Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Biochemische assays voor het analyseren van activiteiten van de ATP-afhankelijke chromatine remodeling Enzymen

doi: 10.3791/51721 Published: October 25, 2014

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

SNF2 familie chromatine remodeling complexen zijn voorzien van een centrale SNF2-achtige ATPase subunit 1,2. Sommige SNF2-achtige ATPases functie enkelvoudige subeenheid enzymen, terwijl anderen werken als katalytische subeenheid grotere multi-subunit complexen. Ophelderen van de moleculaire mechanismen die voor elk van de subeenheden van chromatine remodeling complexen bijdragen aan hun activiteiten vereist het vermogen om biochemische testen die de verbouwing proces ontleden voeren.

ATP-afhankelijke nucleosoom remodeling door de menselijke INO80 complex en andere chromatine hermodellering enzymen kunnen worden voorgesteld als een meerstaps proces dat begint met binding van het enzym remodeling nucleosomen, gevolgd door activering van de DNA en / of nucleosoom-afhankelijke ATPase, translocatie van de verbouwing enzym op nucleosomale DNA, en de eventuele herpositionering van nucleosomen 1,2. Inzicht in de moleculaire details van de ATP-afhankelijke chromatine remodeling proces requires dissectie van de verbouwing reactie in zijn individuele stappen en definitie van de bijdragen van de individuele colli van het chromatine remodeling complex om elke stap van de reactie. Dergelijke analyses vereisen het vermogen om nucleosoom remodeling en andere activiteiten geanalyseerd middels gedefinieerde moleculaire substraten in vitro.

In een eerdere JOVE protocol, beschreven we procedures gebruikt om INO80 chromatine remodeling complexen en subes met gedefinieerde subunit composities 3 te genereren. Hier presenteren we drie biochemische assays die kwantitatieve analyse van de nucleosoom binden, DNA en nucleosoom-geactiveerde ATPase en nucleosoom remodeling activiteiten die bij dergelijke complexen mogelijk.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1 ATP-afhankelijke Nucleosome Remodeling Testen

Meten ATP-afhankelijke nucleosoom remodeling activiteiten, immuungezuiverd INO80 of INO80 subcomplexen geïncubeerd met ATP en mononucleosomal substraat, waarbij een enkele nucleosoom geplaatst aan een uiteinde van een 216-bp 32P-gemerkte DNA-fragment bevat. De reactieproducten worden vervolgens onderworpen aan elektroforese in natieve poly-acrylamide gels.

  1. De 32-P gemerkt, '601' DNA fragment genereren amplificeren van pGEM-3Z-4 601 a 216 bp DNA fragment dat een einde 601 gelegen nucleosoom positionering volgorde met de oligonucleotiden 5'-ACAGGATGTATATATCTGACACGTGCCTGG en 5'-als AATACTCAAGCTTGGATGCCTGCAG forward en reverse primers.
    1. Stel een 100 ui PCR-reactie zoals beschreven in Tabel 1.
    2. Voer de PCR-reacties in een thermische cycler met het volgende programma: 1 min bij 96 ° C, followed door 45 sec bij 94 ° C, 30 seconden bij 57 ° C, 60 seconden bij 72 ° C gedurende 30 cycli; eindigend met 7 min bij 72 ° C.
    3. Nadat de PCR reactie is voltooid, verwijdert de niet opgenomen nucleotiden door het passeren van de reactieproducten tweemaal door nuclease-vrij spinkolommen.
    4. Run 5 ui van het gezuiverde PCR product in een 1,2% agarose gel om te bevestigen dat het PCR reactie gegenereerde het gewenste ~ 216 bp DNA fragment.
    5. Verdun 5 ui van het gezuiverde PCR product 20-voudig, en meet de DNA-concentratie met een UV spectrofotometer. De gemiddelde opbrengst is ~ 40 ng / ul.
    6. Meet de radioactiviteit van 1 pl van het gezuiverde PCR product in een scintillatieteller. Schat de labelingsefficiëntie door het berekenen van de cpm / ng. Een succesvolle labeling reactie wordt verwacht ~ 15.000 cpm / ng 601 DNA fragment verkregen.
  2. Transfer Hela cel nucleosomen op het label 601 DNA met behulp van een seriële verdunning methode 5.
    1. Meng 2 pmol32p gemerkte DNA-fragment met 601 6 ug Hela nucleosomen (bereid zoals beschreven 5) in 50 ul van een buffer die 1,0 M NaCl, 10 mM Tris-HCl, pH 8,0, 1 mM EDTA, 0,1 mM PMSF, en 1 mM DTT en incubeer bij 30 ° C gedurende 30 minuten.
    2. Opeenvolgend verdun het mengsel tot 0,8 M, 0,6 M en 0,4 M NaCl door verdunning met 12,5 ul, 20,8 pl en 41,6 pl van respectievelijk 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 mM PMSF, en 1 mM DTT, met een 30 min incubatie bij 30 ° C na elke verdunning.
    3. Verdun het mengsel tot 0,2 M en 0,1 M NaCl door toevoeging van 125 ul en 250 ul van dezelfde buffer die 0,1% Nonidet P-40, 20% glycerol en 200 ug / ml BSA, met een 30 minuten incubatie bij 30 ° C tussen de laatste twee verdunningen. Bewaar de mononucleosome substraat bij 4 ° C gedurende maximaal 3 maanden.
  3. Voer ATP-afhankelijke nucleosoom glijden reacties in een totaal volume van 10 pl. De reaction bestanddelen worden vermeld in tabel 2. Aangezien de optimale NaCl concentratie INO80 nucleosoom remodeling activiteit ~ 50 mM NaCl (ongepubliceerde resultaten), passen de totale concentratie van NaCl in elke reactie tot 50 mM, met inachtneming van de hoeveelheid NaCl in bereidingen van nucleosomen en enzym.
    1. Voordat u begint met het opzetten van de assays, gegoten inheemse poly-acrylamide gels (18 x 16 cm). Om een gel dat 5% acrylamide bereiden (acrylamide: bisacrylamide 37,5: 1), 0,5 x TBE (45 mM Tris boraat, 1 mM EDTA), 0,01% ammoniumpersulfaat (APS) en 0,001% N, N, N', N'-tetramethylethyleendiamine (TEMED) en meng het in tabel 3 vermelde bestanddelen. Laat de gel polymeriseren ten minste 2 uur bij kamertemperatuur.
    2. Ondertussen, voor elke reactie uit te voeren combineren in een vooraf gekoelde silicium 1,5 ml microcentrifugebuis ~ 20 nM INO80 of INO80 subcomplex (bereid zoals beschreven 3) met een hoeveelheid EB100 buffer (
    3. Stel een meester cocktail met de rest van de ingrediënten, opschaling een factor X (waarbij X = aantal reacties +3). De hoeveelheid van elk die nodig is voor een 10 gl reactiemengsel ingrediënt wordt in tabel 5; het recept worden opgeschaald volgens het aantal reacties te voeren. Meng goed door de buis te tikken of door op en neer pipetteren met een Pipetman en draai de buis gedurende een paar seconden in een microcentrifuge benchtop.
    4. Doseer 5.25 gl van de master cocktail aan elk van de reageerbuizen tijdens stap 1.3.2. Meng goed door en neer te pipetteren. Start de reactie door overdracht reactiebuizen een 30 ° C verwarmingsblok of waterbad en incubeer gedurende 2 uur.
    5. Ondertussen bereiden 'verwijderen mix' cocktail met concurrent DNAen nucleosomen, opschaling met een factor X (X = aantal reacties + 4). De hoeveelheid van elk die nodig is om 1,5 gl verwijderen mix voor een enkele reactie bereiden ingrediënt in Tabel 6; het recept worden opgeschaald afhankelijk van het aantal tests worden uitgevoerd.
    6. Beëindig reacties door 1,5 pi van het mengsel te verwijderen. Meng goed, spin down en incubeer bij 30 ° C nog eens 30 minuten.
    7. Ondertussen voorlooptijd het natieve polyacrylamidegel in een verticale elektroforese-eenheid bij 100 V gedurende 30 minuten bij 4 ° C, met 0,5 x TBE als loopbuffer met een magnetische roerstaaf in de onderste kamer constant buffer omloop gegarandeerd.
    8. Om het monster te laden, voeg 2,5 pl ladingskleurstof met 3x TBE, 30% glycerol, 0,25% broomfenolblauw en 0,25% xyleencyanol FF. Meng goed, kort draaien de monsters, en laden op de gel met behulp van tips voor het laden.
    9. Voer de elektroforese bij 200 V gedurende 4,5 uur bij 4 ° C met buffer circulatie.
    10. Om het detecteren, breng de gel Stapels twee vellen filtreerpapier. Wikkel het filter papier met de gel op de top met behulp van duidelijke plastic omslag, en vervolgens bloot aan een opslag fosfor scherm bij 4 ° C voor de gewenste tijd.
    11. Scan het scherm met een isotoop afbeeldingsscanner systeem en het analyseren met geschikte software.

2 Mononucleosome bindingstests

De bindingsaffiniteit van een bepaalde INO80 complex voor mononucleosomes assay Voer een elektroforetische mobiliteit Shift Assay (EMSA) met de mononucleosomal substraat gegenereerd in stap 1.2.

  1. Opzetten van de reactie mixen voor bindingsbepalingen zoals beschreven voor nucleosoom remodeling assays maar laat de ATP en het verwijderen mix van de reacties; incubeer bij 30 ° C gedurende 30 minuten.
  2. Voeg 2,5 ul van laadkleurstof aan elk reactiemengsel, en gelden voor een native polyacrylamide gel met 3,5% acrylamide (acrylamide: bis 37,5: 1), 1% glycerol, 0.5x TBE, 0.01% APS en 0,001% TEMED.
  3. Met 0.5x TBE als loopbuffer, voert de gel bij 200 V gedurende 2,5 uur bij 4 ° C met buffer circulatie en blootstellen aan een opslag fosforscherm.

3 DNA en Nucleosome-afhankelijke ATPase Assays

Voer ATPase assays 5 pl reactiemengsels bevatten 20 mM Tris-HCl (pH 7,5), 60 mM NaCl, 6,6 mM MgCl2, 0,8 mM EDTA, 0,015% Nonidet P-40, 2,5% glycerol, 0,1 mg / ml BSA, 1 mM DTT, 0,1 mM PMSF, 2 mM ATP, 2 pCi [α- 32 P] ATP (3000 Ci / mmol). Per INO80 complex of hoeveelheid INO80 complex te testen opgezet drie parallelle reacties, een met EB100 buffer om DNA of nucleosoom-onafhankelijke ATPase, een meet bevattende gesloten circulair plasmide-DNA (5.000 bp, ~ 30 nM) te meten DNA afhankelijke ATPase en een met Hela oligonucleosomen (~ 185 nM) voor nucleosoom-afhankelijke ATPase meten. Stel alle reacties op het ijs.

Voor elke reactie samen 10-50 nM van de immuungezuiverd INO80 of INO80 subcomplexen met een hoeveelheid EB100 buffer voldoende om een ​​volume van 2,2 pl geven voorgekoeld gesmeerd 1,5 ml microcentrifuge buisjes. Onmiddellijk opnieuw te bevriezen elke-INO80 bevattende fracties in poedervorm droogijs of vloeibare stikstof.
  • Het opzetten van een master-cocktail. De hoeveelheid van elk die nodig is voor een enkele reactie ingrediënt wordt in tabel 7. Opwaardering het recept door grotere met een factor 3 (X +2) 1, waarin X = het aantal INO80 preparaten te testen.
  • Voor te bereiden 'sub-cocktails' met buffer alleen, DNA, of nucleosomen, afzien 2,5 (X + 2) ul van de master cocktail in drie aparte buizen. Voeg 0,3 (X + 2) pi hetzij EB100, gesloten circulair plasmide-DNA (1,5 ug / ul) of Hela oligonucleosomen (1,5 ug / ul) en meng.
  • Doseer 2,8 pi van de juiste sub-cocktail naar de enzymbevattende reactiebuizen opgericht in step 3.1. Voorzichtig pipet op en neer om te mengen; voorkomen dat er bubbels.
  • Om reacties te beginnen, de overdracht van de reageerbuisjes op een 30 ° C warmte-blok.
  • Na 5, 15, 30 en 60 min incubatie spot 0,5 pi van elk reactiemengsel op een cellulose polyethyleenimine dunnelaagchromatografie (TLC) plaat (20 x 10 cm) in een rechte lijn ten minste 1,5 cm van de onderkant . Onmiddellijk terug reageerbuisjes tot 30 ° C warmteblok dus verschillende tijdstippen kan worden genomen van een enkele buis. Na het spotten, droog de TLC-platen met behulp van een föhn.
  • Breng de TLC platen met een glazen kamer die voldoende 0,375 M kaliumfosfaat (pH 3,5) zodat de bodem van 0,5 cm van de TLC-plaat wordt ondergedompeld in de oplossing.
  • Bedek de kamer en ontwikkelen tot de voorzijde van de vloeibare fase de top van de TLC-platen bereikt. Onmiddellijke droog de platen grondig met behulp van een föhn.
  • Maak de gedroogde TLC platen een fosforscherm opslag bij kamertemperatuur.Scan het scherm met een isotoop afbeeldingsscanner systeem bepalen de hoeveelheid radioactief ATP substraat en ADP product.
  • Om de hoeveelheid ATP gehydrolyseerd Vermenigvuldig het% ATP gehydrolyseerd door de hoeveelheid ATP in het uitgangsmateriaal aanwezige reactiemengsel met de volgende formule: pmol ATP gehydrolyseerd = 10 pmol ATP in conferentie reactiemengsel x [ADP / (ADP + ATP)]
  • Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    De figuren tonen representatieve resultaten van biochemische assays gebruikt INO80 activiteiten te karakteriseren, zoals nucleosoom schuiven (figuur 1) en binding (figuur 2) assays en DNA of nucleosoom-afhankelijke ATPase tests (figuur 3).

    De in figuur 1 experiment vergelijkt het vermogen van intacte INO80 complexen gezuiverd door FLAG-Ies2 of FLAG-INO80E en INO80 subes gezuiverd door hetzij FLAG-Ino80ΔN of Ino80ΔNΔHSA verbouwingen van mononucleosomes geassembleerd op een 216 bp, radioactief gemerkte DNA fragment katalyseren. De positie van de nucleosoom op de DNA fragment beïnvloedt elektroforetische mobiliteit; lateraal gepositioneerd nucleosomen sneller lopen in de gel dan meer centraal gepositioneerd nucleosomen. Sinds INO80 chromatine remodeling complexen bij voorkeur bewegen mononucleosomes naar het midden van een stuk DNA 6,7,8, remodeling activiteit is moniden gevolgd door de opkomst van een populatie van nucleosomen die vertonen verminderde elektroforetische mobiliteit. Na afloop van de reactie, moet een overmaat Hela oligonucleosomen en zalm sperma of ander DNA worden toegevoegd aan het reactiemengsel als deelnemer aan een substraat gebonden INO80 of INO80 subes verwijderen, aangezien het enzym gebonden remodelleren elektroforetische mobiliteit van het nucleosoom verandert substraat. Complexen gezuiverd door FLAG Ino80ΔN missen de metazoan-specifieke subeenheden INO80D, INO80E, Amida, MCRS1, NFRKB en UCH37, terwijl complexen gezuiverd door Ino80ΔNΔHSA missen ook Arp4, Arp8 en YY1. Complexen gezuiverd door middel van FLAG-Ies2, FLAG-INO80E en FLAG-Ino80ΔN hebben soortgelijke activiteiten, wat aangeeft dat de metazoan-specifieke subeenheden zijn overbodig voor nucleosoom remodeling door de INO80 complex. Daarentegen complexen gezuiverd door FLAG-Ino80ΔNΔHSA inactief in deze assay, wat aangeeft dat remodeling activiteit afhangt van de HSA domein van de INO80 ATPase en / of de bijbehorende subeenheden.

    De experimenten in figuur 2 vergelijken de nucleosomen binding activiteiten van INO80 en INO80 subes behulp van elektroforetische mobiliteit verschuiving assays. Deze assays zijn eveneens uitgevoerd om de nucleosoom remodeling assays, behalve dat er geen toegevoegde oligonucleosomen en DNA aan het einde van de reactie-nucleosoom gebonden complexen te verwijderen. Bijgevolg incubatie van nucleosomen met toenemende hoeveelheden intact INO80 complexen gezuiverd via INO80E subeenheid leidt tot een dosisafhankelijke verdwijnen van de band overeenkomend met vrije mononucleosomes en van een nieuw 'verschoven' soorten die migreert bij de top van de gel (lanen 6-8). Wanneer daarentegen nucleosomen geïncubeerd met kleinere complexen die waren gezuiverd door Ino80ΔN en dat een subset van INO80 subeenheden ontbreekt, de verschoven soort sneller migreert (lanen 2-5 en 9-11), wat suggereert dat de relatieve mobbij verwerking van de super-verschoven band wordt bepaald door de grootte van de complexen geanalyseerd.

    Figuur 3 toont resultaten van een analyse vergelijking van de DNA-en nucleosoom geactiveerde ATPase activiteiten van twee verschillende INO80 subes. De langzamer migreren spots overeen met de start α- 32 P gemerkt ATP, en de sneller migrerende soorten ADP reactieproducten; pijlen geven de richting van oplosmiddel migratie.

    Een van de complexen hier getest, INO80ΔN omvat een INO80 ATPase subeenheid die zich normaal C-terminus van het eiwit, terwijl de andere, INO80ΔNC, mist het C-eindstandige gebied INO80. Hoewel deze twee complexen zijn verder identiek, de snelheid van ATP hydrolyse (gemeten door omzetting van radioactief gemerkt ATP naar ADP) is groter in de aanwezigheid van INO80ΔNC, suggereert de C-terminus van de INO80 ATPase kan zijn activiteit negatief reguleren. Merk op dat het tempo van de ATP hydrolysis beide complexen groter in de aanwezigheid van nucleosomen dan DNA, wijst de INO80 nucleosoom remodeling complexen voorkeur nucleosomale substraten voor ATP hydrolyse.

    In de in de figuur assay is er slechts een zeer geringe ATP hydrolyse in reacties die DNA of nucleosomen (van niet detecteerbaar tot <5% van die waargenomen in de aanwezigheid van DNA / nucleosomen) missen. Omdat de ATPase activiteit van INO80 en andere SNF2 familie chromatine hermodellering enzymen sterk gestimuleerd door DNA en nucleosomen, zou de aanwezigheid van aanzienlijke DNA en / of nucleosoom-onafhankelijke ATPase activiteit in de gezuiverde preparaten van de INO80 complex de aanwezigheid van verontreinigende cellulaire suggereren DNA, of als alternatief, verontreinigende non-INO80 ATPases die niet met succes tijdens de zuivering werden verwijderd. Verschillende stappen kunnen worden genomen om ongewenste introductie van DNA en / of ATPase tijdens het zuiveringsproces beperken.

    1) Verhoging van de salt concentratie (NaCl) bij de binding en wasstappen tijdens de zuivering. Gebruik van minder dan 200 mM NaCl in binding en wasstappen levert meestal preparaten van remodeling complexen met onaanvaardbare verontreinigende DNA en / of ATPases. We routinematig zuiveren INO80 complexen met een buffer die 450 mM NaCl verontreinigingen te minimaliseren (in 3 beschreven). Wij hebben buffers die zoveel 1 M NaCl actieve INO80 complexen zuiveren; echter, krijgen we een verminderde opbrengst aan actieve complexen onder deze omstandigheden;

    2) Voor het verlagen van de verhouding van FLAG agarose te cellysaat tijdens immuunzuivering; de optimale hoeveelheid FLAG-agarose worden door titratie bepaald;

    3) ATP-afhankelijke chaperones kan gebonden blijven aan-FLAG gemerkte eiwitten tijdens immuunzuivering. Vaak kunnen verwijderd worden door op 1 mM ATP in de wasbuffer gedurende immunozuivering;

    4) We hebben succesvoly verwijderd contaminerende DNA door op benzonase bij een concentratie van 25 eenheden / ml tijdens incubatie extract met FLAG-agarose kralen. LET OP: Het is essentieel om ervoor te zorgen benzonase wordt verwijderd tijdens het stappen daaropvolgende wassen, als restafval DNase substraat DNA of nucleosomen zal degraderen tijdens tests voor INO80 activiteit.

    De interpretatie van deze ATPase assays kunnen in principe worden bemoeilijkt door het feit dat INO80 chromatine remodeling complexen bevatten verschillende potentiële ATPases, met inbegrip van de SNF2-achtige kern ATPase INO80, actine-achtige eiwitten ARP5, Arp8, Baf53a, actine, en de AAA + ATPasen Tip49a en Tip49b. Ondanks de fysieke aanwezigheid van meerdere ATPases echter eerdere studies hebben aangetoond dat slechts complexen die katalytisch actieve INO80 kan DNA of nucleosoom-geactiveerde ATP hydrolyse ondersteunen; complexen die het katalytisch inactief E653Q vorm van INO80 ATPase niet aan detecteerbaar DNA-of-nucleosome gestimuleerd ATPase acti vertonenviteit onder alle omstandigheden getest 8. Aldus zijn DNA en / of-nucleosoom gestimuleerde ATPase activiteit van INO80 of INO80 subcomplexen hoofdzakelijk bijgedragen door de INO80 ATPase subeenheid.

    Figuur 1
    Figuur 1 INO80 nucleosoom ombouw, afhankelijk van de INO80 HSA domein en / of geassocieerde subeenheden, maar is onafhankelijk van de INO80 NTD en metazoan specifieke subeenheden. Nucleosome remodeling werden uitgevoerd met FLAG immuungezuiverd complexen van nucleaire extracten bereid uit cellijnen die FLAG -gelabeld versies van wild-type of mutant INO80 subeenheden. Intact INO80 complexen werden gezuiverd van cellijnen die FLAG-Ies2 of FLAG-INO80E; INO80 subes werden gezuiverd uit cellijnen die FLAG-Ino80ΔN of FLAG-Ino80ΔNΔHSA. Een relatieve concentratie (rel. Conc.) Van 1 correspondeert met ~ 10 nM INO80 complex. href = "https://www.jove.com/files/ftp_upload/51721/51721fig1highres.jpg" target = "_blank"> Klik hier om een ​​grotere versie van deze afbeelding te bekijken.

    Figuur 2
    Figuur 2 Nucleosome binding door de INO80 complex is onafhankelijk van de INO80 NTD en metazoan specifieke subeenheden. Nucleosome bindingsassays werden uitgevoerd in de aanwezigheid van variërende hoeveelheden van de aangegeven-FLAG immuungezuiverd INO80 complex. Binding van INO80 of INO80 subes om resultaten in de opkomst van slow-migreren "super-verschoven" banden die overeenkomen met mononucleosomes stabiel gebonden door INO80 of INO80 subes mononucleosomes. Klik hier om een grotere versie van deze afbeelding te bekijken.

    Figuur 3 "src =" / files / ftp_upload / 51721 / 51721fig3highres.jpg "/>
    Figuur 3 en nucleosoom DNA-afhankelijke ATPase assays. TLC (dunnelaagchromatografie) gebaseerde ATPase tests werden uitgevoerd om de snelheid van ATP hydrolyse door INO80 meten subcomplexen gezuiverd door FLAG-Ino80ΔN (AN) of FLAG-Ino80ΔNC (ΔNC) in de aanwezigheid van verzadigende hoeveelheden DNA en nucleosomen. De bepalingen werden uitgevoerd met twee verschillende concentraties van elk complex (5 nM en 10 nM) en drie verschillende reactietijden. De hoeveelheid ATP gehydrolyseerd (in pmol) in de reacties is aangegeven onder elk paneel. Klik hier om een grotere versie van deze afbeelding te bekijken.

    </ Tr>
    67,5 ul H2O
    10 gl 10x PCR buffer (zie Materials List)
    1 pi pGEM-3Z-601 (10 ng / ul)
    5 pi voorwaartse primer (10 urn)
    5 pi reverse primer (10 urn)
    0,5 pl dNTP voorraadoplossing van 10 mM elk van de 4 dNTPs
    1 pi Taq DNA polymerase (5 eenheden / pl)
    10 gl [Α- 32P] dCTP (6000 Ci / mmol, 3.3 uM)

    Tabel 1 reactiemengsel voor PCR-amplificatie van radioactief gemerkte "601" DNA-fragment.

    20 nM INO80 of INO80 subes
    2,8 nM nucleosomen (bestaande uit een mengsel van mononucleosomes op de 32p gemerkte DNA-fragment 601 en HeLa-cellen nucleosomen)
    1 mM ultrapuur ATP
    20 mM HEPES-NaOH (pH 7,9)
    50 mM NaCl
    5 mM MgCl2
    1 mM dithiothreitol (DTT)
    0,1 mM fenylmethaansulfonylfluoride (PMSF)
    0,1 mg / ml runderserumalbumine (BSA)
    5% glycerol
    0.02% Nonidet P-40
    0.02% Triton X-100

    Tabel 2 Onderdelen van de ATP-afhankelijke nucleosoom remodeling assays.

    32,6 ml H2O
    5 ml 40% acrylamide / Bis (37,5 1)
    2 ml 10x TBE (900 mM Tris-boraat, 20 mM EDTA)
    De volgende bestanddelen onmiddellijk vóór het gieten van de gel:
    0.4 ml 10% ammoniumpersulfaat
    0,1 ml TEMED

    Tabel 3 Bereiding van natieve polyacrylamidegel voor ATP-afhankelijke nucleosoom remodeling assays.

    10 mM HEPES pH 7,9
    10% glycerol
    100 mM NaCl
    1,5 mM MgCl2
    0,05% Triton X-100
    Voeg vlak voor gebruik:
    1 mM DTT
    200 uM PMSF
    1: 1000 verdunning Proteaseremmer Cocktail (zie Materials List)

    Tabel 4 EB100 buffer.

    3,9 pl H2O
    1 pi Remodeling 10x buffer (200 mM HEPES-NaOH (pH 7,9), 0,2% NP-40, 0,2% Triton X-100, 50% Glycerol, 50 mM MgCl2, 1 mg / ml BSA)
    0,1 pl 100 mM ATP
    0.01 pi 1 M DTT
    0.01 pi 100 mM PMSF
    0.25 pi gereconstitueerd mononucleosome substraat uit stap 1.2

    Tabel 5 Onderdelen van de master cocktail voor ATP-afhankelijke nucleosoom remodeling assays.

    0.33 pi 400 nM Hela nucleosomen
    0.75 pi 100 nM gesonificeerd zalmsperma DNA
    0.01 pi 1 M DTT
    0.01 pi 100 mM PMSF

    Tabel 6: Het verwijderen mix cocktail.

    2 ui H2O
    0.25 pi 20x ATPase buffer die 400 mM Tris-HCl (pH 7,5), 200 mM NaCl, 132 mM MgCl2, 16 mM EDTA, 0,3% Nonidet P-40, 50% glycerol, 2 mg / ml BSA
    0,1 pl 100 uM ATP
    0.005 pi 1 M DTT
    0.005 pi 100 mM PMSF
    0,1 pl [Α- 32 P] ATP (3000 Ci / mmol)
    <p class = "jove_content"> Tabel 7 Onderdelen van de master cocktail voor ATPase assays.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Om nucleosoom remodeling en ATPase activiteiten we waarnemen in assays afhankelijk van de katalytische activiteit van INO80 complexen, en niet op contaminerende remodeling en / of ATPase enzymen, we routinematig assay nucleosoom remodeling en ATPase activiteit van katalytisch inactieve versies INO80 complexen, gezuiverd parallel met wildtype INO80 volgens dezelfde procedure. Een negatieve controle reactie ontbreekt ATP moet worden uitgevoerd als het testen nucleosoom remodeling activiteit te testen op de aanwezigheid van contaminerende ATP en / of ATP-onafhankelijke remodeling activiteiten die interpretatie van experimenten vergelijken de activiteiten van verschillende preparaten van INO80 complex of subcomplexen kunnen bemoeilijken. Katalytisch inactief versies van INO80 of INO80 subes mag geen nucleosomen verbouwing of ATPase activiteiten vertonen. Bovendien detectie van DNA of nucleosoom-onafhankelijke ATPase activiteit de aanwezigheid van verontreinigende ATPase (s) in het enzyme fractie. Als activiteit nog gedetecteerd in aanwezigheid van katalytisch inactieve INO80 of er aanzienlijke DNA of nucleosoom-onafhankelijke ATPase activiteit zelfs na optimalisatie zuivering zoals beschreven in 'Representatieve resultaten, "complexen worden verder gezuiverd door extra stappen, zoals ion uitwisseling of gelfiltratiechromatografie of gradiënt sedimentatie.

    Bij het meten van nucleosoom remodeling en ATPase-activiteiten, is het raadzaam om testen uit te voeren voor de verschillende lengtes van de tijd en met meer dan een concentratie van INO80 of INO80 subes om ervoor te zorgen metingen worden genomen bij het product-tijd en dosis-respons curves zijn lineair. Ook moet nucleosoom bindingsassays worden uitgevoerd met verschillende concentraties INO80 complex (es); anders kan men niet betrouwbaar vergelijken de activiteiten van verschillende INO80 voorbereidingen.

    Nucleosoom glijden en bindingsbepalingen moet altijd controle reacties omvattendat mononucleosome substraat alleen, zijn als een marker voor de elektroforetische mobiliteit van de beginnend nucleosomen bevolking tonen. Op deze wijze kan men gemakkelijk veranderingen door specifiek de aanwezigheid van het enzym breuk aanduiden. Dergelijke controlereacties ook de integriteit van de gereconstitueerde mononucleosomes beoordelen.

    Om gemakkelijk interpreteerbare nucleosoom voeren schuiven en bindingstesten is het nuttig homogeen mononucleosomal substraten genereren; Daarom in dit protocol beschreven assay gebruikt nucleosomen gemonteerd op een DNA fragment dat een sterke nucleosoom positionering sequentie. Hoewel de INO80 complex meestal zijdelings gepositioneerd nucleosomen verplaatsen naar een meer centraal op een DNA fragment, andere chromatine remodeling enzymen, zoals ISWI-bevattende complex nurf 9, bewegen nucleosomen van meer centrale positie naar de uiteinden van DNA-fragmenten. Zo werden, tijdens de karakterisering van een chromatine remodeling enzyme is het nuttig mononucleosome substraten waarbij de nucleosoom positionering sequentie op verschillende plaatsen bereiden. Alternatief kan men substraten waarin nucleosomen zijn vervaardigd op DNA-fragmenten zonder nucleosoom positionering sequentie gebruiken. In dit geval zal de start nucleosomen bevolking zijn een mengsel van meer centraal en lateraal gepositioneerd nucleosomen.

    De ATP-afhankelijke nucleosoom remodeling proces kan leiden tot verschillende resultaten remodeling, waaronder complete nucleosoom verplaatsing van het DNA, nucleosoom beweging op het DNA of voorbijgaande veranderingen in nucleosoom structuur die niet kan leiden tot veranderingen in de posities van nucleosomen eenmaal de reactie-evenwicht bereikt maar toch functioneel significant. Het nucleosoom glijdende beschreven test kunnen de eerste twee reacties volgen, maar kan niet in staat zijn om voorbijgaande veranderingen detecteren in nucleosoom structuur. Een test die een deel van deze voorbijgaande alt kan detecterenfoon maakt gebruik van het feit dat nucleosomale DNA op het oppervlak van het nucleosoom octameer grotendeels ontoegankelijk doorsnijden met een restrictie-enzym dat DNA linker die is verplaatst van het octameer oppervlak door nucleosoom schuifdeuren of gedeeltelijk afwikkelen van nucleosomale DNA gevoelig snijden 10,11,12. Een dergelijke test kan ook zeer nuttig zijn in het geval dat het nucleosoom remodeling enzym bindt zo strak tegen het substraat dat het niet kan worden verwijderd door concurrent 13.

    Onze nucleosome glijden en bindingsbepalingen meten INO80 activiteiten met mononucleosomal substraten bereid met inheemse Hela cel histonen. Echter, remodeling activiteiten van INO80 of andere chromatine remodeling enzymen kunnen in principe worden beïnvloed door de aanwezigheid of afwezigheid van specifieke post-translationele modificaties of histon varianten. Daarnaast kan mononucleosomes activiteiten INO80 complex anders stimuleren dan di-nucleosomen,of een array van nucleosomen. Zo kunnen de activiteiten meten INO80 complex met meer gecompliceerd en divers nucleosomale substraat inzicht in het mechanisme waarmee INO80 chromatine remodeling complexen worden geregeld bieden.

    Als alternatief voor het gebruik van radioactief gelabelde DNA fragmenten nucleosoom remodeling en bindingsassays, sommige onderzoekers visualiseren nucleosomen en / of DNA door kleuring nucleosomale DNA met ethidium bromide 14; echter assays uitgevoerd onder toepassing van niet-radioactieve detectiemethoden aanzienlijk minder gevoelig dan die beschreven in dit protocol, typisch waarbij het gebruik van aanzienlijk meer enzym.

    De voortgang van ATPase reacties als een functie van tijd volgens de 32 P-gebaseerde assay beschreven vereist een afzonderlijke rondes van monsterbehandeling en analyse op elk tijdstip. Als alternatieve benadering kan ATPase-activiteit worden gemeten met fluorescentie gebaseerde testen

    De procedures die we in dit document JOVE zijn gebruikt om drie verschillende biochemische eigenschappen van INO80 of INO80 subcomplexen karakteriseren in het proces van ATP-afhankelijke nucleosoom remodeling. Via verschillende INO80 subcomplexen of INO80 mutanten in deze testen, is het mogelijk om de functionele bijdrage van verschillende INO80 subeenheden en / of domein structuren ontleden de INO80 nucleosoom ombouw, en stap (pen) in de remodeling reactie bepalen waarop INO80 subeenheden en / of domeinen van belang kan zijn. Deze procedures kunnen worden aangepast voor studie van andere nucleosoom remodeling en bindende enzymen en ATPases with zowel DNA en nucleosomen-afhankelijke of onafhankelijke activiteiten. We merken dat verschillende chromatine remodeling enzymen hogere of lagere intrinsieke ATPase of nucleosoom remodeling activiteiten dan het menselijk INO80 complex kan hebben. Vandaar dat, wanneer de aanpassing van die protocollen voor analyse van andere chromatine remodeling enzymen, moet men concentraties van enzym ATP, DNA en nucleosomen en reactietijden en / of temperaturen variëren teneinde de assays optimaliseren voor de specifieke enzymen onderzocht.

    Subscription Required. Please recommend JoVE to your librarian.

    Materials

    Name Company Catalog Number Comments
    Protease Inhibitor Cocktail Sigma P8340
    10x PCR reaction buffer  Roche Applied Science  11435094001
    Roche Taq DNA Polymerase Roche Applied Science  11435094001
    NucAway Nuclease-free Spin Columns  Ambion Cat. # AM10070
    ultrapure ATP  USB/Affymetrix 77241 25 UM
    bovine serum albumin  Sigma A9418 
    40% Acrylamide/Bis 37.5:1 Amresco 0254-500ML
    Sonicated salmon sperm DNAs  GE Healthcare 27-4565-01
    10% ammonium persulfate (APS) Thermo Scientific 17874
    benzonase  Novagen Cat. No. 70664
    dCTP, [α-32P]- 6,000 Ci/mmol PerkinElmer BLU013Z250UC
    PCR thermal cycler PTC 200 MJ Research PTC 200
    Hoefer vertical electrophoresis unit Hoefer SE600X-15-1.5
    lubricated 1.5 ml microcentrifuge tubes  Costar 3207
    Storage Phosphor Screen  Molecular Dynamics 63-0034-79
    3MM filter paper Whatman  28458-005 VWR
    Typhoon PhosphorImager  GE Healthcare 8600
    ImageQuant software GE Healthcare ver2003.02
    TLC Glass Plates, PEI-Cellulose F Millipore 5725-7
    Immobilon-FL Transfer Membrane 7 x 8.4 Millipore IPFL07810
    General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe Biodex Model 14C

    DOWNLOAD MATERIALS LIST

    References

    1. Clapier, C. R., Cairns, B. R. The biology of chromatin remodeling complexes. Annual Review of Biochemistry. 78, 273-304 (2009).
    2. Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes. Cell. 154, (3), 490-503 (2013).
    3. Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes. (2013).
    4. Lowary, P. T., Widom, J. New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning. J. Mol. Biol. 276, (1), (1006).
    5. Owen-Hughes, T., et al. Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes. Methods Mol. Biol. 119, 319-331 (1999).
    6. Udugama, M., Sabri, A., Bartholomew, B. The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor. Mol. Cell Biol. 31, (4), 662-673 (2011).
    7. Jin, J., et al. A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex. Journal of Biological Chemistry. 280, (50), 41207-41212 (1074).
    8. Chen, L., et al. Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling. Journal of Biological Chemistry. 286, (13), 11283-11289 (2011).
    9. Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF. Cell. 97, (7), 833-842 (1999).
    10. Polach, K. J., Widom, J. Restriction enzymes as probes of nucleosome stability and dynamics. Methods Enzymol. 304, 278-298 (1999).
    11. Anderson, J. D., Thastrom, A., Widom, J. Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol. 22, (20), 7147-7157 (2002).
    12. Saha, A., Wittmeyer, J., Cairns, B. R. Chromatin remodeling through directional DNA translocation from an internal nucleosomal site. Nature Structural and Molecular Biology. 12, (9), 747-755 (2005).
    13. Gottschalk, A. J., et al. Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A. 106, (33), 13770-13774 (2009).
    14. Clapier, C. R., Cairns, B. R. Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes. Nature. 492, (7428), 280-284 (2012).
    15. Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry. 33, (27), 8262-8271 (1994).
    16. Luk, E., et al. Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome. Cell. 143, (5), 725-736 (2010).
    Biochemische assays voor het analyseren van activiteiten van de ATP-afhankelijke chromatine remodeling Enzymen
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes. J. Vis. Exp. (92), e51721, doi:10.3791/51721 (2014).More

    Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes. J. Vis. Exp. (92), e51721, doi:10.3791/51721 (2014).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter