Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

मानव भ्रूण स्टेम कोशिकाओं में लक्ष्य निर्धारण जिंक उंगली Nuclease बढ़ी जीन

doi: 10.3791/51764 Published: August 23, 2014

Summary

रिपोर्टर सेल लाइनों, कल्पना ट्रैक और विषम आबादी से ब्याज की कोशिकाओं को अलग करने के लिए एक साधन प्रदान करते हैं. हालांकि, जीन को लक्षित मानव भ्रूण स्टेम कोशिकाओं में पारंपरिक मुताबिक़ पुनर्संयोजन का उपयोग अत्यंत अक्षम है. इस के साथ साथ, हम जस्ता उंगली nuclease बढ़ाया मुताबिक़ पुनर्संयोजन का उपयोग EGFP साथ सीएनएस मध्यमस्तिष्क विशिष्ट प्रतिलेखन कारक PITX3 ठिकाना को लक्षित वर्णन.

Abstract

वर्तमान मानव भ्रूण स्टेम सेल (ईएससी) भेदभाव प्रोटोकॉल के साथ एक प्रमुख सीमा विषम सेल आबादी की पीढ़ी है. इन संस्कृतियों ब्याज की कोशिकाओं होते हैं, लेकिन यह भी undifferentiated ESCs, गैर तंत्रिका डेरिवेटिव और अन्य न्यूरोनल उपप्रकार साथ दूषित कर रहे हैं. यह इन विट्रो में में और ऐसी दवाओं की खोज या सेल रिप्लेसमेंट थेरेपी के लिए इन विट्रो मॉडलिंग के रूप में विवो अनुप्रयोगों में उनके उपयोग की सीमा. इस पर काबू पाने में मदद करने के लिए, कल्पना ट्रैक और ब्याज की कोशिकाओं को अलग करने के लिए एक साधन प्रदान करते हैं, जो संवाददाता सेल लाइनों,, इंजीनियर हो सकता है. पारंपरिक मुताबिक़ पुनर्संयोजन अत्यंत अक्षम है के माध्यम से हालांकि, मानव भ्रूण स्टेम कोशिकाओं में इस लक्ष्य को हासिल करने के लिए. इस प्रोटोकॉल एक साथ एक साथ, पीयूष homeobox मानव भ्रूण स्टेम कोशिकाओं में 3 (PITX3) लोकस साइट विशेष डबल कतरा डीएनए टूट परिचय जो कस्टम डिजाइन जस्ता उंगली न्युक्लिअसिज़, का उपयोग करने का लक्ष्यीकरण का वर्णनPITX3 - EGFP -specific डीएनए दाता वेक्टर. PITX3 संवाददाता सेल लाइन की पीढ़ी के बाद, यह तो ऐसे में इन विट्रो पार्किंसंस रोग मॉडलिंग या सेल रिप्लेसमेंट थेरेपी के रूप में पढ़ाई के लिए उपयोग में प्रकाशित प्रोटोकॉल का उपयोग भेदभाव किया जा सकता है.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

वर्तमान भ्रूण स्टेम सेल (ईएससी) भेदभाव प्रोटोकॉल विशेष रूप से विशिष्ट neuronal phenotypes की व्युत्पत्ति के संबंध में, विषम सेल आबादी में परिणाम. संस्कृतियों वांछित सेलुलर phenotype, अन्य न्यूरोनल होते हैं इस प्रकार, हालांकि, गैर neuronal और संयुक्त राष्ट्र के विभेदित सेल प्रकार अक्सर 1 मौजूद हैं. इन विशेषताओं ईएससी के आवेदन सेल प्रतिस्थापन चिकित्सा में उपयोग के लिए और इन विट्रो रोग मॉडलिंग में सेल के सूत्रों व्युत्पन्न सीमा.

जेनेटिक संवाददाता सेल लाइनों, कल्पना ट्रैक और ब्याज की कोशिकाओं को अलग करने के लिए एक साधन प्रदान करते हैं, संवाददाता प्रोटीन (आरपी) की अभिव्यक्ति अंतर्जात अभिव्यक्ति reproduces कि प्रदान की है. एक जीन कोडिंग क्षेत्र के तुरंत नदी के ऊपर प्रमोटरों का उपयोग कच्चे आनुवंशिक संवाददाताओं से प्राप्त करने के लिए इस्तेमाल किया जा सकता है लेकिन इस तरह के निर्माणों अंतर्जात जीन अभिव्यक्ति को नियंत्रित कि सटीक नियामक तत्वों की कमी है. इसके विपरीत, मुताबिक़ पुनर्संयोजन प्रदान करता हैअवसर आरपी की उच्च निष्ठा अभिव्यक्ति सुनिश्चित करने के लिए. अतीत में, ब्याज की विशिष्ट loci में मुताबिक़ पुनर्संयोजन के लिए बनाया गया वैक्टर को लक्षित डीएनए वितरण 1,2 के एक साधन के रूप में electroporation का उपयोग माउस ESCs (mESCs) में आर पी एस लक्षित करने के लिए इस्तेमाल किया गया है. हालांकि पारंपरिक मुताबिक़ पुनर्संयोजन के माध्यम से संवाददाता सेल लाइनों की पीढ़ी मानव ESCs (hESCs) के लिए अत्यंत अक्षम है, और इस प्रकार केवल (3 में समीक्षा) मामलों की एक मुट्ठी में दर्ज़ किया गया है. जस्ता उंगली न्युक्लिअसिज़ (ZFNs) के रूप में सामूहिक रूप से जाना जाता साइट विशेष जस्ता उंगली रूपांकनों, के साथ एक Fok मैं nuclease की एक संलयन युक्त एक इंजीनियर काइमेरिक प्रोटीन, उपयोग करके डीएनए डबल कतरा टूटता पूर्व निर्धारित जीनोमिक loci में पेश किया जा सकता है. डीएनए डबल कतरा तोड़ दोनों पक्षों के लिए अनुरूपता साथ एक डीएनए वेक्टर जोड़ा जाता है, जीनोमिक साइट डीएनए दाता अनुक्रम का समावेश की अनुमति, मुताबिक़ पुनर्संयोजन द्वारा मरम्मत की जा सकती है. इस तकनीक को उपयोगी च साबित कर दिया हैया मानव प्राथमिक कोशिकाओं 4,5 और hESCs 6,7 दोनों में जीनोमिक संपादन. और हाल ही में काम का उपयोग किया गया है प्रतिलेखन उत्प्रेरक की तरह प्रेरक न्युक्लिअसिज़ (TALENS), संयंत्र द्वारा प्रयोग किया जाता प्रतिलेखन कारक साइट विशेष न्युक्लिअसिज़ 9 के डिजाइन में सहायता करने के लिए, 8 रोगजनकों.

निम्नलिखित प्रोटोकॉल में हम मानव पिट्यूटरी homeobox 3 (PITX3) लोकस के लिए ZFNs साथ एक साथ मुताबिक़ लक्ष्यीकरण वेक्टर 6 युक्त एक EGFP की electroporation द्वारा एक hESC संवाददाता सेल लाइन की पीढ़ी प्रदर्शित करता है. 2-3 सप्ताह के लिए एंटीबायोटिक चयन के बाद, सही ढंग से एकीकृत डीएनए के साथ hESCs मैन्युअल उठाया विस्तार और पीसीआर के माध्यम से शुरू में जांच की, और बाद में दक्षिणी सोख्ता द्वारा मान्य किया जा सकता है.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सभी प्रक्रियाओं एक बाँझ लामिना का प्रवाह हुड में किया जाता है. जब तक अन्यथा निर्दिष्ट सभी मीडिया और समाधान 37 डिग्री सेल्सियस तक equilibrated रहे हैं.

अभिकर्मक के लिए (इस प्रोटोकॉल में इस्तेमाल hESCs और hiPSCs, WA-09) मानव पीएससी के 1 विस्तार

नोट: यह Matrigel या Geltrex पर hESCs विस्तार करने के लिए आवश्यक नहीं है. माउस भ्रूणीय (MEFs) fibroblasts पर विस्तार hESCs एक MEF हटाने कदम निम्नलिखित electroporation या nucleofection के लिए इस्तेमाल किया जा सकता है (धारा 2.8 देखें).

  1. 1 एक्स 100 मिमी पकवान और MEF मीडिया में 2 सेमी प्रति 2.0 एक्स 10 4 कोशिकाओं पर DR4 MEFs के 1 एक्स 75cm2 कुप्पी तैयार / वी जिलेटिन डब्ल्यू 0.1% के साथ पूर्व लेपित व्यंजन पर (1 टेबल देखें).
    नोट: CF1, BLK6 या MF1 MEFs इस्तेमाल किया जा सकता है, हालांकि, यह जैसे, DR410, एंटीबायोटिक प्रतिरोधी MEF लाइनों उपयोग किया जाता है की सिफारिश की है.
  2. अगले दिन, एक 100 मिमी पकवान पर पारित होने hESCs खंड 1.1 में तैयार MEFs साथ पूर्व मढ़वाया. इस ASPI करने के लिएसंस्कृतियों व्यंजन से दर hESC मीडिया, सीए 2 + / Mg2 + मुक्त हैंक्स 'संतुलित नमक समाधान (HBSS) के साथ hESCs धोने, 37 डिग्री सेल्सियस / 5% सीओ 2 humidified इनक्यूबेटर में Dispase (उचित मात्रा के लिए 2 टेबल देखें) और जगह जोड़ने. MEFs दूर करने के लिए HBSS के साथ 2 बार - 3-5 मिनट ऊष्मायन के बाद, धीरे महाप्राण Dispase और 1 धो लो. धीरे संस्कृति पकवान की सतह से कालोनियों परिमार्जन, hESC मीडिया (3 टेबल देखें) और एक सेल खुरचनी का उपयोग कर, या 5 मिलीलीटर विंदुक जोड़ें.
  3. एक 15 मिलीलीटर अपकेंद्रित्र ट्यूब में संस्कृति पकवान से निलंबन में कॉलोनी टुकड़े ले लीजिए. HESC मीडिया और 15 मिलीलीटर ट्यूब पर स्थानांतरण से कुल्ला संस्कृति पकवान. एकल कक्षों या छोटे टुकड़ों में clumps को तोड़ने के लिए नहीं सावधान रहना.
  4. कॉलोनी टुकड़े गोली 160 XG पर 5 मिनट के लिए अपकेंद्रित्र.
  5. सतह पर तैरनेवाला Aspirate. कॉलोनी टुकड़ा गोली ढीला करने के लिए उंगली से 15 मिलीलीटर ट्यूब के नीचे ठोकर. विभाजन के अनुपात के अनुसार hESC मीडिया में धीरे resuspend कॉलोनी टुकड़े (normall4 और 1: 8 उपयुक्त है) फिर 1 के बीच का अनुपात विभाजित. दक्षता replating प्रभावित करेगा इस रूप में एकल कक्षों या छोटे टुकड़ों में clumps रेंडर करने के लिए नहीं बहुत सावधान रहना.
  6. MEFs HBSS के साथ 1x धोने पर hESC टुकड़े replating से पहले. धीरे धीरे व्यंजन MEFs साथ पूर्व मढ़वाया को hESC मीडिया में hESC टुकड़े युक्त सेल निलंबन का एक उचित मात्रा में (2 टेबल देखें) जोड़ें.
  7. इनक्यूबेटर में शेल्फ पर संस्कृति बर्तन रखें और समान रूप से कॉलोनी टुकड़े वितरित करने की ओर आगे और पीछे और साइड धीरे धीरे कदम.
  8. दैनिक hESC मीडिया बदलें.
  9. MEFs (MEF-मुख्यमंत्री) से वातानुकूलित मीडिया को तैयार करने के लिए धोने के 75 सेमी 2 फ्लास्क MEFs HBSS के साथ 1 एक्स के साथ पूर्व मढ़वाया. HESC मीडिया जोड़ें. 24 घंटे के बाद मीडिया वातानुकूलित और ताजा hESC मीडिया के साथ की जगह ले लीजिए. 12 दिनों की एक अधिकतम के लिए दैनिक दोहराएँ. जब तक जरूरत 4 डिग्री सेल्सियस पर MEF मुख्यमंत्री स्टोर.

अभिकर्मक के लिए मानव ESCs के 2. तैयारी

  1. HESCs के विकास को ध्यान से देखेंदैनिक एक खुर्दबीन के नीचे. कालोनियों 40-50% मिला हुआ, थाली 2 सेमी प्रति 2.0 x 10 5 MEFs साथ 3 एक्स 100 मिमी व्यंजन हो जाते हैं.
  2. कालोनियों 60 हो जाते हैं - 70% मिला हुआ वे ट्रांसफ़ेक्ट बनने के लिए तैयार हैं. विभेदित कालोनियों या कॉलोनी कोर निकाल कर 'पुरूष' कालोनियों.
    नोट: हम उच्च अभिकर्मक विश्वास करते हैं और कोशिकाओं लॉग चरण विकास में हैं जब लक्ष्यीकरण क्षमता उत्पन्न होती है, यह hESCs ≥ 70% confluency तक पहुँचने से पहले electroporation आयोजित किया कि सुझाव दिया है.
  3. HBSS के साथ hESC कालोनियों धोएं और Accutase जोड़ें.
    नोट: यह रॉक अवरोध के साथ पूर्व इलाज hESCs आवश्यक नहीं है वाई 27,632 कदम 2.7 के दौरान वाई 27,632 के साथ incubated के रूप में जब पर्याप्त निषेध हो जाएगा
  4. 37 डिग्री सेल्सियस / 5 एक खुर्दबीन के नीचे देखा के रूप में कालोनियों एकल कक्षों प्रदान कर रहे हैं जब तक% सीओ 2 पर 20 मिनट - 10 के लिए सेते हैं. एक 1 मिलीलीटर विंदुक के साथ महीन चुर्ण बनाना कोशिकाओं.
  5. एक 40 माइक्रोन सेल straine का उपयोग कर एक 15 मिलीलीटर शंक्वाकार ट्यूब में hESC मीडिया और फिल्टर जोड़ेंसेल clumps को हटाने के लिए आर.
  6. 5 मिनट के लिए 160 XG पर अपकेंद्रित्र. ताजा hESC मीडिया में Resuspend सेल गोली और किसी भी अवशिष्ट Accutase समाधान निकालने के लिए दोहराएँ.
  7. 10 माइक्रोन वाई 27,632 और एक 100 मिमी पकवान के लिए कुल सेल निलंबन हस्तांतरण जिलेटिन के साथ लेपित पूर्व युक्त hESC मीडिया में कोशिकाओं Resuspend.
  8. 30 मिनट की एक न्यूनतम के लिए 37 डिग्री सेल्सियस / 5% सीओ 2 सेते हैं.
  9. इस समय के दौरान MEFs जिलेटिन लेपित पकवान का पालन करना होगा. एक ताजा 15 मिलीलीटर अपकेंद्रित्र ट्यूब में एक 1 मिलीलीटर पिपेट का उपयोग गैर पक्षपाती hESCs लीजिए और एक hemocytometer का उपयोग सेल घनत्व का निर्धारण.

HESCs के 3 Electroporation

  1. 0.22 सुक्ष्ममापी फिल्टर और जोड़ 10 एनजी / एमएल पुनः संयोजक मानव fibroblast वृद्धि कारक 2 (rhFGF2) का उपयोग कर फ़िल्टर मुख्यमंत्री MEF मीडिया.
  2. 5 मिनट के लिए 160 XG पर एक नया 15 मिलीलीटर शंक्वाकार ट्यूब और अपकेंद्रित्र के लिए खंड 2.9 से 7.5 x 106 hESCs स्थानांतरण.
  3. घातीय हाथी के लिए चयन कार्यक्रम: electroporator की स्थापना के दौरान इस बार250 वी, समाई: ctroporation और निम्न पैरामीटर, वोल्टेज सेट 500 μF, और प्रतिरोध: ∞-.
  4. सतह पर तैरनेवाला Aspirate और ठंडा 0.22 माइक्रोन फ़िल्टर किया HBSS के 0.8 मिलीलीटर में सेल गोली फिर से निलंबित. एक बाँझ 0.4 सेमी electroporation क्युवेट का हल स्थानांतरण.
  5. टीवी hPITX3 आगे लक्ष्यीकरण का निर्माण (30 माइक्रोग्राम डीएनए) जोड़ें और एक 200 μl विंदुक के साथ धीरे मिश्रण. 5 मिनट के लिए बर्फ पर सेते हैं. इस समय के दौरान PITX3 ZFN mRNA की एक विभाज्य निकालें और बर्फ पर defrost. Electroporation क्युवेट में डीएनए / सेल मिश्रण करने के लिए स्थानांतरण ZFN mRNA की 7.5 μl defrosted है. एक 200 μl विंदुक के साथ धीरे मिलाएं.
    नोट: निशाना बनाया जा रहा ठिकाना दक्षता को लक्षित करने के लिए योगदान देता है कि मुख्य कारक है. ऐसे PITX3 के रूप में मूक जीन, ESCs में व्यक्त नहीं जीन, मुश्किल हैं loci एन्कोडिंग पारंपरिक मुताबिक़ पुनर्संयोजन 6 का उपयोग लक्षित करने के लिए. इस प्रकार, इस प्रोटोकॉल कस्टम एक डीएनए डबल कतरा बी प्रेरित करने के लिए मानव PITX3 लोकस के लिए ZFNs डिज़ाइन किया इस्तेमालReak.
  6. Electroporator पर स्क्रीन पर दिए गए निर्देशों का पालन करके Electroporate.
  7. एक 200 μl विंदुक 10 मिलीलीटर hESC मीडिया वाले एक 15 मिलीलीटर ट्यूब को electroporation क्युवेट से सामग्री हस्तांतरण का उपयोग करना. HESC मीडिया के 200 μl एक 15 मिलीलीटर ट्यूब को हर समय और हस्तांतरण के साथ दो बार क्युवेट धो लें. वहाँ हो जाएगा "श्लेष्मा की तरह" मलबे नकारात्मक सेल अस्तित्व को प्रभावित करेगा जो lysed कोशिकाओं से डीएनए और प्रोटीन से मिलकर. इस मलबे को हटाने के लिए 5 मिनट के लिए 160 XG पर अपकेंद्रित्र.
  8. सतह पर तैरनेवाला Aspirate और धीरे ढीला करने के लिए सेल गोली नल. 10 माइक्रोन वाई 27,632 युक्त MEF मुख्यमंत्री पूरक 30 मिलीलीटर में पुनः निलंबित और MEFs साथ preplated 3 एक्स 100 मिमी व्यंजन पर replate.
  9. दैनिक मीडिया बदलें. 2 दिन, वाई 27,632 वापस लिया जा सकता है और कोशिकाओं hESC मीडिया ही में हो गई.
  10. 2-3 दिनों के बाद hESCs 50-70% मिला हुआ होना चाहिए. इस बिंदु पर एंटीबायोटिक चयन (जैसे, 0.5 माइक्रोग्राम / एमएल puromycin) शुरू करते हैं.
  11. एसईएल बनाए रखेंदैनिक ताजा hESC / puromycin मीडिया जोड़कर ection. ~ 7 दिनों के बाद छोटे कालोनियों दिखाई जानी चाहिए. एंटीबायोटिक प्रतिरोधी MEFs इस्तेमाल नहीं कर रहे हैं, MEFs 2 सेमी प्रति एक अतिरिक्त 1.0 एक्स 10 4 कोशिकाओं जोड़कर पूरक हो सकते हैं.

4 उठा ट्रांसजेनिक hESC क्लोन

  1. लगभग 14 - (कालोनियों ~ 1 मिमी व्यास तक पहुँच चुके हैं) चयन निम्नलिखित 21 दिनों के विस्तार और स्क्रीनिंग के लिए प्लेटें तैयार करते हैं. 5 घंटा की एक न्यूनतम के लिए 4 डिग्री सेल्सियस पर Matrigel या Geltrex की एक विभाज्य defrosting द्वारा शुरू करो. निर्माताओं 'निर्देशों के अनुसार पतला और 3 एक्स 96 अच्छी तरह से प्लेटों के प्रत्येक अच्छी तरह से करने के लिए 75 μl जोड़ें. 2 सेमी प्रति 2.0 एक्स 10 4 कोशिकाओं पर MEFs चढ़ाना द्वारा 3 एक्स 48 अच्छी तरह प्लेटें तैयार करें. 37 डिग्री सेल्सियस / 5% सीओ 2 पर दोनों प्लेटों हे / एन सेते हैं.
  2. अगले दिन एक ग्रिड काटने से एक 2 मिलीलीटर विंदुक के अंत पर एक 21 जी सुई का उपयोग 16-25 टुकड़ों में कालोनियों काटना.
  3. महाप्राण 96 अच्छी तरह प्लेटें से Matrigel और supplem के साथ बदलेंented मुख्यमंत्री MEF मीडिया. 48 अच्छी तरह प्लेटें 1 HBSS के साथ एक्स और hESC मीडिया जोड़ने में धो MEFs.
  4. एक 200 μl विंदुक का प्रयोग धीरे विस्तार के लिए एक 48 अच्छी तरह से थाली में विच्छेदित कॉलोनी के 1/3 हस्तांतरण. पूरक मुख्यमंत्री MEF मीडिया वाले एक इसी 96 अच्छी तरह से थाली में विच्छेदित कॉलोनी के अन्य 2/3 स्थानांतरण.
  5. दैनिक मीडिया बदलकर दोनों प्लेटों का रखरखाव (MEFs युक्त 48 अच्छी तरह प्लेटें के लिए 96 अच्छी तरह से Matrigel लेपित प्लेटें और hESC मीडिया के लिए मुख्यमंत्री MEF मीडिया पूरक, दोनों 0.5 माइक्रोग्राम / एमएल puromycin के साथ पूरक).
  6. 96 अच्छी तरह प्लेटें 100% मिला हुआ हैं और फिर शुरू में पीसीआर के माध्यम से स्क्रीन तक 'का विस्तार करें.

5 स्क्रीनिंग और सकारात्मक क्लोन के विस्तार

  1. जीनोमिक डीएनए (11 पर आधारित विधि) तैयार inverting द्वारा प्लेटों से सभी मीडिया को दूर करने के लिए, तो कागज तौलिए पर दाग.
  2. आर टी पीबीएस (100 μl / अच्छी तरह से प्रत्येक धोने), 5.1 कदम के लिए के रूप में पलटना और दाग के साथ एक अच्छी तरह से दो बार कुल्ला. -80 डिग्री सेल्सियस एफ में जगह प्लेटेंया 1 - 2 घंटा सेल में सहायता करने के लिए (प्लेटें इस तरह अनिश्चित काल के संग्रहीत किया जा सकता है).
  3. कोशिकाओं Sarcosyl lysis बफर बनाने के सी -80 डिग्री पर हैं (तालिका 4 देखें) (50 μl / अच्छी तरह से). अच्छी तरह से प्रत्येक में 5 फिर आरटी पर मिनट पिपेट lysis बफर के लिए कोशिकाओं, गर्म प्लेटें lyse करने के लिए. नमी बनाने के लिए नम कागज तौलिए से युक्त एक sealable कंटेनर में टेप, जगह के साथ एक थाली के किनारों सील, और 60 डिग्री सेल्सियस पर ओ / एन सेते हैं.
  4. ऊष्मायन के बाद, -20 डिग्री सेल्सियस निरपेक्ष इथेनॉल के 10 एमएल के लिए 5M NaCl के 150 μl जोड़ने के मिश्रण अच्छी तरह से, और प्रत्येक अच्छी तरह से करने के लिए 100 μl जोड़ने (नोट: NaCl जोड़ा जाता है जब इथेनॉल बादलमय जाना होगा). ठोकर प्लेटें धीरे मिश्रण (नहीं पिपेट करना) और आरटी पर 30 मिनट की एक न्यूनतम के लिए छोड़ दें. इस समय के दौरान समाधान स्पष्ट जायेंगे और डीएनए वेग जाएगा.
  5. फिर अच्छी तरह से प्रत्येक के लिए 70% इथेनॉल के 150 μl जोड़ने कदम 5.1 में के रूप में समाधान निकालें. धीरे थाली पलटना और पहले के रूप में दाग. इस चरण में एक और 2x दोहराएँ.
    नोट: क्योंकि उपजी डीएनए स्वाभाविक रूप adheटिशू कल्चर प्लास्टिक को जोड़कर यह इन धोने चरणों के दौरान उखाड़ फेंकना नहीं बन जाता है.)
  6. अंतिम धोने के बाद शीर्ष गति से संक्षिप्त अपकेंद्रित्र प्लेटों में कम से कम 30 मिनट के लिए आरटी पर प्रत्येक अच्छी तरह से तो हवा शुष्क के नीचे (या 37 डिग्री सेल्सियस) के लिए डीएनए ध्यान केंद्रित करने के लिए.
  7. 40 जोड़ें - 50 μl T0.1E (pH8.0) 1 घंटे के लिए 65 डिग्री सेल्सियस पर प्रत्येक अच्छी तरह से और जगह प्लेटें या ते (pH8.0) (5 तालिका देखें) या कम से 4 डिग्री कंपनी / एन पीसीआर के लिए उपयोग करने से पहले. धीरे थाली की तरफ दोहन से डीएनए Resuspend. फिर से निलंबित डीएनए / 10 μl पीसीआर प्रतिक्रिया के 1-2 μl का प्रयोग करें.
  8. HPITX3 एल बांह जनरल के साथ लंबे खाका पीसीआर प्रणाली का विस्तार का उपयोग करना. एफ और hPITX3 एल हाथ GFP आर प्राइमरों 58 डिग्री सेल्सियस annealing, 45 सेकंड विस्तार, 35 चक्रों में क्लोन की प्रारंभिक जांच करते हैं.
  9. एक 1% agarose जेल में Hyperladder 1kb साथ Electrophorese नमूने 45 मिनट के लिए 100 वी पर GelRed और यूवी रोशनी के माध्यम से सकारात्मक क्लोन का पता लगाने युक्त.
  10. Expa से जीनोमिक डीएनए पचाने द्वारा पीसीआर सकारात्मक क्लोन मान्यएक दक्षिणी धब्बा करने के लिए वेक्टर अनुरूपता हथियार के HindIII और hybridizing जांच 5 'और 3' के साथ nded क्लोन (देखें नीचे) (पहले 1 में वर्णित है). जांच प्राइमर जोड़े hPITX3 5 'जांच एफ और आर, और hPITX3 3' जांच एफ और आर, EcoRI के साथ पचा और एक सामान्य क्लोनिंग वेक्टर में ligated का उपयोग पीसीआर द्वारा उत्पन्न कर रहे हैं.
  11. सकारात्मक क्लोन की संख्या पर निर्भर करता है, MEFs (2 सेमी प्रति 2.0 एक्स 10 4 कोशिकाओं) के साथ पहले से चढ़ाना द्वारा 6 अच्छी तरह से थाली के 2 कुओं तैयार करते हैं.
  12. अगले दिन 1 घंटा की एक न्यूनतम के लिए 10 माइक्रोन वाई 27,632 के साथ 48 अच्छी तरह से थाली में सकारात्मक क्लोन pretreat.
  13. HBSS के साथ सकारात्मक क्लोन धोएं और Accutase के 300 μl जोड़ें.
  14. कालोनियों एकल कक्षों प्रदान कर रहे हैं, जब hESC मीडिया के 1 मिलीलीटर जोड़ने और एक 15 मिलीलीटर ट्यूब में इकट्ठा.
  15. दैनिक मीडिया बदलें. 2 दिन, वाई 27,632 वापस लिया जा सकता है और कोशिकाओं hESC मीडिया में हो गई.
  16. 80% मिला हुआ, उपसंस्कृति और Colo के शेष फ्रीज - कालोनियों में 70 हैं जबNY टुकड़े.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

PITX3 के साथ कस्टम डिजाइन PITX3 जस्ता उंगली जोड़ी के सह electroporation के बाद - EGFP -specific डीएनए दाता वेक्टर, और बाद puromycin चयन, सकारात्मक hESC क्लोन शुरू में जीनोमिक पीसीआर स्क्रीनिंग (चित्रा 1) के माध्यम से पता चला रहे थे. इन पीसीआर 5 के साथ सकारात्मक क्लोन 'और 3' विशिष्ट जांच के दक्षिणी धब्बा संकरण 19% की दक्षता के साथ, PITX3 ठिकाना (चित्रा 2) के 1 एक्सॉन को सही लक्ष्यीकरण की पुष्टि की. 3 चित्र में दिखाया Immunofluorescent छवियों एक प्रकाशित PA6 stromal सेल भेदभाव प्रोटोकॉल 12,13 का उपयोग भेदभाव निम्नलिखित PITX3 प्रमोटर द्वारा संचालित EGFP अभिव्यक्ति का प्रदर्शन. EGFP के सह स्थानीयकरण ऐसे FOXA2 (लाल) (चित्रा 3 ए) और tyrosine hydroxylase (गु, लाल) के रूप में मध्यमस्तिष्क डोपामिनर्जिक न्यूरॉन्स के मार्कर के साथ मनाया जा सकता है, (3B चित्रा) महत्वपूर्ण बात नहीं सह स्थानीयकरण सी, जबकि GABAergic मार्कर, गामा aminobutyric एसिड (लाल गाबा) के साथ मनाया जा ould   (चित्रा -3 सी).

चित्रा 1
पीसीआर उत्पाद (984 बीपी पर बैंड) द्वारा दिखाया के रूप में चित्रा 1 प्रारंभिक जीनोमिक पीसीआर स्क्रीनिंग. कॉलोनी उठा और विस्तार के बाद, प्रारंभिक जीनोमिक पीसीआर स्क्रीनिंग कई सकारात्मक क्लोन का पता चला. (क्लोन. EGFP जीन के भीतर स्थित है जो प्राइमरों hPITX3 एल बांह जनरल. बस छोड़ दिया लक्षित कर हाथ बाहर स्थित है जो एफ,, और hPITX3 एल हाथ GFP आर का उपयोग कर जांच की गई) दायाँ हाथ और बाएं हाथ की ओर गलियों एक 1 केबी हैं सीढ़ी. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

> "lways चित्रा 2
EGFP चित्रा 2 मान्यकरण hESCs में जस्ता उंगली न्युक्लिअसिज़ का उपयोग hPITX3 ठिकाना को निशाना. को लक्षित करने के लिए मान्य कार्यरत दक्षिणी धब्बा रणनीति (ए) योजनाबद्ध. शीर्ष पैनल योजनाबद्ध को लक्षित से पहले देशी hPITX3 ठिकाना दिखाता है. नीचे पैनल योजनाबद्ध EGFP transgene की सही प्रविष्टि निम्नलिखित hPITX3 ठिकाना दर्शाया गया है. प्रत्येक पैनल के तहत लाल लाइनों 5 'और 3' दक्षिणी धब्बा जांच के लिए बाध्य होगा, जिस पर साइटों को वर्णन, और चित्रा 2B. (बी) पीसीआर पूर्व स्क्रीनिंग से चयनित सही ढंग से लक्षित कालोनियों के प्रतिनिधि दक्षिणी धब्बा में बैंड के अनुरूप हैं. लघुरूप: EGFP, बढ़ाया हरी फ्लोरोसेंट प्रोटीन; PGK, मानव phosphoglycerol काइनेज प्रमोटर; PURO, puromycin प्रतिरोध जीन. अन्य विशेषताएं: loxP साइटों, बैंगनी; polyadenylation अनुक्रम, बीएलUE, hPITX3 एक्सॉनों, नारंगी. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 3
चित्रा 3 hPITX3-EGFP hESCs PA6 / LSB / शिथिलता / FGF8 परिस्थितियों में विभेदित. (ए) FOXA2 (लाल), (ख) वें (लाल) और (सी) गाबा (लाल) के साथ लेबल EGFP की Immunofluorescent छवियों. DAPI (नीला) के साथ counterstained. सलाखों, 50 माइक्रोन तराजू. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

PITX3 के साथ कस्टम डिजाइन PITX3 जस्ता उंगली जोड़ी के सह electroporation के बाद - EGFP -specific डीएनए दाता वेक्टर, और बाद puromycin चयन, सकारात्मक hESC क्लोन शुरू में जीनोमिक पीसीआर स्क्रीनिंग (चित्रा 1) के माध्यम से पता चला रहे थे. इन पीसीआर 5 के साथ सकारात्मक क्लोन 'और 3' विशिष्ट जांच के दक्षिणी धब्बा संकरण 19% की दक्षता के साथ, PITX3 ठिकाना (चित्रा 2) के 1 एक्सॉन को सही लक्ष्यीकरण की पुष्टि की. 3 चित्र में दिखाया Immunofluorescent छवियों एक प्रकाशित PA6 stromal सेल भेदभाव प्रोटोकॉल 12,13 का उपयोग भेदभाव निम्नलिखित PITX3 प्रमोटर द्वारा संचालित EGFP अभिव्यक्ति का प्रदर्शन. महत्वपूर्ण बात नहीं सह स्थानीयकरण GABAergic मार्कर के साथ मनाया जा सकता है, जबकि (3B चित्रा); EGFP के सह स्थानीयकरण ऐसे FOXA2 (लाल) (चित्रा 3 ए) और tyrosine hydroxylase (लाल वें) के रूप में मध्यमस्तिष्क डोपामिनर्जिक न्यूरॉन्स के मार्कर के साथ मनाया जा सकता है , गामा aminobutyric एसिड (GABA, लाल) (चित्रा -3 सी).

ontent "के लिए: रखने together.within पृष्ठ =" हमेशा "> चित्रा 1
पीसीआर उत्पाद (984 बीपी पर बैंड) द्वारा दिखाया के रूप में चित्रा 1 प्रारंभिक जीनोमिक पीसीआर स्क्रीनिंग. कॉलोनी उठा और विस्तार के बाद, प्रारंभिक जीनोमिक पीसीआर स्क्रीनिंग कई सकारात्मक क्लोन का पता चला. (क्लोन. EGFP जीन के भीतर स्थित है जो प्राइमरों hPITX3 एल बांह जनरल. बस छोड़ दिया लक्षित कर हाथ बाहर स्थित है जो एफ,, और hPITX3 एल हाथ GFP आर का उपयोग कर जांच की गई) दायाँ हाथ और बाएं हाथ की ओर गलियों एक 1 केबी हैं सीढ़ी. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 2
चित्रा 2 की मान्यताEGFP hESCs में जस्ता उंगली न्युक्लिअसिज़ का उपयोग hPITX3 ठिकाना को निशाना. को लक्षित करने के लिए मान्य कार्यरत दक्षिणी धब्बा रणनीति (ए) योजनाबद्ध. शीर्ष पैनल योजनाबद्ध को लक्षित से पहले देशी hPITX3 ठिकाना दिखाता है. नीचे पैनल योजनाबद्ध EGFP transgene की सही प्रविष्टि निम्नलिखित hPITX3 ठिकाना दर्शाया गया है. प्रत्येक पैनल के तहत लाल लाइनों 5 'और 3' दक्षिणी धब्बा जांच के लिए बाध्य होगा, जिस पर साइटों को वर्णन, और चित्रा 2B. (बी) पीसीआर पूर्व स्क्रीनिंग से चयनित सही ढंग से लक्षित कालोनियों के प्रतिनिधि दक्षिणी धब्बा में बैंड के अनुरूप हैं. लघुरूप: EGFP, बढ़ाया हरी फ्लोरोसेंट प्रोटीन; PGK, मानव phosphoglycerol काइनेज प्रमोटर; PURO, puromycin प्रतिरोध जीन. अन्य विशेषताएं: loxP साइटों, बैंगनी; polyadenylation अनुक्रम, नीले, hPITX3 एक्सॉनों, नारंगी. इस फाई का एक बड़ा संस्करण देखने के लिए यहां क्लिक करेंgure.

चित्रा 3
चित्रा 3 hPITX3-EGFP hESCs PA6 / LSB / शिथिलता / FGF8 परिस्थितियों में विभेदित. (ए) FOXA2 (लाल), (ख) वें (लाल) और (सी) गाबा (लाल) के साथ लेबल EGFP की Immunofluorescent छवियों. DAPI (नीला) के साथ counterstained. सलाखों, 50 माइक्रोन तराजू. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

पदार्थ मिलीग्राम / 100 मिलीलीटर सूची संख्या (प्रदायक)
DMEM 89 10566-016 (जीवन टेक्नोलॉजीज)
भ्रूण गोजातीय सीरम 10 16140-071 (जीवन टेक्नोलॉजीज)
पेन / Strep 1 15070-063 (जीवन टेक्नोलॉजीज)

तालिका 1.

घटक 100 मिमी पकवान 60 मिमी पकवान 6 अच्छी तरह से 48 अच्छी तरह से 96 अच्छी तरह से 75cm 2 फ्लास्क
HBSS 5 मिलीलीटर 2 मिलीलीटर 1 मिलीलीटर 0.5 मिलीलीटर 0.1 मिलीलीटर 8 मिलीलीटर
Accutase 5 मिलीलीटर 2 मिलीलीटर 1 मिलीलीटर 0.5 मिलीलीटर 0.1 मिलीलीटर 8 मिलीलीटर
Dispase 5 मिलीलीटर 2 मिलीलीटर 1 मिलीलीटर - - -
hESC मीडिया 10 मिलीलीटर 6 मिलीलीटर 3 मिलीलीटर 0.5 मिलीलीटर 0.2 मिलीलीटर 15 मिलीलीटर
Matrigel - - - - 0.1ml -

तालिका 2.

</ तालिका>

तालिका 3.

पदार्थ मिलीग्राम / 100 मिलीलीटर सूची संख्या (प्रदायक)
DMEM / F12 80 11320-033 (जीवन टेक्नोलॉजीज)
एस आर 20 10828-028 (जीवन टेक्नोलॉजीज)
NEAA 1 11140-050 (जीवन टेक्नोलॉजीज)
Glutamax 1 35050-061 (जीवन टेक्नोलॉजीज)
पेन / Strep 1 15070-063 (जीवन टेक्नोलॉजीज)
एसएस mercaptoethanol 0.1 21985-023 (सिग्मा Aldrich)
rhFGF2 7 एनजी / एमएल [अंतिम] 233-FB-025 / सीएफ (आर एंड डी सिस्टम)
पदार्थ एकाग्रता सूची संख्या (प्रदायक)
एन Lauroylsarcosine सोडियम नमक समाधान (Sarcosyl) 0.5% (w / वी) 61747 (सिग्मा Aldrich)
EDTA 10.0 मिमी E9884 (सिग्मा Aldrich)
NaCl 10.0 मिमी S3014 (सिग्मा Aldrich)
Tris-सीएल (pH7.5) 10.0 मिमी T3253 (सिग्मा Aldrich)
Proteinase कश्मीर 1.0 मिलीग्राम / एमएल जैव 37084 (Bioline ऑस्ट्रेलिया)

तालिका 4.

पदार्थ एकाग्रता सूची संख्या (प्रदायक)
Tris-सीएल (pH8.0) 10.0 मिमी T3253 (सिग्मा Aldrich)
EDTA (pH8.0) 0.1 मिमी E9884 (सिग्मा Aldrich)

तालिका 5.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

संवाददाता सेल लाइनों की पीढ़ी, ट्रैक कल्पना और hESCs से निकाली गई एक विषम जनसंख्या से ब्याज की कोशिकाओं को अलग करने के लिए एक शक्तिशाली साधन प्रदान करता है. हालांकि, पारंपरिक मुताबिक़ पुनर्संयोजन के माध्यम से लक्षित कर जीन मानव ESCs 3 के लिए अत्यंत अक्षम साबित हो गया है. इस प्रोटोकॉल में हम ZFNs के साथ मिलकर एक व्यापक रूप से उपलब्ध लक्ष्यीकरण वेक्टर का उपयोग hESCs में, एक्सॉन PITX3 लोकस में से एक में एक आरपी शुरू करने के लिए एक अपेक्षाकृत सरल तकनीक का वर्णन. हमारे हाथ में जीन को लक्षित प्रणाली (कि पहले 6 प्रकाशित करने के लिए इसी तरह की) एक सही ढंग से लक्षित PITX3 ठिकाना युक्त puromycin प्रतिरोधी क्लोन के 19% के साथ कुशल है.

जीन लक्ष्यीकरण की सुविधा के लिए ZFNs का उपयोग के साथ एक सीमा घर में खरोंच से ZFNs को डिजाइन करने में कठिनाई है. इस प्रकार, इस प्रोटोकॉल में हम कस्टम प्राप्त करने के लिए महंगा हो सकता है जो व्यावसायिक रूप से उपलब्ध ZFNs, बनाया गया. & # प्रयुक्त160; हाल ही में, TALEN प्रणाली मुताबिक़ पुनर्संयोजन 9 का उपयोग को लक्षित जीन के लिए इस्तेमाल किया गया है. TALENS का उपयोग बहुत जीन संपादन की लागत कम कर देता है और इस प्रक्रिया में तेजी लाने, घर में बनाया जा सकता है. स्पष्ट रूप से इस अध्ययन में प्रदर्शन नहीं हालांकि कार्यप्रणाली ही है जैसे TALEN प्लास्मिड 3.5 कदम के बजाय ZFN mRNA में उपयोग किया जाता है सिवाय 9 में दिखाया गया है, इस प्रोटोकॉल को आसानी से, TALENS के उपयोग को शामिल करने के लिए संशोधित किया जा सकता है.

इस तकनीक का उपयोग करते समय यह hPSCs लॉग चरण विकास में हैं, यह सुनिश्चित करने के लिए आवश्यक है (उदाहरण के लिए, संस्कृतियों 70% या उससे अधिक मिला हुआ नहीं हैं). हम इस कोशिका विभाजन के दौरान परमाणु लिफाफा टूटने के बाद नाभिक को प्लाज्मिड लाभ का उपयोग के रूप में महत्वपूर्ण है कि विश्वास करते हैं. इस प्रक्रिया में दाता डीएनए को शामिल करने के विभाजन के दौरान अनुरूपता निर्देशित मरम्मत कारनामे के रूप में इसके अलावा, डीएनए दाता वेक्टर ही डीएनए संश्लेषण निम्नलिखित डीएनए में शामिल होगाजीनोम.

ZFN दृष्टिकोण के साथ एक अन्य संभावित सीमा डीएनए की शुरूआत के जीनोम में कहीं टूट जाता है. बाहरी 5 'और 3' जांच के साथ दक्षिणी संकरण सही एकीकरण का पता लगाता है हालांकि यह कहीं जीनोम में अतिरिक्त एकीकरण घटनाओं या त्रुटि प्रवण मरम्मत का पता नहीं लगा होगा. अतिरिक्त एकीकरण घटनाओं SELEX 3,6 का उपयोग कर पता लगाया जा सकता ZFN जोड़े के बंद लक्ष्य दरार जबकि वेक्टर विशेष जांच का उपयोग दक्षिणी संकरण (जैसे, EGFP) द्वारा जांच की जा सकती.

हम सीधे एक PITX3 जीन की निष्क्रियता को जिम्मेदार ठहराया जा सकता है कि मध्यमस्तिष्क डोपामिनर्जिक न्यूरॉन्स के विकास में कोई स्पष्ट प्रभाव का पालन नहीं किया था, शोधकर्ताओं ने एक जीन की एक कॉपी बाधित है जहां किसी भी लक्षित कर घटना के लिए हानिकारक हो सकता है कि दिमाग में रखना चाहिए परिणामों का विश्लेषण और है कि जब सेल के विकास के खाते में रखना चाहिए. इस चाहे मामला काफी हद तक निर्भर करेगाजीन पर निशाना बनाया जा रहा है और केवल प्रयोग के माध्यम से पता लगाया जा सकता है.

एक PA6 आधारित भेदभाव प्रोटोकॉल 12,13 का उपयोग हम (चित्रा 3) और छँटाई प्रतिदीप्ति सक्रिय सेल निम्नलिखित नकारात्मक आबादी बनाम सकारात्मक EGFP के qPCR विश्लेषण immunofluorescence द्वारा संवाददाता प्रणाली की निष्ठा की पुष्टि करने में सक्षम थे (नहीं दिखाया डेटा). PITX3 मध्यमस्तिष्क डोपामिनर्जिक न्यूरॉन्स 14 को एक प्रतिलेखन कारक विशिष्ट है, एक मानव PITX3 संवाददाता सेल लाइन के इंजीनियरिंग या तो इन विट्रो में पीडी मॉडलिंग या सेल प्रतिस्थापन चिकित्सा की पढ़ाई में hESCs से निकाली गई PITX3 + मध्यमस्तिष्क डोपामिनर्जिक न्यूरॉन्स के उपयोग की सुविधा होगी.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

इस प्रोटोकॉल में वर्णित कार्य पुनर्योजी चिकित्सा के लिए कैलिफोर्निया इंस्टीट्यूट (सीआईआरएम) के साथ एक सहयोगी गठबंधन के हिस्से के रूप में विक्टोरियन सरकार से धन के द्वारा ही संभव बनाया गया था.

Materials

Name Company Catalog Number Comments
Mouse Embryonic Fibroblasts (DR4) GlobalStem GSC-6004G
Gelatin Sigma G1393-100ML
HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS) Life Technologies 14175-095
Dispase StemCell Technologies 7923
Cell Scraper Corning 3008
Accutase Life Technologies A11105-01
Y27632 Axon Medchem Axon 1683
Cell Strainer - 40 μm BD Biosciences 352340
33 mm - 0.22 μm filter Millipore SLGP033RS
rhFGF2 R&D Systems 233-FB-025/CF
Electroporator BioRad 165-2661
0.4 cm electroporation cuvette BioRad 165-2088
Human TV-hPITX3-forward targeting construct Addgene 31942
ZFN Kit; Human PITX3 Sigma-Aldrich CKOZFN1050-1KT
Puromycin InvivoGen ant-pr-1
Matrigel BD Biosciences 354277
Geltrex Life Technologies A1569601
NaCl Sigma-Aldrich S3014
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 10566-016
Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS) Life Technologies 16140-071
Pen/Strep Life Technologies 15070-063
Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12) Life Technologies 11320-033
KnockOut Serum Replacement (KSR) Life Technologies 10828-028
MEM Non-Essential Amino Acids  (NEAA) Life Technologies 11140-050
GlutaMAX Life Technologies 35050-061
ß-mercaptoethanol Life Technologies 21985-023
N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%) Sigma-Aldrich 61747
EDTA Sigma-Aldrich E9884
Trizma Hydrochloride Sigma-Aldrich T3253
Proteinase K solution (20 mg/ml) Bioline Australia BIO-37084
Expand Long Template PCR System Roche Australia 11681834001
hPITX3 L arm gen. F (primer): 5’ TGTCCTAAGGAGAATGGGTAACAGACA 3’ GeneWorks, Australia
hPITX3 L arm GFP R (primer): 5’ ACACGCTGAACTTGTGGCCGTTTA 3’ GeneWorks, Australia
HyperLadder 1 kb  Bioline Australia BIO-33025
GelRed Jomar Bioscience, Australia 41003

DOWNLOAD MATERIALS LIST

References

  1. Nefzger, C. M., et al. Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells. Stem Cells. 30, (7), 1349-1361 (2012).
  2. Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential. Neurochemistry International. 59, (3), 394-403 (2011).
  3. Collin, J., Lako, M. Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells. Stem Cells. 29, (7), 1021-1033 (2011).
  4. Carroll, D. Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Therapy. 15, (22), 1463-1468 (2008).
  5. Urnov, F. D., et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 435, (7042), 646-651 (2005).
  6. Hockemeyer, D., et al. Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases. Nature Biotechnology. 27, (9), 851-857 (2009).
  7. Lombardo, A., et al. Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nature Biotechnology. 25, (11), (2007).
  8. Boch, J., Bonas, U. Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annual Review of Phytopathology. 48, 419-436 (2010).
  9. Hockemeyer, D., et al. Genetic engineering of human embryonic cells using TALE nucleases. Nature Biotechnology. 29, (8), 731-734 (2011).
  10. Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. A transgenic mouse strain expressing four drug-selectable marker genes. Nucleic Acids Research. 25, (18), 3745-3746 (1997).
  11. Ramírez-Solis, R., Rivera-Pérez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. Genomic DNA microextraction: a method to screen numerous samples. Analytical Biochemistry. 201, (2), 331-335 (1992).
  12. Kawasaki, H., et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron. 28, (1), 31-40 (2000).
  13. Denham, M., Thompson, L. H., Leung, J., Pébay, A., Björklund, A., Dottori, M. Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells. Stem Cells. 28, (10), 1805-1815 (2010).
  14. Smidt, M. P., et al. A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons. Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).
मानव भ्रूण स्टेम कोशिकाओं में लक्ष्य निर्धारण जिंक उंगली Nuclease बढ़ी जीन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).More

Hartley, B. J., Fabb, S. A., Finnin, B. A. L., Haynes, J. M., Pouton, C. W. Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells. J. Vis. Exp. (90), e51764, doi:10.3791/51764 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter