama de la replicación capacities observaron. Por lo tanto, la diversidad de secuencia dentro del gen gag solo puede afectar drásticamente la capacidad del virus para replicarse in vitro. Si bien esto es representante de Gag-MJ4 virus quiméricos derivados de Zambia con infección aguda, otras secuencias de subtipo C no se han probado exhaustivamente, y pueden mostrar diferentes cinética de replicación. Por lo tanto, el gran cuidado se debe tomar para optimizar la MOI para adaptarse a la replicación específica de los virus de un estudio particular, porque no puede haber una amplia gama de los niveles de replicación entre diferentes del VIH-1 Gag y redes troncales de aislamientos.

Una de las ventajas de utilizar una línea de células T tales como la línea celular GXR25, que soporta la replicación de MJ4, es el nivel de reproducibilidad observó en relación con los experimentos de replicación utilizando estimuló las células mononucleares de sangre periférica como objetivos. En experimentos de optimización iniciales, MJ4 tipo salvaje exhibió una variabilidad intra-ensayo de 8,7%, y diferent clones de la misma variabilidad Gag-MJ4 virus quimérico exhibido en la replicación del 8,5%. Debido a que diferentes mezclas magistrales y exposiciones phosphoscreen pueden dar valores DLU que difieren ligeramente en magnitud, variabilidad intra-ensayo adicional se puede controlar mediante la ejecución de la misma norma virus (en nuestro caso, de tipo salvaje MJ4) en cada placa de ensayo RT. Figura 6 representa gráficamente la valores DLU derivan de la misma infección MJ4, cuantificado en ocho placas RT diferentes. La normalización a un virus que es común a todos los ensayos de RT puede ayudar a mitigar el potencial de error inducido por estos ligeros cambios en la magnitud de la señal entre ensayos.

Variablemente Inter-ensayo también fue probado y se replica repite en diferentes días fueron altamente correlacionados. Figura 7 representa los valores de puntuación RC normalizadas a partir de dos experimentos independientes realizados aproximadamente un año de diferencia. Se observó un alto grado de correlación con la ausencia de grandes valores atípicos (R 2 = 0,873) between las dos repeticiones independientes.

Aunque altamente correlacionado, hay una cierta variabilidad en la magnitud global de la cinética de replicación entre los dos experimentos independientes. Esto se puede atribuir en parte a la diferencia en los números de paso entre las poblaciones de células GXR25 utilizados en cada experimento. En general, las poblaciones de células GXR25 que han sido pases por un período de tiempo superior a 6 meses tienden a soportar la replicación más eficiente de quimeras Gag-MJ4. Por lo tanto, es aconsejable para evaluar la capacidad de replicación entre grupos de quimeras dentro de un marco de tiempo de un mes. Cuando los pasos anteriores son seguidos de cerca, este ensayo es capaz de producir resultados muy robustos y reproducibles, que son aplicables a una amplia gama de estudios.

Figura 1
Figura 1. Representante imag geles que representan la separación electroforética de los productos de PCR. Para todos los productos de PCR, 5 l de cada reacción de 50 l se mezcló con 3 l de colorante de carga 5x, cargado en un gel de agarosa-TAE al 1% suplementado con 1X SYBR-seguro mancha de gel de ADN, y separados por electroforesis a 120 V durante 45 min. El Promega 1 kb escalera de ADN (carril 1) se utilizó para aproximar los tamaños de amplicón. A) El gen gag se amplificó a partir del ARN viral usando un enfoque de PCR anidada. Debido a las inserciones y eliminaciones, la amplificación de la mordaza puede variar de 1.600-1.700 pb de longitud y aparece ligeramente por encima de los 1.500 pb escalera del ADN marcador. Los carriles 2-5 muestran la amplificación exitosa del gen gag. B) El 5 'LTR de MJ4 se amplificó a partir del plásmido MJ4 de tipo salvaje y se visualizó por medio de la separación electroforética. Los carriles 2-5 representan la amplificación exitosa del producto LTR 1474 pb, que aparece ligeramente por debajo de los 1.500 pb escalera del ADN marcador. C) El 5R17; LTR deriva de tipo salvaje MJ4 y el gen gag amplificado a partir de plasma del paciente se fusionan entre sí a través de empalme de solape de PCR de extensión y se visualizó por medio de la separación electroforética. Los carriles 2-5 representan fusiona con éxito amplicones que son aproximadamente 3200 pb de tamaño, y que aparecen ligeramente por encima de los 3.000 pb escalera del ADN marcador.

Figura 2
Figura 2. imagen gel Representante que representa la separación electroforética de digestiones de restricción para la clonación de genes gag del paciente en MJ4. Fueron digeridos plásmido MJ4 de tipo salvaje y productos de fusión gag LTR con BclI durante 1,5 horas a 50 ° C y NgoMIV durante 1 hora a 37 ° C. Fragmentos de vector y de inserción se visualizaron mediante separación electroforética en un gel de agarosa-TAE al 1% suplementado con 1X SYBR-seguro ADN gEL mancha a 100 V durante 2 h y el uso de un iluminador de luz azul a fin de reducir el daño del ADN inducido por UV. Los fragmentos vectoriales y de inserción adecuados para etapas de clonación posteriores se publican aproximadamente 10.000 pb y 2900 pb, respectivamente.

Figura 3
Figura 3. imagen gel Representante que representa la separación electroforética de la digestión de restricción de Gag-MJ4 ADN plásmido quimera purificado se digirió doblemente. ADN plásmido quimera purificada Gag-MJ4 con NgoMIV y restricción HpaI enzimas durante 2 horas a 37 ° C. Digestiones de restricción se visualizaron por medio de la separación electroforética en un gel de agarosa-TAE al 1% suplementado con 1X mancha de gel de ADN-SYBR de seguridad en 120 V durante 45 min. Los plásmidos sin grandes supresiones se resolverán en dos bandas distintas en aproximadamente 8.700 y 4.300 pb.


Figura 4. replicación de MJ4 y NL4-3 aislados de VIH-1 en la línea celular GXR25 en diferentes multiplicidades de infección (MOI). 5 x 10 5 GXR25 células fueron infectadas como se describe en el protocolo del método con 5 veces el aumento de MOI cada acción de virus. Los sobrenadantes se recogieron en los días 2, 4, 6, y la infección y la producción de viriones 8 después se cuantificó mediante un ensayo radiomarcado transcriptasa inversa. Las infecciones se realizaron por triplicado y las barras de error indican la desviación estándar de las tres repeticiones. (A) MJ4 (B) NL4-3.

Figura 5
Figura 5. gama Representante de replicación para diferentes quimeras Gag-MJ4. 5 GXR25 células fueron infectadas con el tipo salvaje MJ4 o Gag-MJ4 quimeras en una MOI de 0,05, los sobrenadantes se recogieron a intervalos de dos días después de la infección, y la producción del virión cuantificado por una radiomarcado ensayo de RT. La inserción de diversos subtipo C genes gag derivada puede tener un impacto dramático en la capacidad de replicación de MJ4. MJ4 la replicación de tipo salvaje se denota en rojo.

Figura 6
Figura 6 Comparación de la variación intra-ensayo en la transcriptasa inversa radiomarcado (RT) ensayo de cuantificación. El gráfico representa inherente variabilidad intra-ensayo representando los valores de UCD de los mismos sobrenadantes a partir de una sola infección MJ4 de tipo salvaje en ocho ensayo RT diferente placas. La variación en las curvas refleja los ligeros cambios en magnitud de la señal de apuestasplacas ween, que pueden ser corregidos mediante la ejecución de un estándar en cada plato RT, que se puede utilizar posteriormente para normalizar las laderas de quimeras Gag-MJ4 ensayadas en el mismo plato.

Figura 7
Figura Los mismos virus quimérico Gag-MJ4 se utilizaron para infectar células GXR25 en dos experimentos independientes 7. reproducibilidad del ensayo de replicación a través del tiempo en la línea celular GXR25. Cabo de aproximadamente un año de diferencia. Las puntuaciones de replicación se han generado mediante el cálculo de la pendiente de los valores transformados logarítmicamente DLU y la normalización de la pendiente que el de tipo salvaje MJ4. Quimeras gag-MJ4 que se replican más eficientemente que de tipo salvaje MJ4 tener puntuaciones de replicación mayor que 1, y aquellos que se replican menos eficientemente que de tipo salvaje MJ4 tener puntuaciones de replicación menor que 1. Los dos mediciones independientes están fuertemente correlacionados (R 2 = 0.87, regresión lineal) y destacar la reproducibilidad de los ensayos realizados en diferentes momentos y con las células en diferentes pasajes.

A)

Reactivo Volumen de reacción 1x (l)
2x Reacción Mix (Invitrogen) 25
Libre de nucleasa H 2 O 17
GOF Cebador directo (20 mM de concentración) 1
Cebador inverso VIFOR (20 mM de concentración) 1
Superíndice III en un solo paso Enzyme Mix 1
Plantilla de ARN 5
Volumen total 50

B)

Número de ciclos Tiempo (hr: min: seg) Temperatura (° C)
1 01:00:00 50
1 02:00 94
10 Doce y cuarto 94
Doce y media 56
05:00 68
40 Doce y cuarto 94
Doce y media 56
05:00 + 5 segundos / ciclo 68
1 12:00 68
1 4
Fin

Cuadro 1 A) mezcla y B Master) la mordaza de primera ronda. * Nota: secuencia del cebador GOF: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. VIFOR secuencia del cebador: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reactivo Volumen de reacción 1x (l)
Libre de nucleasa H 2 O 35.5
5x Phusion HF Buffer 10
dNTPs (40 mM) desoxinucleótidos 1
Cebador GagInnerF1 (20 mM de concentración) 1
BclIDegRev2 Cebador inverso (20 concentración M) 1
Polimerasa Phusion Hot Start II 0,5
Primera ronda de PCR como plantilla 1
Volumen total 50

B)

Número de ciclos Tiempo (hr: min: seg) Temperatura (° C)
1 Doce y media 98
29 Doce y diez 98
Doce y media 53
01:00 72
1 10:00 72
1 4
Fin

Cuadro 2 A) mezcla y B Master) condiciones del termociclador para la segunda ronda de amplificación gag anidados. * Nota: GagInnerF1 primer secuencia: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 secuencia del cebador: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reactivo Volumen de reacción 1x (l)
Libre de nucleasa H 2 O 35.5
5x Phusion HF Buffer 10
dNTPs (40 mM) desoxinucleótidos 1
Cebador MJ4For1b (20 mM de concentración) 1
MJ4Rev Cebador inverso (20 concentración M) 1
Polimerasa Phusion Hot Start II 0,5
MJ4 plásmido como plantilla (10 ng / ul) 1
Volumen total 50

B)

Número de ciclos Tiempo (hr: min: seg) Temperatura (° C)
1 Doce y media 98
29 Doce y diez 98
Doce y media 58
Doce y cuarenta y cinco 72
1 10:00 72
1 4
Fin

Cuadro 3 A) mezcla y B Master) condiciones del termociclador para la amplificación 5 'MJ4 LTR. * Nota: secuencia del cebador MJ4For1b: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev primer secuencia: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reactivo Volumen de reacción 1x (l)
Libre de nucleasa H 2 O 34.5
5x Phusion HF Buffer 10
dNTPs (40 mM) desoxinucleótidos 1
Cebador MJ4For1b (20 mM de concentración) 1
BclIRev Cebador inverso (20 concentración M) 1
MJ4 LTR 1,3 kb amplicón (gel purificado, ~ 50 ng) 1
Polimerasa Phusion Hot Start II 0,5
Amplicón Gag (purificado en gel, ~ 100 ng) 1
Volumen total 50

B)

Número de ciclos Tiempo (hr: min: seg) Temperatura (° C)
1 Doce y media 98
29 Doce y diez 98
Doce y media 58
Una y media 72
1 10:00 72
1 4
Fin

Cuadro 4 A) mezcla y B Master) condiciones del termociclador para empalme de superposición-extensión PCR para generar inserciones de gag LTR. * Nota: secuencia del cebador BclIRev: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reactivo Volumen de reacción 1x (l) Tiempo de incubación (h) La incubación de temperatura (° C)
1,5 g de 3 kb LTR amplicón gag o plásmido MJ4 x l para 1,5 g
NEB CutSmart Buffer (previamente NEB Buffer # 4) 2
Enzima de restricción BclI 1
Libre de nucleasa H 2 O x
Volumen total 19 1.5 50
NgoMIV enzima de restricción 1
Volumen total 20 1 37

B)

Reactivo Volumen de reacción 1x (l) Tiempo de incubación (h) La incubación de temperatura (° C)
50 ng corte MJ4 vector plasmídico x l de 50 ng
45 ng corte LTR inserto gag (3: 1) x l de 45 ng
Tampón de ligasa 10x Roche 2
Roche ADN ligasa de T4 (5 U / l) 1
Libre de nucleasa H 2 O
Volumen total 20 18 + (durante la noche) 4

C)

Reactivo Volumen de reacción 1x (l) Tiempo de incubación (h) La incubación de temperatura (° C)
450 ng de plásmido Gag-MJ4 x l de 450 ng
NEB CutSmart Buffer (previamente NEB Buffer # 4) 2
NgoMIV enzima de restricción 0,5
Enzima de restricción HpaI 0,5
Libre de nucleasa H 2 O x
Volumen total 20 2 37

Cuadro 5 A) Restricción de digerir mezcla maestra y B) reacción de ligación para la generación de Gag-MJ4 provirus quimérico. C) restricción de diagnóstico digest para asegurar Gag-MJ4 fidelidad clonación.

Nombre Primer Secuencia de nucleótidos (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
FOR3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Cuadro 6 Lista de cebadores de secuenciación necesarias para confirmar LTR 5 'y la secuencia gag identidad de Gag-MJ4 provirus quimérico.

Bueno A 8 l virus + 232 l 1% FBS en DMEM
Bueno B 80 l de Pozo A + 160 l 1% FBS en DMEM
Bueno C 80 l de Pozo B + 160 l 1% FBS en DMEM
Bueno D 80 l de Pozo C + 160 l 1% FBS en DMEM
Bueno E 80 l de Bueno D + 160 l 1% FBS en DMEM
Bueno F 80 l de Pozo E + 160 l 1% FBS en DMEM

Tabla 7. esquema de dilución (3fold) para la titulación de virus infecciosos en las células TZM-bl.

A)

Reactivo Volumen
PBS sin Ca 2 + o Mg 2 + 500 ml
Gluteraldehyde 4 ml
Formaldehído 11 ml

* Nota: Almacenar a 4 ° C.

B)

Reactivo Volumen
PBS sin Ca 2 + o Mg 2 + 4,75 ml
Ferricianuro de potasio (0,2 M) 100 l
Ferrocianuro de potasio (0,2 M) 100 l
Cloruro de magnesio (1 M) 20 l
X-gal (50 mg / ml) 40 l

* Nota: Asegúrese fresco y almacenar lejos de la luz hasta su uso.


C.

Original y dilución A B C D E F
Volumen de virus (l) a los pocillos de una fila de placa de 24 pocillos 5 1.6667 0.5556 0.1852 0.06173 0.02057

8. Tabla A) B) soluciones de fijación para la titulación de los virus quiméricos Gag-MJ4 en la línea celular indicadora TZM-bl. C) El volumen de virus por pocillo para el cálculo de unidades infecciosas / l.

Reactivo Volumen
Suero bovino fetal (FBS), que se define 55 ml
La penicilina, la estreptomicina, glutamina (100x) 6 ml
Tampón HEPES (1 M) 6 ml

Cuadro 9 Receta para el medio completo RPMI para la propagación de las células GXR25.

Reactivo Volumen (ml)
NucleasaH 2 O exento 419,5
Tris-Cl, pH 7,8 (1 M) 30
El cloruro de potasio (1 M) 37.5
Cloruro de magnesio (1 M) 2.5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1.02
Ácido poliadenílico, sal de potasio (2 mg / ml) 1.25
Oligo-dT (25 mg / ml) 3.25
Volumen total 500

Cuadro 10 Receta para el radiomarcado con transcriptasa inversa maestro de la mezcla de ensayo. * Nota: tienda como alícuotas de 1 ml a -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Debido a la longitud y el carácter técnico de este protocolo, hay varios pasos que son fundamentales tanto para la construcción exitosa de plásmidos Gag-MJ4 quiméricos, así como para la cuantificación de la capacidad de replicación viral. Aunque la estrategia de clonación basado enzima de restricción para la introducción de genes gag extranjera en MJ4 descrito en este protocolo tiene numerosas ventajas sobre los métodos basados ​​en la recombinación utilizadas anteriormente, el protocolo puede ser técnicamente difícil si los pasos críticos no se siguen con precisión.

En primer lugar, es absolutamente esencial utilizar ADN plásmido MJ4 que se ha generado en una cepa bacteriana competente carece de los metilasas ADN DCM y represas. Esto es necesario ya que la actividad enzimática de la endonucleasa de restricción BclI, que se utiliza para clonar genes gag en el esqueleto MJ4, es presa / DCM metilación sensible. El JM110 y SCS110 (un derivado de JM110 negativo endA) E. cepas de coli unre adecuado para generar ADN plasmídico no metilado MJ4. Además, para la escisión de bandas vectoriales y de inserción, es muy recomendable que un iluminador de luz azul se utiliza para la visualización. Esto reducirá el daño del ADN de longitud de onda dependiente de UV y aumentar drásticamente la eficiencia de clonación. Si un iluminador de luz azul no está disponible, la eficiencia de clonación se puede maximizar mediante la visualización de ADN con mancha de gel de ADN SYBR Caja de seguridad en lugar de bromuro de etidio y minimizando el tiempo de exposición a rayos UV.

Finalmente, la clonación molecular con grandes (> 10kb) y / o plásmidos retrovirales tales como MJ4 ha sido tradicionalmente difícil para una variedad de razones. Plásmidos grandes reducen la eficiencia de transformación de cepas bacterianas competentes 42, mientras que las inserciones retrovirales, que contienen la repetición terminal larga (LTR) secuencias, reducir la estabilidad del plásmido y comprometen la fidelidad de replicación del ADN del plásmido en el huésped bacteriano que conduce a deleciones del genoma retroviral 43 E. coli cepa sobre la cepa DH5a, en nuestras manos. Debido a la naturaleza inestable del plásmido, productos de plásmidos purificados siempre deben ser revisados ​​por el tamaño plásmido correcto por digestión con enzimas de restricción; Aquí, una doble digestión con las endonucleasas de restricción NgoMIV y HpaI a 37 ° C durante 2 horas.

Una vez que la generación exitosa de plásmidos Gag-MJ4 quiméricos se ha logrado, el virus se genera a través de la transfección de 293T células, titularon en una línea indicadora celular, las células TZM-bl, y la capacidad de replicación se mide utilizando una línea de células T basado en la CEM. La línea celular CEM-GXR25 basado utilizado para estos estudios de replicación es una de las pocas líneas de células T establecida capaces de apoyar la entrada y replicación de cepas con tropismo CCR5 del VIH-1. Esto se ha logrado por transducción retroviral para permitir la expresión estable de CCR5 humano 37. Esta línea celular expresa de forma natural CXCR4 y soportar la replicación de CXCR4-trópico VIH-1, tales como la cepa de laboratorio adaptado NL4-3. Sin embargo, con el fin de soportar la replicación eficiente de cepas con tropismo CCR5, tales como MJ4, las células GXR25 deben propagarse por no menos de 4 meses antes de la infección. Correctamente culturas a pases pueden apoyar la replicación incluso después de pases por hasta 1 año. El control cuidadoso de la replicación del tropismo CCR5 en todo passaging es esencial para los experimentos exitosos.

Como con cualquier técnica, hay limitaciones a la proprotocolo que debe ser considerado. Debido a la ubicación de sitios de restricción en el plásmido MJ4, así como la disponibilidad de sitios de restricción de origen natural que se conservan en el VIH-1 aislados, distal del sitio de restricción 3 ', BclI, se encuentra 137 nucleótidos del codón de parada de gag. Aunque esto genera un gen de la proteasa quimérica, esta región es del 96,5% conservado en esta cohorte, y no observamos una gran cantidad de virus quiméricos muertos o defectuosos.

Una de las ventajas de utilizar el subtipo C MJ4 clon molecular infeccioso con el subtipo C secuencias derivadas es que reduce el riesgo de subóptima de emparejamiento de genes entre los genes gag y vectores columna vertebral de diferentes subtipos. Sin embargo, existe una cierta cantidad de diversidad dentro de clado como se evidencia por la agrupación de VIH-1 secuencias por país o región, incluso cuando se encuentra dentro del mismo subtipo 31. Esto podría contribuir a la vinculación subóptima entre los genes gag derIVED de Zambia con infección aguda y la columna vertebral clon molecular infeccioso MJ4, que se deriva de un individuo infectado crónicamente desde Botswana 38. Sin embargo, la mayoría de las construcciones analizadas produjo virus de progenie infecciosa. Como diferente del VIH-1 subtipo C clones moleculares infecciosos se vuelven más ampliamente disponible, será importante para validar este sistema mediante la clonación en estos genes gag del VIH-1 subtipo C en otras cadenas principales con el fin de asegurarse de que hay un sesgo mínimo introducido debido de incompatibilidades de backbone.

La línea celular GXR25 es una línea celular única, específicamente debido a su capacidad para apoyar y CXCR4, dos cepas con tropismo CCR5 y su VIH-1 reportero GFP inducible 37. Sin embargo, existen algunas limitaciones y deben ser considerados cuidadosamente antes de utilizar esta línea de células para los experimentos adaptados de este protocolo. La línea celular GXR25 no parece apoyar la entrada de la mayoría de subtipo C o A, CCR5-trópico, primary aísla hemos probado. Además, el padre línea celular CEM de la que la línea celular se deriva GXR25 exposiciones altos niveles de la ciclofilina A, de hasta 2 a 4 veces más alta expresión de la línea celular Jurkat 44. Debido a los altos niveles de la ciclofilina A, el defecto de replicación normalmente asociada con la canónica HLA-B * 57 asociado de escape mutación, T242N, que se atribuye a una disminución de la capacidad de la cápside de obligar a la ciclofilina A, no puede ser detectada fácilmente en esta línea celular particular 25. Así, la línea celular CEM-GXR25 basado no es ideal para el estudio de defectos de replicación asociados con mutaciones en el bucle de la cápside del VIH-1 se une a ciclofilina.

Finalmente, mientras que este protocolo es ideal para analizar la capacidad de replicación de secuencias gag derivados de los puntos de tiempo agudas, modificaciones se deben hacer con el fin de estudiar la capacidad de replicación de Gag genes derivados de individuos crónicamente infectados. Este protocolo implica la amplificación de secuencias de población desde los puntos de tiempo agudas (mediana de 45 días post fecha de infección estimado) cuando la diversidad viral es limitada. El gen gag de cada quimera A continuación, se secuenció y se comparó con la población inicial amplicón de PCR para asegurar la clonación de fidelidad. Debido a la limitada diversidad de secuencias en puntos de tiempo agudas, la clonación de productos de PCR de población es posible. Sin embargo, existe diversidad de secuencias dentro de las cuasiespecies virales de un individuo crónicamente infectado; por lo tanto, con el fin de evaluar con precisión la capacidad de replicación de las cuasiespecies crónicas, la amplificación del genoma único debe ser empleado para capturar varias variantes representativas. Cada una de estas variantes se deben ensayar para la replicación in vitro.

Esta técnica tiene varias aplicaciones más amplias, que se derivan de sus ventajas sobre los métodos existentes. Dado que este proceso da como resultado un plásmido de replicación competente clonal, es simple de usar construcciones para m adicionalestudios utagenesis, que pueden ayudar a dilucidar la contribución de los residuos específicos a la replicación viral. Por otra parte, mediante la clonación de genes gag de puntos temporales longitudinales, se puede evaluar la evolución de la capacidad de replicación viral a través del tiempo y cómo estos cambios pueden afectar a la patogénesis de una persona infectada por VIH-1.

Esta técnica se puede modificar a fin de ampliar su utilidad para diferentes aplicaciones. VIH-1 proteínas virales adicionales pueden ser diseñados en el plásmido MJ4 con el fin de evaluar sus efectos sobre la replicación viral o sus interacciones con las proteínas del huésped. Esto se puede lograr mediante el diseño de sitios de restricción adicionales en regiones deseadas en el genoma a través de la introducción de cambios de nucleótidos silenciosas. Sin embargo, una consideración especial se debe tomar cuando la ingeniería de nuevos sitios de restricción en la 'mitad del genoma del VIH-1 como muchas proteínas accesorias son codificadas en marcos de lectura alternativos 3, y los cambios silenciosos en unoproteína podría dar lugar a sustituciones de aminoácidos en otro. En este caso, los sitios de restricción métodos de clonación independientes tales como los discutidos por Dudley et al. 45 puede superar esta limitación. Secuencias virales derivados de diferentes poblaciones pueden tener diferentes rangos de capacidades de replicación, y la MOI pueden ajustarse en consecuencia con el fin de capturar la mayoría de los aislados virales dentro de su fase logarítmica de crecimiento. Finalmente, la línea celular GXR25 ha sido establemente transfectada con GFP bajo un dirigida por LTR, el promotor inducible por Tat, y la propagación viral se puede medir como una función de las células positivas para GFP mediante citometría de flujo 37 como una alternativa al ensayo de RT descrito aquí o un tradicional ELISA p24.

En conclusión, este protocolo ofrece una técnica eficiente y eficaz para evaluar el VIH-1 de replicación viral como conferido por el gen gag, que codifica una proteína estructural conservada necesario para la formación de viriones adecuada, Brotación, la maduración y el desmontaje 46-48. Además, esta técnica genera un plásmido clonal competente en replicación, que es ideal para estudios de mutagénesis y, por tanto, proporciona un método para elucidar los determinantes de aminoácidos específicos de la aptitud viral. Estudios como estos son imprescindibles para mejorar la comprensión de cómo la evolución viral inmune impulsado afecta patogénesis y progresión de la enfermedad en el VIH-1 en individuos infectados.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Una enzima de restricción método basado clonación para evaluar la<em&gt; In vitro</em&gt; Capacidad de replicación del VIH-1 subtipo C Gag-MJ4 quiméricos virus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter