Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Desarrollo de una doi: 10.3791/53974 Published: June 10, 2016

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fibrosis está implicada en la patogénesis de diversas enfermedades progresivas crónicas, como la enfermedad pulmonar intersticial, fibrosis cardiaca, cirrosis hepática, insuficiencia renal terminal, la esclerosis sistémica, y las enfermedades autoinmunes 1. Entre las enfermedades pulmonares intersticiales, fibrosis pulmonar idiopática (FPI) es una enfermedad progresiva crónica y muestra mal pronóstico. característica patológica de la IPF es el desarrollo de focos de fibroblasto que consiste en fibroblastos y miofibroblastos activados que están asociados con el pronóstico. Se proponen los orígenes de tales fibroblastos pulmonares que se derivan de varias células mesenquimales, incluyendo fibroblastos pulmonares residentes originalmente y que circulan fibrocitos de la médula ósea. Recientemente, se ha propuesto transición epitelio-mesenquimal (EMT) que se asocia con la formación de células mesenquimales 2, y para contribuir a la patogénesis de trastornos fibróticos.

Se cree que la EMT juega un papel importante en el proceso de desarrollo fetal, la cicatrización de heridas, y la progresión del cáncer, incluyendo la invasión tumoral y la metástasis 3. Tras el proceso de EMT, las células epiteliales obtener la capacidad de las células mesenquimales por la pérdida de marcadores epiteliales, tales como la E-cadherina, y por la expresión de marcadores mesenquimales, tales como la vimentina, y α-actina de músculo liso (SMA) 4,5. Estudios anteriores mostraron la evidencia de que proceso de EMT se ha asociado con el desarrollo de fibrosis de tejidos en el riñón y el pulmón 6 7. Además, la inflamación crónica promueve la enfermedad fibrótica 8; Además, las citoquinas inflamatorias tales como miembro de la superfamilia de factor de necrosis tumoral 14 (TNFSF14; LIGHT), factor de necrosis tumoral (TNF) -α, y la interleucina-1β, se ha demostrado para mejorar EMT 9-12.

ensayo de contracción de gel de colágeno, un ensayo de contracción de las células a base de colágeno en el que los fibroblastos se incrustan en el tipo Igel de colágeno tridimensional, es un ideal modelo in vitro para la evaluación de la contractilidad. La contractilidad es una de las funciones características de los fibroblastos y contribuye a la reparación de heridas normal y fibrosis 13. En este ensayo, se cree que la unión de los fibroblastos para colágeno tipo I a través de mecanismos dependientes de integrina se supone para producir tensión mecánica bajo ciertas condiciones, y en consecuencia dar lugar a la contracción del tejido.

Aquí, se informa que el desarrollo del ensayo de contracción de gel que adaptarse para evaluar la adquisición de la función contráctil en las células que se sometieron a EMT. Este informe demuestra que este ensayo modificado es adecuado para la evaluación de la contractilidad de las células mesenquimales que se sometieron a EMT.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparación y cultivo de células epiteliales de pulmón

  1. células epiteliales de pulmón humano A549 Cultura (línea de células adherentes) en de Eagle modificado por Dulbecco (DMEM) suplementado con 10% de suero bovino fetal (FBS), 100 UI / ml de penicilina, y 100 mg / ml de estreptomicina.
  2. Retirar y desechar el medio de cultivo celular de placa de cultivo, y se lava una vez con 5 - 10 ml de tampón fosfato salino (PBS). Después del lavado, aspirar inmediatamente a la PBS.
  3. Añadir 2 ml de ácido tripsina / etilendiaminotetraacético (EDTA) (0,05%) y se incuba a 37 ° C y 5% de CO2 durante 3 min.
  4. Recoger las células separadas en tubos de centrífuga que contiene medio de cultivo de células, centrifugar los tubos a temperatura ambiente durante 4 min a 150 x g.
  5. Resuspender el pellet de células en 2 ml de medio de cultivo celular y retirar una muestra para el recuento de células. Contar el número de las células utilizando un hemocitómetro con tripán azul mancha para comprobar la viabilidad celular.
  6. células A549 semilla en10 placas de poliestireno cm a una densidad de 0,5 - 1,0 x 10 6 células / placa con 10 ml de medio para el ensayo de contracción de gel. Sembrar las células en placas de 6 pocillos de poliestireno a una densidad de 0,5 - 1,0 x 10 5 células / pocillo con 2 ml de medio para la confirmación de la EMT. Se incuban las células a 37 ° C y 5% de CO2 durante 24 horas.

2. Procedimiento de EMT

  1. Añadir 10 l de TGF-β1 (5 g / ml) y 10 l de TNF-α (10 g / ml) a la placa para el ensayo de contracción de gel sembrado en el paso 1.6. Añadir 2 l de TGF-β1 (5 g / ml) y 2 l de TNF-α (10 g / ml) a la placa para la confirmación EMT cabeza de serie en el paso 1.6. Se incuba a 37 ° C y 5% de CO2 durante 48 horas.

3. Confirmación de Procedimiento EMT por PCR y Western Blotting

  1. Confirmar cambio en la morfología (de similar a la piedra del adoquín al husillo forma) de las células tratadas utilizando microscopía de contraste de fase.
    Nota: Normacélulas de Al A549 tienen adoquín apariencia similar a la piedra y de forma triangular que es una característica de las células epiteliales, pero después de la estimulación con TGF-β1 y TNF-α, las células aparecen de largo y en forma de huso que es similar a las células mesenquimales 14,15.
  2. Evaluar la expresión de un marcador epitelial, tales como E-cadherina, y los marcadores mesenquimales tales como N-cadherina, vimentina y actina de músculo liso α-utilizando PCR o Western Blot.
    1. Extraer el ARN total de las células usando el kit de extracción de ARN 16 y sintetizar cDNA utilizando la transcriptasa inversa 17 de acuerdo con el protocolo del fabricante.
    2. Medir la expresión de los niveles de mRNA utilizando el sistema de PCR en tiempo real 18 y tinte de cianina monomérica kit PCR de acuerdo con las instrucciones del fabricante. Los cebadores específicos para GAPDH (gliceraldehído 3-fosfato deshidrogenasa), ACTA2 (alfa-actina-2), CDH1 (cadherina-1; E-cadherina) y VIM (vimentina) se muestran en la Tabla 1
    3. Lisar las células utilizando un tampón de lisis (Tabla 2) que contenía 1% de cóctel inhibidor de proteasa. Medir todas las concentraciones de proteína de la muestra utilizando un kit de ensayo de proteínas de 19,20, y aplicar las mismas cantidades de proteína en un gel de poliacrilamida.
      1. Realizar SDS-electroforesis en gel y transferencia semiseca de las proteínas a una membrana de PVDF 21. Incubar la membrana con anticuerpos primarios en tampón de bloqueo durante 1 - 2 hr. Después de la incubación, lavar dos veces la membrana con tampón de lavado y se incuba la membrana hr 1 con segundos anticuerpos.
        Nota: Véase la Tabla de Materiales / Equipo de anticuerpos y diluciones utilizadas en estos estudios. Véase la Tabla 2 para los componentes del tampón de bloqueo.
      2. Lavar la membrana con tampón de lavado dos veces. Tome fotos de la membrana con el kit de detección de Western Blot 22 utilizando una cámara CCD de 11,23 frío.

4. Gel Ensayo de contracción para la EMT Evaluación

  1. Aspirar el medio acondicionado desde el recipiente de cultivo de células, y lavar bien con 5 - 10 ml de PBS para eliminar las células muertas. Después del lavado, aspirar inmediatamente a la PBS.
  2. Añadir 2 ml de 0,05% de tripsina / EDTA y se incuba a 37 ° C y 5% de CO2 durante 3 min.
  3. Recoger las células separadas en tubos de centrífuga que contienen DMEM complementado con inhibidor de tripsina (1 mg / ml), centrifugar los tubos a temperatura ambiente durante 4 min a 150 x g.
  4. Mezclar tipo gel 1 de colágeno con agua destilada, y 4 × DMEM concentrado para ajustar los volúmenes para lograr una concentración de colágeno de 1,75 mg / ml, y 1 × concentración DMEM. Asegúrese de mantener el medio de gel en hielo durante este paso.
    Nota: Para hacer 6 ml de medio de gel, mezclar bien 3,5 ml de tipo 1 de gel de colágeno (3 mg / ml), 1,5 ml de 4 × DMEM concentrado, y 1 ml de agua destilada.
  5. Resuspender el sedimento celular en 500 l de PBS y extraer una muestra para recuento de células. Contarel número de las células utilizando un hemocitómetro con tinción de azul de tripano para verificar la viabilidad celular.
  6. Añadir el medio de gel de ajustar los volúmenes de lograr una densidad celular de 3,0 × 10 5 células / pocillo (6,0 × 10 5 células / ml) y suavemente pero rápidamente se mezcla mediante pipeteo sin gelificación.
  7. Dispensar 0,5 ml de la mezcla en cada pocillo de una placa no tratada de 24 pocillos de forma rápida y cuidadosamente para asegurarse de forma cilíndrica ordenada. Tenga cuidado de no permitir que las burbujas de aire que contaminan los geles (Figura 1A).
    Nota: El medio de gel que contiene las células es viscoso y puede gelificar fácilmente y la forma de media luna forma en el pozo.
  8. Incubar la placa durante 15 min en un incubador de células a 37 ° C, 5% de CO2 y 95% de humedad a gel completamente.
  9. Separar los geles de la placa sin romper moviendo una espátula esterilizada de una manera para dibujar una circunferencia en una dirección. Usando una espátula, transferir suavemente los geles a placas de cultivo de tejidos de 60 mmque contiene 5 ml de DMEM / 1% de FBS con o sin TGF-β1 (5 ng / ml) y TNF-α (10 ng / ml).
  10. Agite con cuidado los platos para asegurar geles están flotando en el medio. Incubar en un incubador de células a 37 ° C, 5% de CO2 y 95% de humedad.

5. Medición de Gel Tamaño

  1. Medir el tamaño de gel de colágeno después de 0, 24, 48, y 72 hr utilizando un sistema de análisis de imagen.
    1. Encienda el sistema de documentación de geles (Figura 2A), y poner los platos en el armario de protección contra la luz. A continuación, retire la tapa de platos en el armario.
    2. Abra el software de análisis relacionada gel. Haga clic en el botón "adquisición de imágenes" en la barra de menú para mostrar la imagen de los geles en el gabinete. A continuación, haga clic en "adquirir" en la barra de menú para tomar imágenes de los geles (Figura 2B).
    3. Haga clic en el botón "detección" en la barra de menús (Figura 2C) y ajustar la región de medición (i círculo amarillon Figura 2C) arrastrando el ratón. A continuación, haga clic en el botón "detectar automáticamente" en la barra de menú (véase el botón en la Figura 2D). El software detecta automáticamente los geles que muestran un mapa de calor (Figura 2D).
    4. Haga clic en "OK" para extraer el contorno de los geles de tratamiento de la imagen y calcular áreas rodeadas por el contorno (Figura 2E). Después se calcula el área, el área calculada se visualiza en la ventana emergente separada.
      Nota: Si los geles se solapan entre sí durante la exploración, geles mueva suavemente con una punta de pipeta estéril.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Durante la EMT, las células epiteliales pierden marcadores epiteliales, como E-cadherina, y obtener la expresión de marcadores mesenquimales, como la vimentina y α-actina de músculo liso 4,5. La incubación de células epiteliales de pulmón humano A549 con TGF-β1 y TNF-α induce EMT. La aparición de células A549 normales son de adoquín como la forma y la forma del triángulo que es una característica de las células epiteliales (Figura 3A), pero después de estimuladas con TGF-β1 y TNF-α, la apariencia cambia a forma de huso durante mucho tiempo que es similar a mesenquimales células (Figura 3B).

La expresión de marcadores epiteliales y mesenquimales se evaluó para confirmar que las células se sometieron a EMT. la expresión del ARNm relativa se calculó con el método ΔΔCt. Los datos individuales se normalizó en contra deshidrogenasa gliceraldehído-3-fosfato (GAPDH), que es un servicio de limpieza geno. Las células A549 tratadas con TGF-β1 y TNF-α por 48 hr habían reducido significativamente la expresión de CDH1 y aumentó significativamente la expresión de VIM y ACTA2 (Figura 4A). Las secuencias de los cebadores utilizados para q-PCR se muestran en la Tabla 1. Como se muestra en la Figura 4B, la estimulación con TGF-β1 y TNF-α expresión atenuada E-cadherina, mientras que la expresión de vimentina, N-cadherina, y actina de músculo liso α-fue inducida.

El ensayo de contracción de gel se realizó para evaluar la contractilidad de las células que se sometieron a EMT. Después de la inducción de la EMT con TGF-β1 y TNF-α, las células fueron lanzados en el gel de colágeno y se incubaron durante 72 horas en un medio que contiene el TGF-β1 y TNF-α, o PBS. Como se muestra en la Figura 5A, los geles que contienen células tratadas con TGF-β1 y TNF-α eran más pequeños que los geles de control que contienen las células tratadas con PBS. para quantify los cambios en el tamaño de gel, los geles se analizaron utilizando un analizador de gel 0, 24, 48, y 72 horas después de tratamiento. Después de 72 horas, los tamaños de geles que contienen células tratadas con TGF-β1 y TNF-α se redujeron significativamente en comparación con los geles de control (Figura 5B). También confirmó que los geles que contienen células tratadas con TGF-β1 solo eran más pequeños que los geles de control, pero no eran más pequeños que los geles tratados con TGF-β1 y TNF-α (datos no mostrados).

Figura 1
Figura 1. Figura complementario para hacer los geles. Estas imágenes muestran los geles emitidos en los pozos. El medio de gel que contiene las células es viscoso y puede gelificar y la forma de media luna en el formulario así de fácil. (A) La imagen de la izquierda muestra que los geles son fundidos correctamente y la imagen de la derecha muestra el esquema de "forma cilíndrica ordenada". (B </ Strong>) La imagen de la izquierda muestra que los geles se deforman, y la imagen de la derecha muestra que las burbujas de aire contaminan los geles. (C) Los geles son suaves, por lo dañan fácilmente y por lo general se deforman como "Pac-Man". Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Los pasos para medir el tamaño del gel. (A) El sistema de documentación de gel consiste en un PC y un sistema de imágenes de gel. El "botón de adquisición de imágenes" (B), y una fotografía de los geles. El "botón de detección" (C), y la ventana para el ajuste de la región de medición (círculo amarillo). El "botón de detección automática" (D), y el software hace un mapa de calor de los geles de una imagen a De proteger el contorno de los geles. (E) El software extrae el contorno de los geles de procesamiento de imágenes, y calcula zonas rodeadas por el contorno. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. morfologías de células inducidas-EMT. A549 epitelios de pulmón humano se sembraron a una densidad de 1,0 x 10 5 células / pocillo en una placa de 6 pocillos y se incubaron con o sin 5 ng / ml de TGF-β1 y 10 ng / ml TNF-α por 48 hr, seguido de imágenes microscópicas de contraste de fase. (A) y (B) son imágenes obtenidas bajo × 200. Las barras de escala en (A) y (B), 100 micras. t = "_ blank"> Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. Estimulación EMT con TGF-β1 y TNF-α. (A) QRT-PCR análisis de la expresión de marcadores de EMT (CDH1, VIM, y ACTA2). (B) Transferencia Western que muestra la expresión de E-cadherina, N-cadherina, vimentina, y la alfa actina del músculo liso proteínas en células A549 estimuladas con o sin TGF-β1 y TNF-α. α-tubulina se utilizó como control interno. Las células A549 se cultivaron como en la Figura 1. N = 3 experimentos independientes. ** P <0,01; barras de error representan el SEM. Por favor, haga clic aquí para ver una versión más grande de esta figura.

iles / ftp_upload / 53974 / 53974fig5.jpg "/>
Figura 5. Las células que sufren EMT Adquirida la contractilidad. Las células A549 se sembraron a una densidad de 1,0 x 10 6 células / placa en placas de 10 cm y se incubaron con o sin 5 ng / ml de TGF-β1 y 10 TNF-α ml / ng por 48 hr. Las células fueron entonces echaron en 500 l de medio que contiene 1,75 mg de gel de colágeno / ml a una densidad de 3,0 x 10 5 células / pocillo en una placa de 24 pocillos. Después de la formación del gel, se añadieron a medio con o sin 5 ng / ml de TGF-β1 y 10 TNF-α ml / ng en placas de 60 mm y se incubaron durante 72 h seguido por formación de imágenes (A). tamaños del gel se midieron después de 0, 24, 48, y 72 hr utilizando un sistema de análisis de imagen. N = 9 experimentos independientes (B). ** P <0,01; barras de error representan el SEM. Por favor, haga clic aquí para ver una versión más grande de esta figura.

gen Nombre Delantero 5 '→ 3' Revertir 5 '→ 3'
ACTA2 GCACCCAGCACCATGAAGA ACCGATCCAGACAGAGTATTT
GAPDH GGTGAAGGTCGGAGTCAACGGA GAGGGATCTCGCTCCTGGAAGA
EMPUJE GACAATGCGTCTCTGGCACGTCTT TTCTTCTGCCTCCTGCAGGTTCTT
CDH1 CCCATCAGCTGCCCAGAAAATGAA CTGTCACCTTCAGCCATCCTGTTT

Tabla 1. Secuencias de los cebadores. Primer secuencias utilizadas para QRT-PCR. GAPDH se utilizó como control interno.

Tampón de lisis: tampón RIPA
mM Tris-HCl pH 7,5 20
NaCl 150 mM
EDTA 1 mM
1% de polioxietileno (9) éter octyiphenyl
0,1% de Na-desoxicolato
0,1% de SDS
tampón de bloqueo
1% de reactivo de bloqueo en tampón de lavado
Tampón de lavado: tampón TBST
NaCl 45 g
1 M Tris pH 7,4 50 ml
Polioxietileno (20) monolaurato de sorbitán 2,5 ml
destila el agua añadir a 5 L
5 L

Tabla 2. Los componentes de tampones usados. Los componentes de la lisis, tampón de bloqueo y tampón de lavado.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El protocolo desarrollado en este estudio comprende dos etapas. La primera etapa se realiza para inducir EMT, mientras que el segundo paso es el ensayo de contracción de gel. Dado que es importante confirmar que las células se sometieron a EMT, el paso 2 proporciona un excelente complemento a los cambios en la expresión de genes y morfológicos. Estudios anteriores demostraron que la EMT de las células A549 fue inducida por sólo el 24 por TGF-β1; Sin embargo, como hemos informado anteriormente 10, el tratamiento con TNF-α aumenta la EMT y la adquisición de marcadores de células mesenquimales. Se piensa que los mecanismos de EMT mediada por TGF-β es Smad dependiente 25. TNFa aumenta la EMT TGF-β1 inducida que conduce a la mejora de la contracción del gel. Se ha informado de que los mecanismos de TNF para la mejora de EMT inducida por TGF-β1 no sólo son la fosforilación de Smad2 región de engarce, sino también MAPK regulación 26 de señalización. Por lo tanto, el protocolo desarrollado en este estudio incluyó stimulación tanto por TGF-β1 y TNF-α.

La incrustación de las células que se sometieron a EMT en el colágeno de tipo I gel, y flotan en el medio, son aspectos centrales de este ensayo (paso 4). Debido a que los geles son suaves y se dañan fácilmente, y tienen diferentes dimensiones de cada lado, se requiere mucho cuidado al aplicar los geles para el medio y medir sus tamaños. Si es difícil de llevar a cabo este paso, hay un método alternativo para medir los tamaños de gel en el pozo sin mover los geles en 60 mm plato 27,28. Existen varios problemas comunes, el primer problema es que los geles de colágeno gelificar fácilmente a temperatura ambiente, por lo que los geles a menudo se deforman como se ha mencionado en el paso 4.7. Por lo tanto, la placa debe agitarse suavemente después de emitir los geles en los pozos para asegurarse de que toman una forma cilíndrica ordenada. El segundo problema es que si las burbujas de aire entran en los geles durante la gelificación, entonces el tamaño de los geles será desigual. Tenga cuidado de no permitir que cualquier aire bubbles contaminen los geles. Hay dos diferencias principales entre método original y este método. Las primeras diferencias es que la concentración final de geles de colágeno de método original es 0,75 mg / ml, pero que de este método es 1,75 mg / ml con el fin de permitir que los geles se contraigan más de lo que lo hacen con el método original. Las segundas diferencias es que el método original utiliza medio libre de suero para el medio de gel flotante pero este método utiliza 1% de FBS en el medio flotante gel con el fin de mantener la viabilidad celular y mantener la contractilidad celular.

El ensayo de contracción gel desarrollado originalmente para los fibroblastos es un ideal modelo in vitro para la evaluación de la contractilidad de las células que contribuyen al proceso de cicatrización de heridas y fibrosis 13. La unión de los fibroblastos para colágeno tipo 1 se supone que producir tensiones mecánicas que por consiguiente conduce a una reducción en el tamaño de los geles de colágeno. Además, este ensayo se ha utilizado recientementecomo un modelo in vitro para el estudio de la contracción de las células de las vías respiratorias en las enfermedades inflamatorias, incluyendo el asma bronquial y EPOC 29-31.

El ensayo de contracción de gel es comparable a otros ensayos, tales como ensayos de migración celular, en que no requiere dispositivos específicos y exhibe una alta reproducibilidad cuantitativa. Sin embargo, hay pocos informes que soliciten el ensayo de contracción de gel para la evaluación de la EMT 32. En este estudio, los geles que contienen células que se sometieron a EMT disminuyeron significativamente en tamaño de 24 a 72 hr después de la gelificación, lo que indica la contracción celular. Sin embargo, existen limitaciones a este método. La primera es que en este ensayo, el cambio de tamaño de los geles muestran la suma de la contractilidad de todas las células en los geles. Sin embargo, es difícil de evaluar la contractilidad de células individuales en los geles utilizando este ensayo. La segunda es que las células A549 es una línea celular de cáncer, no las células epiteliales humanas normales. Por lo tanto, es difícil extrapolar our resultados directamente a la patogénesis de la fibrosis pulmonar. Sin embargo, las células A549 se usan ampliamente para estudiar las funciones de las células epiteliales de las vías respiratorias, y varios estudios proporcionaron evidencia de EMT mediante el uso de las células A549 como un modelo de fibrosis pulmonar 33,34.

En resumen, el colágeno tipo I geles que contienen células mesenquimales que sufrió EMT se redujeron en tamaño, lo que indica la contracción de esas células. Por lo tanto, el ensayo de contracción de gel debe ser considerada como un prolongado ensayo in vitro para evaluar la adquisición de la función contráctil en las células a través de proceso de EMT.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen conflictos de intereses a revelar.

Materials

Name Company Catalog Number Comments
DMEM sigma aldrich 11965-092 For A549 medium
FBS GIBCO 10437
Transforming Growth Factor-β1, Human, recombinant Wako Laboratory chemicals 209-16544
Recombinant Human TNF-α R&D systems 210-TA/CF
E-Cadherin (24E10) Rabbit mAb Cell Signaling Technology #3195 1:3,000 dilution
Vimentin (D21H3) Rabbit mAb Cell Signaling Technology #5741 1:3,000 dilution
Anti-α-Tubulin antibody sigma aldrich T9026 1:10,000 dilution
Monoclonal Anti-Actin, α-Smooth Muscle antibody  sigma aldrich A5228 1:10,000 dilution
Anti-N-cadherin antibody BD Transduction Laboratories #610920 1:1,000 dilution
Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody) GE Healthcare NA931-100UL 1:20,000 dilution
Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody) GE Healthcare NA934-100UL 1:20,000 dilution
Blocking reagent GE Healthcare RPN418 2% in TBS-T
6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid corning #353046
100 mm Cell culture dish TPP #93100
DMEM, powder life technologies 12100-046 For 4× DMEM
Type 1 collagen gel Nitta gelatin Cellmatrix type I-A
24 Well cell culture plate AGC TECHNO GLASS 1820-024
Gel Documentation System  ATTO AE-6911FXN Gel imager
Gel analyzing software ATTO Densitograph, ver. 3.00 analysing software bundled with AE-6911FXN
Trypsin-EDTA (0.05%), phenol red life technologies 25300054
24 Well Plates, Non-Treated IWAKI 1820-024
Trypan Blue Solution, 0.4% life technologies 15250-061
RNA extraction kit Qiagen 74106
Reverse transcriptase life technologies 18080044
Real time PCR system Stratagene Mx-3000P
SYBR green PCR kit Qiagen 204145
Protease Inhibitor Cocktail (100x) life technologies 78429
PVDF membrane ATTO 2392390
Protein assay kit bio-rad 5000006JA 
Polyacrylamide gel ATTO 2331810
Western blotting detection reagent GE Healthcare RPN2232
Cold CCD camera ATTO Ez-Capture MG/ST
Trypsin inhibitor sigma aldrich T9003-100MG
Polyoxyethylene (20)Sorbitan Monolaurate Wako Laboratory chemicals 163-11512
Polyoxyethylene (9) octyiphenyl ether Wako Laboratory chemicals 141-08321

DOWNLOAD MATERIALS LIST

References

  1. Wynn, T. A. Cellular and molecular mechanisms of fibrosis. The Journal of pathology. 214, 199-214 (2008).
  2. Hardie, W. D., Glasser, S. W., Hagood, J. S. Emerging concepts in the pathogenesis of lung fibrosis. The American journal of pathology. 175, 3-16 (2009).
  3. Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease. Circulation. 125, 1795-1808 (2012).
  4. Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell. 139, 871-890 (2009).
  5. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. The Journal of clinical investigation. 119, 1420-1428 (2009).
  6. Forino, M., et al. TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture. International journal of experimental pathology. 87, 197-208 (2006).
  7. Yang, S., et al. Participation of miR-200 in pulmonary fibrosis. The American journal of pathology. 180, 484-493 (2012).
  8. Reynolds, H. Y. Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s. American journal of respiratory and critical care medicine. 171, 98-102 (2005).
  9. Camara, J., Jarai, G. Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha. Fibrogenesis & tissue repair. 3, 2 (2010).
  10. Kamitani, S., et al. Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells. International archives of allergy and immunology. 155, 119-128 (2011).
  11. Mikami, Y., et al. Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells. PloS one. 9, e114791 (2014).
  12. Yamauchi, Y., et al. Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1. Experimental lung research. 36, 12-24 (2010).
  13. Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. The Journal of cell biology. 124, 401-404 (1994).
  14. Ramos, C., et al. FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway . American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).
  15. Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition. Bioscience reports. 35, (2015).
  16. Brinkmann, V., Kinzel, B., Kristofic, C. TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype. Journal of immunology. 156, 4100-4106 (1996).
  17. Krug, M. S., Berger, S. L. First-strand cDNA synthesis primed with oligo(dT). Methods in enzymology. 152, 316-325 (1987).
  18. Morozumi, M., et al. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. Journal of clinical microbiology. 44, 1440-1446 (2006).
  19. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical biochemistry. 150, 76-85 (1985).
  20. Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation. Analytical biochemistry. 175, 231-237 (1988).
  21. Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. Electroblotting from polyacrylamide gels. Current protocols in protein science. Chapter 10, Unit 10.7 (2001).
  22. Kricka, L. J., Voyta, J. C., Bronstein, I. Chemiluminescent methods for detecting and quantitating enzyme activity. Methods in enzymology. 305, 370-390 (2000).
  23. Noguchi, S., et al. An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).
  24. Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT). Respiratory research. 6, 56 (2005).
  25. Chen, X., et al. Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling. The Journal of clinical investigation. 124, 3295-3310 (2014).
  26. Saito, A., et al. An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells. PloS one. 8, e56587 (2013).
  27. Dvashi, Z., et al. Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury. The American journal of pathology. 184, 2936-2950 (2014).
  28. Hallgren, O., et al. Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients. Journal of translational medicine. 10, 171 (2012).
  29. Kobayashi, T., et al. Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels. American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).
  30. Horie, M., et al. Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor. Experimental lung research. 40, 222-236 (2014).
  31. Kohyama, T., et al. PGD(2) modulates fibroblast-mediated native collagen gel contraction. American journal of respiratory cell and molecular biology. 27, 375-381 (2002).
  32. Muir, A. B., et al. Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research. 330, 102-110 (2015).
  33. Zhong, Q., et al. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein. American journal of respiratory cell and molecular biology. 45, 498-509 (2011).
  34. Liu, X. Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell motility and the cytoskeleton. 65, 935-944 (2008).
Desarrollo de una<em&gt; In Vitro</em&gt; Ensayo para evaluar la función contráctil de las células mesenquimales que la transición epitelio-mesenquimal Sufrió
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).More

Mikami, Y., Matsuzaki, H., Takeshima, H., Makita, K., Yamauchi, Y., Nagase, T. Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition. J. Vis. Exp. (112), e53974, doi:10.3791/53974 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter