HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Fastställande både värd och virus särdrag som påverkar HIV-1 patogenes och sjukdomsprogression är av största vikt för rationell vaccindesign. Det cellulära immunsvar är en viktig del av människans immunsvar mot hiv-1-infektion. Cytotoxiska T-lymfocyter (CTL) är nödvändiga för den inledande kontrollen av akut viremi och låt värd att upprätta ett stabilt tillstånd (börvärde) virusmängd 1,2. Experimentell utarmning av dessa effektorceller resulterar i förlust av viruskontroll 3,4. Trots detta fly mutationer uppstår inom virusgenomet som gräva CTL erkännande av virusinfekterade celler 5-9.
Vissa HLA-alleler har förknippats med lägre virusnivåer och långsammare sjukdomsprogression med B * 57, B * 27 och B * 81 10-15. En del av den skyddande fördelen av HLA klass I-alleler kan tillskrivas det faktum att de är inriktade funktionellt begränsade regioner av genomet, såsom Gagoch selektera för escape-mutationer som minskar förmågan hos viruset att replikera in vitro 16-21. Även flykt från det cellulära immunsystemet är fördelaktigt för viruset i samband med väljar HLA klass I allel, kan effekten av dessa mutationer har differential konsekvenser för värden vid överföring till en HLA-inkompatibla individ 22,23. Därför kommer förstå effekterna av överförda HLA-associerade utrymnings mutationer på virusreplikakapaciteten vara viktigt att öka våra kunskaper om tidiga HIV-1 patogenes.
Även om stora framsteg har gjorts för att identifiera och karakterisera fitness defekter enskilda flykt mutationer associerade med specifika HLA klass I alleler 24-29, naturligt förekommande HIV-1-isolat har unika och komplexa spår av HLA-associerade polymorfism, troligen härrör från HLA medierad immun tryck av olika immunogenetiska bakgrunder 30. I aprevious analys Goepfert et al. visade att en ansamling av HLA-associerade mutationer i de överförda Gag sekvenser härledda från 88 akut infekterade Zambians associerades med en minskning av börvärde virusmängd 31. Detta tyder på att överföring av skadliga utrymnings mutationer, särskilt i Gag, till HLA-inkompatibla mottagare ger en klinisk nytta, och kan bero på försvagade virusreplikation. Framåt är det absolut nödvändigt att studera hur komplicerade kombinationer av Gag polymorfism inom naturligt förekommande isolat arbetar tillsammans för att definiera egenskaperna hos den överförda virus såsom replikakapacitet, och hur tidigt replikering kan i sin tur påverka HIV-1 kliniska parametrar och sent skede patogenes.
Brockman et al. Visade först en länk mellan replikeringskapacitet gag-pro sekvenser isolerade under kronisk skede infektion och virus i både subtyp C och B-infektioner32-35. Den experimentella metod som presenteras i dessa studier, även lämplig för prövningen av replikeringskapacitet sekvenser härledda från kroniskt infekterade individer in vitro, har flera tekniska förbehåll och begränsningar som gör studerar HIV-1 replikationsförmåga in subtyp C akut infekterade individer svårt. Denna metod förlitar sig på rekombination av befolkningen baserade PCR-amplifierade sekvenserna in i subtyp B NL4-3 provirus, som blev framtagen ur delar från LAV, ett laboratorium anpassat virus lager 36. Virus generationen åstadkoms genom samtransfektion av en CEM-baserade T-cellinje 37 med PCR-amplikoner och digere delta- gag-pro NL4-3 DNA. Denna metod kräver utväxt av viruset under en period av veckor till månader, potentiellt skev arten av det utvunna viruset lager i förhållande till de virala kvasispecies in vivo och därför förändra mätningen av replikeringsförmåga in vitro. Denna metod Iär mer lämpligt för att studera kroniskt infekterade individer, där den väljer effektivt för virus med högsta replikationsförmåga, och där kloning många olika virusvarianter från ett stort antal kroniskt infekterade individer är ganska arbetskrävande och därför inte genomförbart. Men inom en akut infekterad individ, finns det i allmänhet 1-2 varianter närvarande, och därmed eliminerar risken för snedställning typen av återvunna viruset lager, genom in vitro selektionstryck, möjliggör en mer exakt bedömning av in vitro-replikationsförmåga. För det andra kräver den här metoden rekombination subtyp C gag-pro-sekvenser i en subtyp B härledd ryggraden, och skulle kunna införa ryggrad inkompatibilitet fördomar i analysen. På grund av dessa begränsningar, måste ett stort antal sekvenser analyseras för att övervinna eventuella fördomar införs.
Här beskriver vi en alternativ experimentell lämpach lämplig för att studera sekvenser härledda från subtyp C akut infekterade individer. Vi använder ett restriktionsenzym baserad kloningsstrategi för att införa gag-genen från akuta punkter HIV-1 subtyp C infekterade individer infektions time in subtyp C proviral ryggrad, MJ4. Användningen av MJ4 som en gemensam ryggrad på sig att klona gag-gener är avgörande för analysen av subtyp C härledda sekvenser. MJ4 kommer från ett primärt isolat 38, och därmed skulle vara mindre benägna att införa fördomar på grund av subtyp inkompatibilitet mellan ryggraden och gag-genen. Dessutom tillåter den strategi för att använda enzym baserad begränsning kloning för provirala konstruktioner som ska transfekteras direkt i 293T-celler, samt för indrivning av en klonal virus lager identisk med den klonade gag-sekvensen.
Metoden presenteras nedan är en hög genomströmning metod för bedömning replikeringskapacitet subtyp C härlett Gag-MJ4chimära virus. Transfektion in i 293T-celler är enkel och återvinning av virus tar bara tre dagar. In vitro replikering kapacitet analyseras på samma CEM-CCR5 baserade T-cellinje som skapats av Brockman et al. 37, men med hjälp av viktiga protokoll modifieringar som behövs för att framgångsrikt replikering av subtyp C MJ4 chimära virus. Användningen av en lämplig T-cellinje stället PBMC möjliggör ett stort antal subtyp C MJ4-chimär virus som skall testas med hög analys reproducerbarhet. Slutligen, med hjälp av en radiomärkt omvänt transkriptas assay för kvantifiering av virus i supernatanten är mer kostnadseffektivt än att använda kommersiellt tillgängliga p24 ELISA-kit. Det ger också en högre dynamiskt omfång, vilket var viktigt för att upptäcka både dåligt och mycket replikerande virus inom samma analys och för att upptäcka subtila skillnader i replikering mellan isolat.
Sammanfattningsvis har metoden presenteras här tillåtet förden fördjupade studie av replikeringskapacitet gag sekvenser härledda från HIV-1 subtyp C akut infekterade individer från Zambia, och som skrivet, skulle också kunna utvidgas till att studera andra subtyp C smittade befolkningar. En hög grad av variation i replikeringskapacitet mellan olika Gag isolat observerades. Dessutom kunde vi visa ett statistiskt samband mellan replikeringskapacitet på den utsända Gag och börvärde virusmängd och med CD4 + nedgång under en treårsperiod 39. Sådana resultat betona vikten av att studera hur överförd virus egenskaper, såsom replikering kapacitet, interagera med värdens immunsystem för att påverka patogenesen vid tidig infektion och kommer att vara integrerade för att utveckla effektiva vaccin interventioner samt behandling.
På grund av längden och tekniska karaktär detta protokoll, finns det flera steg som är kritiska för både den framgångsrika konstruktionen av chimära Gag-MJ4 plasmider samt för kvantifiering av virusreplikakapacitet. Även restriktionsenzymet baserade kloningsstrategi för införandet av främmande gag gener i MJ4 beskrivs i detta protokoll har många fördelar jämfört med tidigare använda rekombination baserade metoder, kan protokollet vara tekniskt utmanande om kritiska steg inte följs exakt.
…The authors have nothing to disclose.
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |