Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Ett restriktionsenzym Based Kloning metod för att bedöma doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fastställande både värd och virus särdrag som påverkar HIV-1 patogenes och sjukdomsprogression är av största vikt för rationell vaccindesign. Det cellulära immunsvar är en viktig del av människans immunsvar mot hiv-1-infektion. Cytotoxiska T-lymfocyter (CTL) är nödvändiga för den inledande kontrollen av akut viremi och låt värd att upprätta ett stabilt tillstånd (börvärde) virusmängd 1,2. Experimentell utarmning av dessa effektorceller resulterar i förlust av viruskontroll 3,4. Trots detta fly mutationer uppstår inom virusgenomet som gräva CTL erkännande av virusinfekterade celler 5-9.

Vissa HLA-alleler har förknippats med lägre virusnivåer och långsammare sjukdomsprogression med B * 57, B * 27 och B * 81 10-15. En del av den skyddande fördelen av HLA klass I-alleler kan tillskrivas det faktum att de är inriktade funktionellt begränsade regioner av genomet, såsom Gagoch selektera för escape-mutationer som minskar förmågan hos viruset att replikera in vitro 16-21. Även flykt från det cellulära immunsystemet är fördelaktigt för viruset i samband med väljar HLA klass I allel, kan effekten av dessa mutationer har differential konsekvenser för värden vid överföring till en HLA-inkompatibla individ 22,23. Därför kommer förstå effekterna av överförda HLA-associerade utrymnings mutationer på virusreplikakapaciteten vara viktigt att öka våra kunskaper om tidiga HIV-1 patogenes.

Även om stora framsteg har gjorts för att identifiera och karakterisera fitness defekter enskilda flykt mutationer associerade med specifika HLA klass I alleler 24-29, naturligt förekommande HIV-1-isolat har unika och komplexa spår av HLA-associerade polymorfism, troligen härrör från HLA medierad immun tryck av olika immunogenetiska bakgrunder 30. I aprevious analys Goepfert et al. visade att en ansamling av HLA-associerade mutationer i de överförda Gag sekvenser härledda från 88 akut infekterade Zambians associerades med en minskning av börvärde virusmängd 31. Detta tyder på att överföring av skadliga utrymnings mutationer, särskilt i Gag, till HLA-inkompatibla mottagare ger en klinisk nytta, och kan bero på försvagade virusreplikation. Framåt är det absolut nödvändigt att studera hur komplicerade kombinationer av Gag polymorfism inom naturligt förekommande isolat arbetar tillsammans för att definiera egenskaperna hos den överförda virus såsom replikakapacitet, och hur tidigt replikering kan i sin tur påverka HIV-1 kliniska parametrar och sent skede patogenes.

Brockman et al. Visade först en länk mellan replikeringskapacitet gag-pro sekvenser isolerade under kronisk skede infektion och virus i både subtyp C och B-infektioner32-35. Den experimentella metod som presenteras i dessa studier, även lämplig för prövningen av replikeringskapacitet sekvenser härledda från kroniskt infekterade individer in vitro, har flera tekniska förbehåll och begränsningar som gör studerar HIV-1 replikationsförmåga in subtyp C akut infekterade individer svårt. Denna metod förlitar sig på rekombination av befolkningen baserade PCR-amplifierade sekvenserna in i subtyp B NL4-3 provirus, som blev framtagen ur delar från LAV, ett laboratorium anpassat virus lager 36. Virus generationen åstadkoms genom samtransfektion av en CEM-baserade T-cellinje 37 med PCR-amplikoner och digere delta- gag-pro NL4-3 DNA. Denna metod kräver utväxt av viruset under en period av veckor till månader, potentiellt skev arten av det utvunna viruset lager i förhållande till de virala kvasispecies in vivo och därför förändra mätningen av replikeringsförmåga in vitro. Denna metod Iär mer lämpligt för att studera kroniskt infekterade individer, där den väljer effektivt för virus med högsta replikationsförmåga, och där kloning många olika virusvarianter från ett stort antal kroniskt infekterade individer är ganska arbetskrävande och därför inte genomförbart. Men inom en akut infekterad individ, finns det i allmänhet 1-2 varianter närvarande, och därmed eliminerar risken för snedställning typen av återvunna viruset lager, genom in vitro selektionstryck, möjliggör en mer exakt bedömning av in vitro-replikationsförmåga. För det andra kräver den här metoden rekombination subtyp C gag-pro-sekvenser i en subtyp B härledd ryggraden, och skulle kunna införa ryggrad inkompatibilitet fördomar i analysen. På grund av dessa begränsningar, måste ett stort antal sekvenser analyseras för att övervinna eventuella fördomar införs.

Här beskriver vi en alternativ experimentell lämpach lämplig för att studera sekvenser härledda från subtyp C akut infekterade individer. Vi använder ett restriktionsenzym baserad kloningsstrategi för att införa gag-genen från akuta punkter HIV-1 subtyp C infekterade individer infektions time in subtyp C proviral ryggrad, MJ4. Användningen av MJ4 som en gemensam ryggrad på sig att klona gag-gener är avgörande för analysen av subtyp C härledda sekvenser. MJ4 kommer från ett primärt isolat 38, och därmed skulle vara mindre benägna att införa fördomar på grund av subtyp inkompatibilitet mellan ryggraden och gag-genen. Dessutom tillåter den strategi för att använda enzym baserad begränsning kloning för provirala konstruktioner som ska transfekteras direkt i 293T-celler, samt för indrivning av en klonal virus lager identisk med den klonade gag-sekvensen.

Metoden presenteras nedan är en hög genomströmning metod för bedömning replikeringskapacitet subtyp C härlett Gag-MJ4chimära virus. Transfektion in i 293T-celler är enkel och återvinning av virus tar bara tre dagar. In vitro replikering kapacitet analyseras på samma CEM-CCR5 baserade T-cellinje som skapats av Brockman et al. 37, men med hjälp av viktiga protokoll modifieringar som behövs för att framgångsrikt replikering av subtyp C MJ4 chimära virus. Användningen av en lämplig T-cellinje stället PBMC möjliggör ett stort antal subtyp C MJ4-chimär virus som skall testas med hög analys reproducerbarhet. Slutligen, med hjälp av en radiomärkt omvänt transkriptas assay för kvantifiering av virus i supernatanten är mer kostnadseffektivt än att använda kommersiellt tillgängliga p24 ELISA-kit. Det ger också en högre dynamiskt omfång, vilket var viktigt för att upptäcka både dåligt och mycket replikerande virus inom samma analys och för att upptäcka subtila skillnader i replikering mellan isolat.

Sammanfattningsvis har metoden presenteras här tillåtet förden fördjupade studie av replikeringskapacitet gag sekvenser härledda från HIV-1 subtyp C akut infekterade individer från Zambia, och som skrivet, skulle också kunna utvidgas till att studera andra subtyp C smittade befolkningar. En hög grad av variation i replikeringskapacitet mellan olika Gag isolat observerades. Dessutom kunde vi visa ett statistiskt samband mellan replikeringskapacitet på den utsända Gag och börvärde virusmängd och med CD4 + nedgång under en treårsperiod 39. Sådana resultat betona vikten av att studera hur överförd virus egenskaper, såsom replikering kapacitet, interagera med värdens immunsystem för att påverka patogenesen vid tidig infektion och kommer att vara integrerade för att utveckla effektiva vaccin interventioner samt behandling.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 Förstärkning av HIV-1 gag Gene från Infected, Frozen Plasma

  1. Utdrag viralt RNA från 140 l tinade HIV-1 infekterade plasma med hjälp av en extraktion kit.
    1. När så är möjligt, omedelbart vidare till cDNA-syntes efter RNA-extraktion som ofruset viralt RNA ger bäst förstärkningsresultat. Om möjligt, inrätta PCR Master Mix för första omgången DNA-förstärkningen och förvara vid 4 ° C före viralt RNA extraktion.
  2. Omvänd-transkribera cDNA från RNA och förstärker första omgången DNA-produkter med hjälp av omvänt transkriptas och ett värmestabilt DNA-polymeras i en enstegs RT-PCR.
    1. Ta RNA av -80 ° C frys (om frysning var nödvändigt) och kort tina i rumstemperatur och placera i kallt block. Överför 5 ul av RNA till varje PCR-rör innehållande 45 | il av huvudblandning för att ge en slutlig volym av 50 | il. Placera omedelbart återstående RNA-prover i -80 ° C frys.
    2. Efter enzymet är ettdded den första omgången PCR Master Mix (tabell 1A), alikvot 45 pl i varje tunnväggiga PCR-förstärkning röret för antalet reaktioner önskade. Se till att använda PCR-rör med individuella lock och inte beröva proppar för att få minimal korskontaminering mellan proven. Placera PCR-rör i ett kallt blocket för att skydda den temperaturkänsliga RT enzym och RNA-mall. Anm: Proven skall köras i tre exemplar för att adekvat prov på virus kvasispecies. Det är också viktigt att använda en produkt med hög trohet DNA-polymerasenzym för att minimera PCR-presenterad misincorporation. Se listan reagens för den rekommenderade produkten.
    3. Efter RNA-mall har lagts till alla reaktionsrören, överföra PCR-rör till en termocykler för förstärkning med hjälp cyklern program som beskrivs i tabell 1B. Notera: Produkten från denna amplifiering kommer att användas i en andra runda nested PCR.
  3. Utför en kapslad sedir-round PCR-förstärkning, med hjälp av en fil av den första omgången PCR-amplifiering (1.2) som DNA-mallen.
    1. Alikvotera 49 l av andrahands PCR Master Mix (tabell 2A) till varje tunnväggiga PCR-rör för antalet reaktioner önskade. Överför 1 il från den första omgången PCR-amplifiering i varje reaktionsrör för att ge en slutlig volym av 50 | il. OBS: Detta kommer att fungera som mall-DNA för den andra omgången förstärkning. Det är också viktigt att utnyttja ett DNA-polymeras med mycket hög trohet och korrekturläsning kapacitet för att minimera PCR-introducerade misincorporation. Se listan reagens för den rekommenderade produkten.
    2. Överför andra omgången PCR-reaktionsblandning för att termo och köra program som beskrivs i tabell 2B. Anmärkning: Efter genomgången av programmet kommer produkterna från denna reaktion köras på en agarosgel för att bekräfta produktionen av produkten.
  4. Tillsätt 3 l av 5x laddningsfärg till 5 & #181, l av 50 ^ andrahandsreaktionsvolym och köra vid 120 V på en 1% agaros-TAE-gel som innehåller en UV-fluorescerande DNA fläcken tills banden är lösta. Visualisera 1.6 kb band på en blå ljusbelysning (se figur 1 A).
  5. Kör den återstående 45 ^ il reaktionsvolym på en 1% agaros-TAE-gel innehållande en DNA-fläck, och utklippning lämpliga band med ett rent rakblad.
    1. Extrahera DNA från gelskivan med användning av en gel-reningskit, eluera i nukleasfritt vatten, kombinera tre positiva reaktioner per individ, och frysa produkten vid -20 ° C för efterföljande användning.

2. Förbereda gag amplikoner för kloning genom införandet av nödvändiga Restriction webbplatser

  1. Amplify den långa terminala upprepningen (LTR) / 5 'UTR parti av MJ4 plasmiden (se tabell 3).
  2. Visualisera 1,3 kb PCR-produkter på belysnings, punktskatter positiva amplikoner, gel rena och fryser som tidigarebeskrivits (1.4,1.5; se figur 1B).
  3. Skapa smält MJ4 LTR- gag amplikoner via "sammanfogningsöverlappnings-extension" PCR (se tabell 4).
  4. Visualisera, punktskatter, rena och frysa 3.2 kb amplikonema som i 1.4,1.5 (se figur 1C).

3. Kloning Amplified gag gener i MJ4, subtyp C, Infectious Molecular Clone

  1. Matsmältning 1,5 pg av MJ4 plasmid och 1,5 pg av renat LTR- gag-PCR-produkten med BclI (metylering känslig) restriktionsendonukleas för 1,5 h vid 50 ° C (se Tabell 5A).
  2. Lägg ett pl av NgoMIV till uppslutningsreaktionen och inkubera vid 37 ° C under 1 tim.
  3. Lägg 5x laddningsfärg till restriktionsklyvning reaktioner och långsamt elektrofores den totala volymen på en 1% agaros-TAE-gel innehållande en DNA-gel stain för 1-2 h vid 100 V. visualisera, punkt och rena indikerade banden för kloning såsom tidigare described (se figur 2).
  4. Förbered ligeringsreaktioner använder renat LTR- gag insats och MJ4 vektor-DNA på en 3: 1 insats till vektor-förhållande. Inkubera ligeringsreaktioner över natten vid 4 ° C (se Tabell 5B).
  5. Omvandla JM109 kemiskt kompetenta bakterier med ligeringsprodukter och spreds på LB-agarplattor med 100 | ig / ml ampicillin och odla vid 30 ° C under 22 + h.
    1. Tina JM109 kompetenta celler på is under 15 min. Etikett 1,5 ml mikrorör och chill på is.
    2. Alikvot 50-100 l av JM109-celler till redan kylda 1,5 ml mikrorör. Lägg 2,5-5 l av ligeringsreaktion till JM109-celler, snärta röret lätt att blanda och omedelbart återvända till isen. Inkubera kompetenta celler med ligeringsprodukt på is i 30 min.
    3. Värmechock 1,5 ml mikrorör innehållande JM109 kompetenta celler och ligeringsreaktion i ett 42 ° C värmeblock under 45 sekunder och återgå till is i minst 3 min.
    4. Lägg 50 | il av SOC-media till varje mikrocentrifugrör och plattan hela transformationsreaktionen på rumstemperatur LB-agarplattor kompletterade med 100 ^ ig / ml ampicillin.
    5. Överför plattorna till en 30 ° C inkubator och låt stå i 20 timmar, eller tills kolonier tydligt bildas.
  6. Plocka isolerade kolonier och växa i 4 ml LB med 100 ng / ml ampicillin vid 30 ° C under 22 + h.
  7. Centrifugera ner kulturerna vid 3200 xg under 15 minuter, häll av buljong, och extrahera plasmid-DNA.
  8. För att bekräfta att klona trohet, skär miniprep-DNA med NgoMIV och Hpal-restriktionsenzymer i en dubbel smälta vid 37 ° C under 2 tim. Analysera på 1% agaros-TAE-gel (se tabell 5C).
  9. Sekvens LTR-gag insert region i varje plasmid med användning av följande primrar: GagInnerF1, GagF2, Rev1, rev3 och GagR6 (tabell 6) för att bekräfta sekvensidentiteten.
  10. Jämför de klonade sekvenser erhållna med befolkningen sekvenserna derived från den ursprungliga renade amplikonen från 1.5.1. OBS: Det är viktigt att i slutändan bedöma replikeringskapacitet två oberoende kloner för att se till att eventuella in vitro replikering fenotyper inte beror på fel backbone infördes under kloningsprocessen.

4. Alstring och bestämning av antikroppnivå av replikationskompetent Gag-MJ4 chimära virusen

  1. Generera replikationskompetent virus genom transfektion av 1,5 | ig av den chimära MJ4 plasmid miniprep-DNA in i 293T-celler med användning av en 4: ett förhållande av Fugene HD såsom beskrivs av Prince et al 39.
  2. Titer skördade virusstammar på TZM-bl celler som beskrivs nedan och i Prince m.fl. 39.
    1. Plate TZM-bl celler 24 timmar före infektion med viruset för att få en 30-40% sammanflytande cellmonolager följande dag. Detta kan vanligen åstadkommas genom att tillsätta 5 x 10 4 celler i en total volym av 800 | il per brunn i en 24-brunnars platta.
    2. Efter att ha lagt celler till brunnen, försiktigt flytta 24-brunnar framåt och bakåt, sedan sida till sida för att effektivt distribuera celler. Aldrig snurra - detta kommer att resultera i celler ansamlas i mitten av plattan.
    3. Följande dag, förbereda 1% FBS i DMEM; detta kommer att användas för att späda ut DEAE-dextran och att späda virusförråd. Stock DEAE-dextran är 10 mg / ml eller 125x, och en slutlig koncentration av 80 | ig / ml eller 1x önskas.
    4. Ta ut virus lager som ska testas från -80 ° C frys och placera på shaker tina i rumstemperatur.
    5. Med hjälp av en multikanalpipett, seriellt späda virusstammar i en rundbottnad vävnadsodling behandlade 96-brunnar med lock. Detta är en 3-faldig utspädning protokoll. Se tabell 7 för utspädningsschema.
    6. Ta ut mediet från seedade TZM-bl 24-brunnsplattor med en vakuumsug och se till att inte störa cellmonolager. Bara ta bort materialet från en 24-brunnar i taget så att celler görinte torka ut.
    7. Tillsätt 150 pl av 1x DEAE-dextran + 1% FBS i DMEM blandningen till varje brunn med en 1,000 l pipett. Använd inte upprepa pipett eftersom det stör monolager.
    8. Tillsätt 150 l av varje virusspädning till lämplig brunn. Lägg viruset till mitten av brunnen och virvla försiktigt för att jämnt fördela viruset över cellmonoskiktet. Inkubera infekterade celler under 2 h i en vävnadsodlingsinkubator vid 37 ° C och 5% CO2.
    9. Efter två timmars inkubering, tillsätt 0,5 ml 10% FBS i DMEM till varje brunn och retur plattorna till inkubatorn i ytterligare 48 timmar.
    10. Efter 48 timmar bör cellerna vara 100% sammanflytande. Eftersom MJ4 är ett replikationskompetent virus, kommer det att finnas en viss celldöd, men detta är att vänta.
    11. Ta ut mediet från varje brunn och tillsätt 400 | il / brunn av fixeringslösning (se tabell 8A för recept). Fix endast en platta i taget. Lägg fixeringslösning med användning av en 1000 | j, l pipett och låt stå under 5 min vidrumstemperatur.
    12. Ta bort fixeringslösning och tvätta 3x med PBS med Ca2 + / Mg2 +. Använd en sprutflaska för att försiktigt lägga PBS till sidan av brunnen för att undvika att den monolager. Efter den tredje tvätten, blot plattan torka på hushållspapper.
    13. Lägg 400 | il / brunn av färgningslösning (se tabell 8B för recept) till varje brunn i 24-brunnar, och inkubera vid 37 ° C under minst 2 tim. Längre inkubationstider är acceptabla, men inkubationstider bör hållas konsekvent mellan titrering experiment.
    14. Tvätta 2x med PBS med Ca2 + / Mg 2 + och göra mål för infektion eller lägg PBS och förvara vid 4 ° C för att göra poäng senare. Plattorna kan förvaras vid 4 ° C i upp till fyra dagar, så länge som den monoskiktet hålles hydratiserade.
    15. För att göra mål för infektion, använd en permanent markör för att dela brunnar i 24-brunnar i kvadranter. Räkna alla blå celler inom ett synfält, med hjälp av en total förstoring av 200X, en gång ivar och en av de fyra kvadranterna av en brunn.
    16. Beräkna Infektions enheter per il enligt följande: [(# blå celler / 4) x 67] / (il virus ivering) = IE / ul. Se Tabell 8C för volym i pl av viruset sattes till varje brunn. Genomsnittet flera brunnar tillsammans; siffrorna bör vara relativt lika för en exakt titrering.

5. Beredning av kultur medier och Förökning av GXR25 celler för in vitro-Replication analys

  1. Förbered komplett RPMI (cRPMI) för förökning av GXR25 celler. OBS: Det är oerhört viktigt att kulturen GXR25 celler minst fyra månader före planerad replikeringsförsök (se tabell 9).
  2. Split celler 1:10 två gånger per vecka och upprätthålla celltäthet mellan 1 x 5-2 OKTOBER x 10 6 celler / ml.

6. In vitro replikering av Gag-MJ4 chimärer i GXR25 (CEM-CCR5-GFP) celler

  1. Dagen innan jagnfection, dela upp celler till en koncentration mellan 2-3 x 10 5 celler / ml, så att de är i logaritmisk tillväxt på dagen för infektionen.
  2. På dagen för infektion, avlägsna viruslagren från -80 ° C frys och tining. Beräkna volymen av virus behövs från varje bestånd bygger på IU / l titer från TZM-bl cellanalys för att infektera 5 x 10 5 GXR25 celler vid en infektions på 0,05, med hjälp av formeln:
    Volymen av virus för infektion (l) = 1 l / X IU x 0,05 x 500.000
    OBS: Vi har valt en MOI av 0,05, eftersom detta resulterar i en logaritmisk tillväxtfas för alla de virus som vi har testat. Det är viktigt att genomföra initiala experiment för att bestämma den optimala MOI fånga logaritmisk tillväxt för det virus som skall testas.
  3. Späd viruset i cRPMI till en volym av 100 | il (för att uppnå en 0,05 MOI) och lägga in i en brunn i en V-bottnade vävnadsodlingsbehandlade 96-brunnars platta. OBS: Ta med både en positive (MJ4 WT infekterade) och en negativ (mock infekterade celler) kontroll i varje uppsättning replikering experiment. Ställ in plåten så att alla andra kolumnen är tom för att begränsa korskontaminering mellan brunnarna. Den positiva kontrollen är absolut nödvändigt, eftersom det kommer att användas senare som en standard för att normalisera de replikeringsbackarna, som är ett mått på replikerhastigheten av experimentella replikat.
  4. Räkna GXR25 celler med användning av en automatiserad cellräknare. Beräkna antalet celler som behövs totalt för alla infektioner (5 x 10 5 x # infektioner). Alikvotera önskad volym in i en 50 ml koniskt rör och centrifugera för att pelletera cellerna. Beräknar alltid efter 25% fler infektioner än vad som behövs.
  5. Aspirera media noggrant och suspendera i cRPMI vid en koncentration av 5 x 10 5 celler / 100 | il.
  6. Pipette celler i en steril tråg och blanda väl. Med hjälp av en flerkanalig pipett, tillsätt 100 | il av celler till varje brunn i 96-brunnars platta innehållande den utspädda viruset. Mix noggrant.
  7. Tillsätt 2 l av 5 mg / ml (100x) lösning av polybren till varje brunn och blanda celler ordentligt.
  8. Inkubera vid 37 ° C i vävnadskultur inkubator med 5% CO2 under 3 timmar.
  9. För att tvätta infekterade celler, till centrifugen 96-brunnars V-bottnad platta pelletisera cellerna. Sedan försiktigt bort 150 l av mediet och ersätt med nya 150 l av cRPMI utan att störa cellpelleten. Upprepa 2 gånger (inklusive centrifugering) för att tillräckligt tvätta cellerna.
  10. Efter den sista centrifugeringen och tillsats av 150 | il cRPMI, resuspendera cellpelleten med en multikanalpipett och lägga hela cellen / virus-blandning (ca 200 | j, l) från varje brunn oberoende till 800 | il cRPMI i en brunn i en 24-brunnars vävnads odlingsplatta.
  11. Placera plattan i 5% CO 2 vävnadsodlingsinkubator vid 37 ° C.
  12. Varannan dag, avlägsna 100 | il av supernatanten från ytan av odlingsbrunn och överför till en 96-brunnars U-bottom plattan och lagra fryst vid -80 ° C tills att köra virus kvantifiering analys. NOTERA: Noggrann arrangemang av supernatanter i 96-brunnars plattor kommer att möjliggöra multikanalpipett överföring av odlingssupernatanterna under virion kvantifiering via en radiomärkt-omvänt transkriptas (RT)-analysen. Varje platta bör innehålla prover från en infektion standard för att normalisera interplatta variation i RT-analys avläsning.
  13. Efter att varje 100 ^ prov, dela celler 1: 2 med noggrant resuspending celler och ta bort hälften av den återstående volymen (450 l). Restore ursprungliga volym (1 ml) genom att tillsätta 550 | il färskt cRPMI till varje brunn.

7. Analys av omvänt transkriptas (RT) i cellkultursupernatanter

Protokollet anpassat från Ostrowski et al 40.

  1. Inrätta biologisk säkerhet huva i en BSL-3 anläggning för användning med radioaktivt material.
    1. Placera absorberande papper i hood och ersätta aspirator för aspirator utsetts för radioaktivt bruk. Obs: Allt radioaktivt avfall måste kasseras med enligt säkerhetsbestämmelserna.
  2. Lägg 1-2 | il av 10 mCi / ml [α- 33 P] dTTP och 4 | il av 1 M ditiotreitol (DTT) till varje 1 ml alikvot av RT huvudblandning (se tabell 10 och et al. Ostrowski 40).
  3. Blanda försiktigt varje 1,5 ml mikrocentrifugrör av RT Master Mix, DTT, och [α- 33 P] dTTP med 1,000 l pipett och överför till en steril tråg.
  4. Dispensera 25 | il av märkt RT blanda i varje brunn i 96-brunnars tunnväggiga PCR-platta. Obs: Inkludera utrymme för en positiv kontroll (MJ4 WT-infektion) och negativ kontroll (Mock infektion).
  5. Tillsätt 5 l av varje supernatant till PCR-platta innehållande RT Master Mix.
  6. Täta PCR-plattan med självhäftande folie och inkubera i 2 timmar vid 37 ° C i en termocykler. Av säkerhetsskäl, rinSE pipettspetsar med Amphyl och avyttra tips i liten behållare som innehåller Amphyl avfall, som senare kommer att avyttras i radioaktivt avfall.
  7. Efter inkubation göra små hål i folien locket med en 200 | il multikanalpipett. Obs: Om pipettspetsar röra vätska i bra, byt tips innan du flyttar till nästa kolumn eller rad.
  8. Blanda proverna 5x och överföra 5 l av varje prov till DE-81 papper. Lufttorka 10 minuter.
  9. Tvätta blöts 5x med 1x SSC (natriumklorid, natriumcitrat), och sedan 2x med 90% etanol vid 5 min per tvätt. Låt lufttorka.
    1. Placera varje blöt i en separat tvättbehållare, t.ex. en förvaringsbox smörgås, lägga tillräckligt med tvättbuffert (1x SSC eller 90% EtOH) för att täcka blot, och skaka i 5 minuter.
    2. Häll av tvättbuffert i separata behållare och upprepa. Anm: De första 3 tvättar anses radioaktivt och ska kasseras. De sista två tvättar kan regelbundet omhändertas.
  10. När torr, bilefully linda blot i Saran wrap och utsättas för en phosphoscreen i en tätt försluten kassett över natten i rumstemperatur.
  11. Analysera phosphoscreens med fosfor och kvantifiera radioaktiva avskrifter.
  12. Rita en cirkel runt varje radioaktiv signal med hjälp OptiQuant programvara. Plotta Digital Light Unit (DLU) värden för att generera replikering kurvor.
  13. För att generera replikering kapacitet poäng, DLU värdena log10-transforme och backar beräknades med dagen 2, 4 och 6 tidpunkter. Replikering backar sedan delat med lutnings av WT MJ4 i order generera replikering kapacitet betyg. Det är viktigt att normalisera utifrån de MJ4 WT värden erhållna från samma RT plattan för att minska intra-analysvariation.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

För att kunna utföra detta protokoll, vilket skapar en proviral plasmid som kan montera fullt fungerande, smitt Gag-MJ4 chimärer, måste stor försiktighet iakttas för att generera lämpliga PCR amplikoner. Fastställande av huruvida PCR har genererat lämplig storlek gag amplicon är avgörande. Produkter bör vara inom 100 baspar (bp) av ca 1.700 bp amplikon visas i Figur 1A. Den exakta längden av detta fragment kommer att variera beroende på gag-genen under studie. Därefter måste den 5 'långa terminala upprepningen (LTR) portion av MJ4 molekylära klonen amplifieras och skarvas till gag-amplikon, för att göra den lämplig för efterföljande kloning. Den MJ4 LTR amplicon bör vara 1474 bp lång. Figur 1B visar en representativ bild av gelen som korrekta bandstorlekar anges. Efter sammanfogningsöverlappnings-extension PCR 41 bör kombineras LTR- gag produkter varaca 3200 bp i längd, såsom visas i figur 1C.

När gag-genen har gjorts lämplig för kloning genom fusion till 5 'LTR från MJ4, som innehåller den nödvändiga NgoMIV-restriktionsstället, både vektorn och gag insatsen måste spjälkas med NgoMIV och BclI-restriktionsenzymer och skars ut från en agarosgel efter elektroforetisk separation. Det är absolut nödvändigt att skära lämpliga vektor och insert band. En representativ gel visas i figur 2. Vektorn partiet av MJ4 plasmiden bör vara ungefär 10.000 bp i längd, medan den LTR- gag insatsen bör förbli vid approximativt 3000 bp i längd, såsom de restriktionsställen som är belägna vid de yttersta ändarna av amplikonen. En betydande minskning av storleken indikerar ytterligare en cut-plats inom gag-genen som studeras.

Efter ligering av de två fragmenten, bakteriell transformation, ennd isolering av plasmid-DNA måste Gag-MJ4 chimärer kontrolleras för lämplig storlek genom att utföra en dubbel smälta med NgoMIV och Hpal restriktionsenzymer. Hellång Gag-MJ4 chimärer som inte har uppstått några radering händelser under bakteriell replikering bör ha en restriktionsmönster som liknar det som visas i figur 3, med två band på cirka 8.700 och 4.300 bp.

En viktig distinktion av detta protokoll jämfört med tidigare metoder, är användningen av HIV-1 subtyp C infektiös molekylär klon, MJ4, snarare än den vanligare laboratorieanpassad NL4-3 virus. Dock kunde de metoder som beskrivs i föregående avsnitt modifieras för kloning av subtyp B gag sekvenser i pNL4-3.

En optimering av den mångfald av infektion (MOI) för användning i efterföljande experiment utfördes i syfte att välja den ideala MOI som visade logaritmisk tillväxt av en majoritet av de testade virus.Figur 4 skildrar representativa replikeringskurvorna från tre olika MOIs (0,01, 0,05 och 0,25) för MJ4 (Figur 4A) samt för NL4.3 (Figur 4B). MJ4 replikerar mycket mindre effektivt i GXR25 celler än NL4-3, vilket är viktigt att ta hänsyn till, som en MOI lämplig för NL4-3 replikering sannolikt skulle vara för låg för att upptäcka effektiva MJ4 replikering. Som ses i figur 4A, en MOI av 0,05 i motsats till 0,01 eller 0,25, var det perfekta valet, eftersom logaritmisk tillväxt observerades mellan dag 2-6 efter MJ4. För den lägre MOI, 0,01, dag 6 DLU värden är knappt mätbar, och vi förväntade generering av Gag-MJ4 chimära virus som replik lägre än MJ4. Därför skulle denna MOI inte fånga tillväxten av den mer försvagade Gag-MJ4 chimärer, som också kan vara den mest biologiskt kritiska. Dessutom en MOI på 0,25 var inte perfekt, eftersom de snabba kinetik virusreplika dödade en betydande Amount av celler även efter dag 4 Detta medför att replikering kurvan att plana ut, och beräkna en lutning baserad på en kurva som detta skulle underskatta replikeringskapacitet. Utifrån kurvor genereras för NL4-3, även vid en MOI på 0,01, har tillgängliga cell mål blivit märkbart utmattad efter dag 6 efter infektion. Sammanfattningsvis gjordes en MOI av 0,05 befunnits vara optimala för en stor panel av Gag-MJ4 chimära virus, som alla hade skilda Gag sekvenser och varierande grad av replikation.

Sammanlagt 149 Gag-MJ4 chimära virus som härstammar från akut subtyp C Gag sekvenser har testats för in vitro-replikation med denna analys. De normaliserade RC-värden varierade från 0,01 till över 3,5 med vissa virus replikera mer än 100 gånger mer effektivt än vildtypen MJ4. Figur 5 visar replikeringskurvorna från nio representativa Gag-MJ4 chimära virus, med vildtyp MJ4 avbildas i rött, och visar det stora utbudet av replikering capacities observerats. Således kan sekvensen mångfald inom gag-genen ensam drastiskt påverka förmågan hos viruset att replikera in vitro. Även om detta är representativt för Gag-MJ4 chimära virus som härstammar från akut infekterade Zambians, andra subtyp C-sekvenser har inte testats i tillräcklig utsträckning, och kan uppvisa olika replikering kinetik. Därför måste stor försiktighet iakttas för att optimera MOI för att passa den specifika replikation av virus i en viss undersökning, eftersom det kan finnas ett stort utbud av nivåerna av replikering mellan olika HIV-1-stamnät och Gag isolat.

En av fördelarna med att använda en T-cellinje, såsom den GXR25 cellinje, som stöder replikation av MJ4 är nivån av reproducerbarhet observer relativt replikerings experiment med användning av stimulerade perifera mononukleära blodceller som mål. I inledande optimeringsexperiment, MJ4 vildtyp uppvisade en intra-assay variation på 8,7%, och different kloner av samma Gag-MJ4 chimärt virus uppvisade variabilitet i replikation av 8,5%. Eftersom olika huvudmixar och phosphoscreen exponering kan ge DLU värden som skiljer sig något i storlek, kan intra-assay variationen ytterligare kontrolleras genom att köra samma virus standard (i vårt fall vildtyp MJ4) i varje RT assayplatta. Figur 6 plottar DLU värden som erhållits från samma MJ4 infektion, kvantifieras i åtta olika RT-plattor. Normalisering till ett virus som är gemensam för alla RT-analyser kan bidra till att mildra eventuella fel induceras av dessa små förändringar i signal magnitud mellan analyser.

Inter-assay löst testades också och replikat upprepas på olika dagar var starkt korrelerade. Figur 7 tomter de normaliserade RC poängen från två oberoende experiment utförda ungefär ett års mellanrum. En hög grad av korrelation med avsaknaden av stora extremvärden (R2 = 0,873) observerades between de två oberoende replikat.

Även starkt korrelerade, det finns en viss variation i magnitud av replikering kinetik mellan de två oberoende experiment. Detta kan delvis tillskrivas skillnaden i passagenummer mellan GXR25 celler lager som används i varje experiment. I allmänhet GXR25 celler lager som har passe under en tidsperiod som är längre än sex månader tenderar att stödja mer effektiv replikering av Gag-MJ4 chimärer. Därför är det lämpligt att bedöma replikering kapacitet bland grupper av chimärer inom en månad tidsram. När de tidigare stegen följs noga, är denna analys kan producera mycket robusta och reproducerbara resultat, som gäller för ett stort antal studier.

Figur 1
Figur 1 Representant gel images skildrar elektroforetisk separation av PCR-produkter. För samtliga PCR-produkter, var 5 | il av varje 50 pl reaktion blandas med 3 ul av 5x laddningsfärg, laddas i en 1% agaros-TAE-gel kompletterat med 1X SYBR-safe DNA gel stain, och separerades genom elektrofores vid 120 V under 45 min. Den Promega 1 kb DNA-stege (bana 1) användes för att approximera amplikon storlekar. A) gag-genen som amplifierats från viralt RNA genom att använda en nästlad PCR-strategi. På grund av insättningar och deletioner kan gag amplikonet variera från 1600-1700 bp i längd och visas något över 1500 bp DNA-stege markör. Lanes 2-5 skildra framgångsrik gag genamplifiering. B) 5 'LTR av MJ4 amplifierades från vildtyp MJ4 plasmid och visualiseras via elektroforetisk separation. Banorna 2-5 skildrar framgångsrik förstärkning av 1474 bp LTR produkt som verkar något under 1500 bp DNA-stege markör. C) I 5R17; LTR härstammar från vildtypen MJ4 och gag-genen amplifieras från patientplasma smälts samman via skarv-överlappning-extension PCR och visualiseras via elektroforetisk separation. Banorna 2-5 skildrar framgångsrikt smälta amplikoner som är ca 3.200 bp i storlek, och som förekommer något över 3.000 bp DNA stege markör.

Figur 2
Figur 2. representanten gel avbildar elektroforetisk separation av restriktionsuppslutningar för kloning patientens gag-gener in MJ4. Vildtyp MJ4 plasmid och LTR- gag fusionsprodukter spjälkades med BclI för 1,5 h vid 50 ° C och NgoMIV för 1 h vid 37 ° C. Vector och insert fragment visualiserades genom elektroforetisk separation på en 1% agaros-TAE-gel kompletterat med 1X SYBR-safe DNA gel fläck vid 100 V under 2 h och med användning av ett blått ljus illuminator för att minska UV-framkallad DNA-skada. Vektor och insättningsfragment lämpliga för efterföljande kloningssteg visas på cirka 10.000 bp och 2900 bp respektive.

Figur 3
Figur 3 Representativa gel avbildar elektroforetisk separation av restriktionsdigereringar av renat Gag-MJ4 chimär plasmid-DNA. Renat Gag-MJ4 chimär plasmid-DNA dubbeldigererades med NgoMIV och Hpal restriktionsenzymerna för 2 timmar vid 37 ° C. Restriktionsuppslutningar visualiserades genom elektroforetisk separation på en 1% agaros-TAE-gel kompletterat med 1X SYBR säker DNA gel fläcken vid 120 V under 45 minuter. Plasmider utan stora deletioner kommer att lösa till två distinkta band vid ca 8700 och 4300 bp.


Figur 4 replikering av MJ4 och NL4-3 isolat av HIV-1 i GXR25 cellinje vid olika multipliciteter infektions (MOI). 5 x 10 5 GXR25 celler infekterades som beskrivs i metoden protokoll med 5-faldigt ökad MOI av varje virus lager. Supematanter samlades in på dag 2, 4, 6, och 8 efter infektion och virion produktion kvantifierades via en radiomärkt-omvänt transkriptas-analys. Infektioner kördes i tre exemplar och felstaplar betecknar standardavvikelsen för de tre replikat. (A) MJ4 (B) NL4-3.

Figur 5
Figur 5 Representativa intervall för replikation för olika Gag-MJ4 chimärer. 5 GXR25 celler infekterade med vildtyp MJ4 eller Gag-MJ4 chimärer vid en MOI av 0,05, var supernatanterna uppsamlades vid två dagars intervall efter infektion, och virion produktion kvantifieras av en radiomärkt RT-analys. Insättning av olika subtyp C härlett gag-gener kan ha en dramatisk effekt på replikeringskapacitet MJ4. Vildtyp MJ4 replika betecknas i rött.

Figur 6
Figur 6 Jämförelse av intra-analysvariation i den radiomärkta omvänt transkriptas (RT) kvantifiering analysen. Diagrammet visar inneboende intra-analysvariation genom att plotta DLU värden av samma supernatanter från en enda vildtyp MJ4 infektion i åtta olika RT-analys plattor. Variationen i kurvorna återspeglar de små förändringar i signal magnitud satsninglan plattor, som kan korrigeras för genom att köra en standard på varje RT platta, som därefter kan användas för att normalisera sluttningarna av Gag-MJ4 chimärer analyseras på samma platta.

Figur 7
Figur 7 Reproducerbarhet av replikationsanalys över tiden i GXR25 cellinjen. Samma Gag-MJ4 chimära virus användes för att infektera GXR25 celler i två oberoende experiment utfördes ungefär ett års mellanrum. Replikerings betygsättning alstrades genom att beräkna lutningen av log-transforme DLU värden och normalisering som sluttar till vildtyp MJ4. Gag-MJ4 chimärer som kopierar mer effektivt än vildtypen MJ4 har replikerings poäng större än 1, och de som replikerar sämre än vildtyp MJ4 har replikerings poäng mindre än 1 De två oberoende mätningar är starkt korrelerade (R 2 = 0,87, linjär regression) och markera reproducerbarheten hos analyser utförda vid olika tidpunkter och med celler vid olika passager.

A)

Reagens Volym för 1x reaktion (pl)
2x reaktionsblandning (Invitrogen) 25
Nukleasfritt H2O 17
Forward primer GOF (20 ^ M koncentration) 1
Omvänd primer Vifor (20 ^ M koncentration) 1
Upphöjd III ett steg Enzyme Mix 1
RNA-mall 5
Total volym 50

B)

Antal cykler Tid (tim: min: sek) Temperatur (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 sek / cykel 68
1 00:00 68
1 4
END

Tabell 1 A) Master mix och B) gag förstärkning. * Obs: GOF primer sekvens: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor primer sekvens: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A)

Reagens Volym för 1x reaktion (pl)
Nukleasfritt H2O 35,5
5x Phusion HF Buffert 10
dNTP (40 mM deoxinukleotider) 1
Framåt primem GagInnerF1 (20 pM koncentration) 1
Omvänd primer BclIDegRev2 (20 ^ M koncentration) 1
Phusion Hot Start II-polymeras 0,5
Första omgången PCR som mall 1
Total volym 50

B)

Antal cykler Tid (tim: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
END

Tabell 2 A) Master mix och B) termovillkor för kapslade andrahands gag förstärkning. * NAnm: GagInnerF1 primer sekvens: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 primer sekvens: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A)

Reagens Volym för 1x reaktion (pl)
Nukleasfritt H2O 35,5
5x Phusion HF Buffert 10
dNTP (40 mM deoxinukleotider) 1
Framåt primem MJ4For1b (20 pM koncentration) 1
Omvänd primer MJ4Rev (20 ^ M koncentration) 1
Phusion Hot Start II-polymeras 0,5
MJ4 plasmiden som mall (10 ng / ul) 1
Total volym 50

B)

Antal cykler Tid (tim: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
END

Tabell 3 A) Master mix och B) termovillkor för 5 'MJ4 LTR förstärkning. * Obs: MJ4For1b primer sekvens: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev primersekvens: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A)

Reagens Volym för 1x reaktion (pl)
Nukleasfritt H2O 34,5
5x Phusion HF Buffert 10
dNTP (40 mM deoxinukleotider) 1
Framåt primem MJ4For1b (20 pM koncentration) 1
Omvänd primer BclIRev (20 ^ M koncentration) 1
MJ4 LTR 1,3 kb amplikon (gelrenades, ~ 50 ng) 1
Phusion Hot Start II-polymeras 0,5
Gag amplikon (gelrenades, ~ 100 ng) 1
Total volym 50

B)

Antal cykler Tid (tim: min: sek) Temperatur (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
END

Tabell 4 A) Master mix och B) termovillkor för skarv-överlappning-extension PCR för att generera LTR- gag inlägg. * Obs: BclIRev primer sekvens: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A)

Reagens Volym för 1x reaktion (pl) Inkubationstid (h) Inkubation Temperatur (° C)
1,5 | ag av 3 kb LTR- gag amplikon eller MJ4 plasmiden x ^ il för 1,5 ^ g
NEB CutSmart Buffer (tidigare NEB buffert # 4) 2
BclI-restriktionsenzym 1
Nukleasfritt H2O x
Total volym 19 1,5 50
NgoMIV-restriktionsenzym 1
Total volym 20 1 37

B)

Reagens Volym för 1x reaktion (pl) Inkubationstid (h) Inkubation Temperatur (° C)
50 ng skuren MJ4 plasmidvektor x ^ il för 50 ng
45 ng skuren LTR- gag insatsen (3: 1-förhållande) x l för 45 ng
Roche 10x ligasbuffert 2
Roche T4 DNA-ligas (5 U / ^ il) 1
Nukleasfritt H2O
Total volym 20 18 + (över natten) 4

C)

Reagens Volym för 1x reaktion (pl) Inkubationstid (h) Inkubation Temperatur (° C)
450 ng av Gag-MJ4 plasmiden x l för 450 ng
NEB CutSmart Buffer (tidigare NEB buffert # 4) 2
NgoMIV-restriktionsenzym 0,5
Hpal-restriktionsenzym 0,5
Nukleasfritt H2O x
Total volym 20 2 37

Tabell 5 A) Begränsning smälta Master Mix och B) ligeringsreaktion för generering av Gag-MJ4 chimär provirus. C) Diagnostisk restriktionsspjälkning att säkerställa Gag-MJ4 kloning trohet.

Primer Namn Nukleotidsekvens (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
Rev3 GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Tabell 6 Förteckning över sekvenseringsprimrar krävs för att bekräfta 5'LTR och gag sekvensidentitet av Gag-MJ4 chimär provirus.

Well A 8 pl virus + 232 pl 1% FBS i DMEM
Well B 80 ul från Well A + 160 pl 1% FBS i DMEM
Väl C 80 ul från Well B + 160 pl 1% FBS i DMEM
Väl D 80 ul från Well C + 160 pl 1% FBS i DMEM
Well E 80 ul från Well D + 160 pl 1% FBS i DMEM
Väl F 80 ul från Well E + 160 pl 1% FBS i DMEM

Tabell 7. Utspädning ordning (3-faldig) för titrering infektiösa virus på TZM-bl celler.

A)

Reagens Volym
PBS utan Ca 2 + eller Mg 2 + 500 ml
Gluteraldehyd 4 ml
Formaldehyd 11 ml

* Obs: Förvara vid 4 ° C.

B)

Reagens Volym
PBS utan Ca 2 + eller Mg 2 + 4,75 ml
Kaliumferricyanid (0,2 M) 100 | il
Kaliumferrocyanid (0,2 M) 100 | il
Magnesiumklorid (1 M) 20 | il
X-gal (50 mg / ml) 40 | il

* OBS: Gör fräsch och Förvara mörkt fram till användning.


C.

Original Utspädning väl Ett B C D Ö F
Volymen av virus (l) till brunnarna i en 24-brunnar rad 5 1,6667 0,5556 0,1852 0,06173 0,02057

Tabell 8 A) B) fästlösningar för titrering av Gag-MJ4 chimära virus på TZM-bl indikator cellinje. C) Volymen virus per brunn för beräkning av smitt enheter / ul.

Reagens Volym
Fetalt bovint serum (FBS), definierad 55 ml
Penicillin, streptomycin, glutamin (100x) 6 ml
HEPES-buffert (1 M) 6 ml

Tabell 9 Recept för komplett RPMI-medium för förökning av GXR25 celler.

Reagens Volym (ml)
Nuclease-fri H2O 419,5
Tris-Cl, pH 7,8 (1 M) 30
Kaliumklorid (1 M) 37,5
Magnesiumklorid (1 M) 2,5
Nonidet P-40 (10%) 5
EDTA (0,5 M) 1,02
Polyadenylsyra, kaliumsalt (2 mg / ml) 1,25
Oligo-dT-primer (25 | ig / ml) 3,25
Total volym 500

Tabell 10 Recept för radiomärkt omvänt transkriptas-analys Master Mix. * Obs: Affär som 1 ml alikvoter vid -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

På grund av längden och tekniska karaktär detta protokoll, finns det flera steg som är kritiska för både den framgångsrika konstruktionen av chimära Gag-MJ4 plasmider samt för kvantifiering av virusreplikakapacitet. Även restriktionsenzymet baserade kloningsstrategi för införandet av främmande gag gener i MJ4 beskrivs i detta protokoll har många fördelar jämfört med tidigare använda rekombination baserade metoder, kan protokollet vara tekniskt utmanande om kritiska steg inte följs exakt.

För det första är det absolut nödvändigt att använda MJ4 plasmid-DNA som har genererats i en kompetent bakteriestam som saknar DCM och damm DNA metylaser. Detta är nödvändigt eftersom den enzymatiska aktiviteten för BclI-restriktionsendonukleas, som används för att klona gag-gener in i MJ4 ryggraden, är mor / DCM metylering känsliga. Den JM110 och SCS110 (en endA negativ JM110 derivatet) E. coli-stammar enre lämplig för att generera ometylerat MJ4 plasmid-DNA. Dessutom, för att excision av vektor-och insatsband, är det starkt rekommenderat att ett blått ljus belysning användas för visualisering. Detta kommer att minska UV-våglängdsberoende DNA-skador och drastiskt öka kloningseffektiviteten. Om ett blått ljus belysnings inte är tillgänglig, kan kloningseffektiviteten maximeras genom att visualisera DNA med SYBR Säker DNA gel fläcken istället för etidiumbromid och minimera UV exponeringstid.

Slutligen har molekylär kloning med stora (> 10 kb) och / eller retrovirala plasmider såsom MJ4 traditionellt varit svårt för en mängd olika skäl. Större plasmider minska omvandlingseffektiviteten av kompetenta bakteriestammar 42 medan retrovirala skär, som innehåller långa terminala upprepningen (LTR)-sekvenser, minska stabiliteten av plasmiden och kompromisser replikering trohet av plasmid-DNA i den bakteriella värden leder till deletioner av det retrovirala genomet 43 E. coli-stam över DH5a-stammen, i våra händer. På grund av instabil karaktär plasmiden bör renade plasmiden produkter alltid kontrolleras för korrekt plasmid storlek genom restriktionsenzymdigestion; här, en dubbel smälta med NgoMIV och Hpal restriktionsendonukleaser vid 37 ° C under 2 tim.

En gång framgångsrik generation chimära Gag-MJ4 plasmider har gjorts, är virus som genereras via transfektion av 293T-celler, titrerades på en indikator-cellinje, TZM-BL-celler och replikaKapacitet mäts med användning av en CEM-baserade T-cellinje. CEM-baserade GXR25 cellinje som användes för dessa replikeringsstudier är ett av de få etablerade T-cellinjer som kan stödja inträde och replikation av CCR5-tropism stammar av HIV-1. Detta har uppnåtts genom retroviral transduktion för att tillåta stabilt uttryck av human CCR5 37. Denna cellinje uttrycker naturligt CXCR4 och kommer att stödja replikation av CXCR4-tropism HIV-1, såsom den laboratorieanpassade stammen NL4-3. Men i syfte att stödja effektiv replikering av CCR5-tropism-stammar, såsom MJ4 måste GXR25 celler förökas under inte mindre än fyra månader före infektion. Korrekt passe kulturer kan stödja replikering även efter ympa i upp till 1 år. Noggrann övervakning av CCR5-tropism replikering hela aging är avgörande för lyckade experiment.

Som med någon teknik, det finns begränsningar till protokol som måste beaktas. På grund av placeringen av restriktionsställen i MJ4 plasmiden liksom tillgängligheten av konserverade restriktionsställen i naturligt förekommande HIV-1-isolat, är 3 'distala restriktionsställe, BcII, belägen 137 nukleotider från gag-stoppkodonet. Även om detta genererar en chimär proteasgen är denna region 96,5% konserverade i denna kohort, och vi inte observera ett överflöd av döda eller defekta chimära virus.

En av fördelarna med att använda den MJ4 subtyp C infektiös molekylär klon med subtyp C härledda sekvenser är att det minskar risken för suboptimal genen parning mellan gag-gener och vektorer för olika subtyper stamnät. Men ett visst mått av inom-klad mångfald existerar som framgår av klustring av HIV-1-sekvenser länder och regioner även när fann inom samma subtyp 31. Detta skulle kunna bidra till suboptimal parning mellan de gag-gener derived från akut infekterade Zambians och MJ4 infektiösa molekylära klon ryggrad, som härrör från en kroniskt infekterad individ från Botswana 38. Men en majoritet av de analyserade konstruktioner producerade infektiöst avkomma virus. Eftersom olika HIV-1 subtyp C infektiösa molekylära kloner blir mer tillgänglig, kommer det att vara viktigt att ytterligare validera detta system genom kloning i dessa HIV-1 clade C gag gener i andra stamnät för att se till att det finns en minimal förspänning infördes på grund till oförenlig ryggraden.

Den GXR25 cellinje är en unik cellinje, speciellt på grund av dess förmåga att stödja både CXCR4 och CCR5-tropism stammar och HIV-1 inducerbart GFP reporter 37. Det finns dock vissa begränsningar och bör övervägas noga innan du använder denna cellinje för experiment anpassas från detta protokoll. Den GXR25 cellinje verkar inte stödja införandet av en majoritet av subtyp C eller A, CCR5-tropism, primary isolerar vi har testat. Dessutom föräldern CEM cellinje från vilken GXR25 cellinje härleddes utställningar hög cyklofilin A, upp till 2-4 gånger högre uttryck än Jurkat cellinje 44. På grund av höga halter av cyklofilin A, replikering defekt som normalt förknippas med den kanoniska HLA-B * 57 associerat fly mutation, T242N, vilket tillskrivs en minskad förmåga kapsid att binda cyklofilin A, inte enkelt kan upptäckas i denna cellinje 25. CEM-baserade GXR25 cellinjen är således inte perfekt för att studera replika defekter associerade med mutationer i HIV-1 kapsid cyklofilin-bindande slinga.

Slutligen, medan detta protokoll är idealisk för analys av den replika kapacitet av gag-sekvenser härledda från akuta tidpunkter, modifieringar måste göras i syfte att studera replika kapacitet av gag-gener härledda från kroniskt infekterade individer. Detta protokoll involverar amplification befolknings sekvenser från akuta tidpunkter (median 45 dagar efter beräknat datum för infektion) vid viral mångfalden är begränsad. Gag-genen från varje chimär därefter sekvenseras och jämföras med den initiala populationen PCR amplicon att säkerställa kloning trohet. Med tanke på det begränsade sekvensdiversitet vid akuta tidpunkter, kloning från befolknings PCR-produkter är möjlig. Det finns dock sekvens mångfald inom de virala kvasispecies av en kroniskt infekterad individ; Därför, för att exakt bedöma replikeringskapacitet av de kroniska kvasispecies, singel genomet förstärkning måste användas för att fånga flera representativa varianter. Var och en av dessa varianter måste därefter analyseras för in vitro-replikation.

Denna teknik har flera bredare program, som följer av dess fördelar jämfört med befintliga metoder. Eftersom denna process resulterar i en klonreplikationskompetent plasmid, är det enkelt att använda konstruktioner för ytterligare mutagenesis studier, som kan hjälpa till att belysa bidragen från specifika rester till virusreplikation. Vidare genom kloning i gag-gener från longitudinella tidpunkter kan man bedöma utvecklingen av virusreplikakapaciteten över tiden och hur dessa förändringar kan påverka patogenesen i en HIV-1 infekterad individ.

Denna teknik kan modifieras för att öka dess användbarhet för olika tillämpningar. Ytterligare HIV-1 virusproteiner kan byggas in i MJ4 plasmiden i syfte att bedöma deras effekter på virusreplikation eller deras interaktioner med värdproteiner. Detta kan åstadkommas genom att konstruera ytterligare restriktionsställen vid önskade områden i genomet genom att införa tysta nukleotidförändringar. Dock måste särskild hänsyn tas vid ingenjörs nya restriktionsställen i den 3 'hälften av HIV-1-genomet så många tillbehör proteiner kodas i alternerande läsramar och tysta förändringar i enprotein kan leda till aminosyrasubstitutioner i en annan. I detta exempel, restriktionsstället oberoende kloningsmetoder såsom de som diskuteras av Dudley et al. 45 kan övervinna denna begränsning. Virala sekvenser härledda från olika populationer kan ha variationer i replikationskapacitet, och ifrågavarande MOI kan justeras i enlighet därmed för att fånga de flesta virala isolat inom deras logaritmisk tillväxtfas. Slutligen har GXR25 cellinjen blivit stabilt transfekterade med GFP under en LTR-driven, Tat-inducerbar promotor, och viral spridning kan mätas som en funktion av GFP-positiva celler via flödescytometri 37 som ett alternativ till den RT-analys som beskrivs här eller en traditionell p24 ELISA.

Sammanfattningsvis ger detta protokoll en effektiv och kraftfull teknik för bedömning av HIV-1 virusreplikation som följer av gag-genen, som kodar för en konserverad strukturprotein som behövs för korrekt virionbildning, Spirande, mognad och demontering 46-48. Vidare alstrar denna teknik en replikationskompetent klonal plasmiden, vilket är idealiskt för mutagenesstudier och sålunda tillhandahåller en metod för att klargöra de specifika aminosyra determinanter av viral fitness. Studier som dessa är absolut nödvändigt för att öka förståelsen för hur immundriven viral evolution påverkar patogenes och sjukdomsprogression hos HIV-1-infekterade individer.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Ett restriktionsenzym Based Kloning metod för att bedöma<em&gt; In vitro</em&gt; Replikering Kapacitet på HIV-1 subtyp C Gag-MJ4 Chimära virus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter