Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Analyse de la ségrégation chromosomique, de l'acétone d'histone et de la morphologie de la broche dans les ovocytes

doi: 10.3791/55242 Published: May 11, 2017

Summary

Ce manuscrit décrit une approche expérimentale pour caractériser morphologiquement et biochimiquement les ovocytes à cheval. Plus précisément, le présent travail illustre comment recueillir des ovocytes à cheval immatures et matures par captage d'ovules guidé par ultrasons (OPU) et comment étudier la ségrégation des chromosomes, la morphologie de la broche, l'acétylation des histones mondiales et l'expression de l'ARNm.

Abstract

Le domaine de la procréation assistée a été développé pour traiter la stérilité chez les femmes, les animaux de compagnie et les espèces en voie de disparition. Dans le cheval, la reproduction assistée permet également la production d'embryons de haut niveau sans interrompre leur carrière sportive et contribue à une augmentation du nombre de poulains chez les juments de haute valeur génétique. Le présent manuscrit décrit les procédures utilisées pour la collecte d'ovocytes immatures et matures à partir d'ovaires à cheval utilisant un prélèvement d'ovule (OPU). Ces ovocytes ont ensuite été utilisés pour étudier l'incidence de l'aneuploïdie en adaptant un protocole préalablement développé chez la souris. Plus précisément, les chromosomes et les centromères des ovocytes de la métaphase II (MII) ont été marqués par fluorescence et comptés sur des plans focaux séquentiels après un balayage par microscope laser confocal. Cette analyse a révélé une incidence plus élevée dans le taux d'aneuploïdie lorsque des ovocytes immatures ont été recueillis à partir des follicules et ont été mûris in vitro par rapport àIn vivo. L'immunocoloration pour la tubuline et la forme acétylée d'histone quatre à des résidus spécifiques de lysine a également révélé des différences dans la morphologie de la broche méiotique et dans le schéma global de l'acétylation des histones. Enfin, l'expression d'ARNm codant pour les histone désacétylases (HDAC) et les acétyl-transferases (HAT) a été étudiée par transcription inverse et PCR quantitative (q-PCR). Aucune différence dans l'expression relative des transcrits n'a été observée entre les ovocytes matures in vitro et in vivo . En accord avec un silence général de l'activité de transcription pendant la maturation des ovocytes, l'analyse de la quantité de transcription totale ne peut révéler la stabilité ou la dégradation de l'ARNm. Par conséquent, ces résultats indiquent que d'autres réglementations translationnelles et post-traductionnelles pourraient être affectées.

Dans l'ensemble, la présente étude décrit une approche expérimentale pour caractériser morphologiquement et biochimiquement l'ovocyte du cheval, un ceLl est extrêmement difficile à étudier en raison de la faible disponibilité des échantillons. Cependant, il peut élargir nos connaissances sur la biologie de la reproduction et la stérilité dans les espèces monovulatrices.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Une vaste gamme de techniques de reproduction assistée a été développée pour traiter l'infertilité chez les femmes, les animaux de compagnie et les espèces en voie de disparition. L'une des procédures les plus courantes dans les milieux cliniques est la récupération des ovocytes de la métaphase II (MII) des follicules ovariens par aspiration transvaginale guidée par ultrasons, prélèvement d'ovule (OPU) 1 . Ces ovocytes sont ensuite fécondés in vitro (FIV), l'embryon (s) résultant (s) implanté (e) dans un utérus receveur. Les ovocytes de stade MII (matures) sont récupérés suite à l'administration de gonadotrophines exogènes. Cependant, ce traitement est associé, chez certains patients, au développement du syndrome d'hyperstimulation ovarienne (OHSS) 2 .

Prenant avantage de la capacité intrinsèque des ovocytes immatures (stade GV) pleinement développé à reprendre spontanément la méiose une fois isolée de leurs follicules, il est possible d'obtenir des ovocytes matures sans administrationLa gonadotrophine 3 . Cette procédure s'appelle la maturation in vitro des ovocytes (IVM) et représente une approche moins axée sur les médicaments, moins coûteuse et plus respectueuse du patient de la technologie de la reproduction assistée. Cependant, le succès du développement embryonnaire avec des ovocytes mûres in vitro est généralement inférieur à celui des ovocytes matures in vivo 4 , 5 . Une explication possible est que les ovocytes matures in vitro sont plus affectés par des erreurs dans la ségrégation chromosomique et l'aneuploïdie qui en résulte entrave le développement embryonnaire normal 6 .

La compréhension de la base moléculaire de la mauvaise séparation chromosomique pendant l'IVM révèlerait finalement le plein potentiel de cette technique. Dans cette optique, l'approche expérimentale utilisée pour étudier les caractéristiques morphologiques et biochimiques des ovocytes à matrice in vitro , par rapport à la matur in vivoLes ovocytes sont ici décrits 7 , 8 . Plus précisément, les procédures pour l'OPU des ovocytes immatures et mûres et l'IVM des ovocytes immatures sont illustrées à l'aide de chevaux adulte et naturellement cyclables en tant que modèle expérimental. Ensuite, l'immunofluorescence et l'analyse d'image sont utilisées pour étudier la ségrégation chromosomique, la morphologie de la broche et le modèle global d'acétylation des histones sur ces gamètes. Enfin, un protocole de transcription inverse et de PCR quantitative est décrit pour l'analyse de l'expression de l'ARNm.

Par rapport aux modèles animaux de rongeurs, les chevaux ne permettent pas la manipulation génétique, sont moins faciles à manipuler et nécessitent un entretien coûteux. Cependant, ce modèle prend un intérêt considérable pour l'étude de la maturation des ovocytes 9 , 10 en raison de la similarité avec la physiologie ovarienne humaine 11 , 12 </ Sup>. En outre, le développement de protocoles fiables de IVM-IVF dans le cheval a un intérêt économique substantiel, car il permettrait d'augmenter le nombre de poulains issus de juments de haute valeur génétique.

L'une des limites de l'exécution d'expériences sur les ovocytes, en particulier chez les espèces monovulatrices, est la disponibilité d'échantillon restreinte. Cette limite a été surmontée ici en ajustant une approche, précédemment développée chez la souris, aux ovocytes de chevaux 13 , 14 afin de mener le comptage des chromosomes qui minimise la perte d'échantillon (voir la discussion pour une comparaison avec d'autres techniques disponibles). En outre, un protocole de coloration à triple fluorescence a été optimisé pour effectuer des analyses multiples sur le même échantillon, et des analyses de q-PCR ont été réalisées uniquement sur des pools de 2 ovocytes.

Dans l'ensemble, la présente étude décrit une approche expérimentale visant à améliorer morphologiquement et biochimiquementRaccordez l'ovocyte du cheval, un type de cellule qui est extrêmement difficile à étudier en raison de la faible disponibilité de l'échantillon. Cependant, il peut étendre notre connaissance de la biologie de la reproduction et de la stérilité des espèces monovulatrices.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toutes les procédures ont été approuvées par le Comité de soins et d'utilisations des animaux CEEA Val de Loire numéro 19 et ont été réalisées conformément aux Principes directeurs pour la prise en charge et l'utilisation des animaux de laboratoire.

1. Collection d'ovocytes et maturation in vitro

  1. Prise d'ovule
    1. Évaluation quotidienne par échographie du diamètre des follicules ovariens dans une cohorte de juments adultes. À l'émergence d'un follicule ≥33 mm (follicule dominant), injecter la jument avec 1 500 UI de gonadotrophine chorionique humaine (hCG) dans la partie supérieure de la veine jugulaire (iv).
      1. Avant d'effectuer l'injection, tamponnez la zone avec de l'alcool, localisez le sillon de la joule et placez le pouce 2-3 cm sous le site d'injection pour amener la veine à augmenter. Insérez l'aiguille presque parallèlement au cou et aspirer pour s'assurer que l'aiguille est dans la veine (le sang entrera dans la seringue). À ce stade, injectez-vous; HCG va induire le mL'actualisation de l'ovocyte dans le follicule dominant.
    2. 35 h après l'injection de hCG, calient la jument avec de la detomidine (15 μg / kg, iv), du tartrate de butorphanol (10 μg / kg, iv) et du bromure de butylscopolamine (0,2-0,3 mg / kg, 15 mL / mare, iv).
    3. Connectez l'aiguille à la sonde à ultrasons. Insérez la sonde ultrasonore par voie vaginale et maintenez l'ovarien transréctéralement pour faire face à la sonde ultrasonore. Demandez à un opérateur de manœuvrer l'aiguille et l'autre pour maintenir l'ovaire en place, avec le follicule face à la sonde à ultrasons . Début de l'ovaire avec le follicule dominant.
    4. Percer la paroi vaginale et la paroi du follicule dominant avec l'aiguille (les sondes à ultrasons pour OPU sont équipées d'un canal pour l'aiguille connectée à un système d'aspiration); Theneedle sera visible dans l'image échographique.
    5. Aspirer le fluide folliculaire dans un tube conique de 50 ml connecté au système d'aspiration. Verser le contenu de la coniqueTube dans une grande boîte de Petri et recherche le complexe cumulus-ovocytes (COC) en utilisant un stéréomicroscope.
    6. Étant donné que le COC n'est pas toujours récupéré avec le liquide folliculaire, rincer le follicule avec la solution saline tamponnée au phosphate modifiée par Dulbecco (DPBS) contenant 5 UI / mL d'héparinat à 37 ° C. Examiner le DPBS pour la présence de COC, comme décrit précédemment pour le fluide folliculaire à l'étape 1.1.5. Rincer plusieurs fois jusqu'à ce que le COC soit récupéré.
    7. Une fois que le COC du follicule dominant est récupéré, percer et rincer les follicules ≥ 5 et ≤ 25 mm, comme décrit pour le follicule dominant dans les étapes 1.1.3-1.1.4; Les follicules ≥ 5 et ≤25 n'expriment pas l'hormone lutéinisante / le récepteur de la choriogonadotropine (LHCGR) et, par conséquent, leurs ovocytes ne deviennent pas mûr en réponse à l'hCG et seront recueillis au stade GV (immature). Ne conservez que les COC avec plusieurs couches complètes de cellules cumulus et un ooplasme brun, finement granulé. Jeter les autres.
    8. À la fin de l'OPU, enJecte la jument avec la pénicilline benzylique 15 000 UI / animal pour prévenir l'infection.
    9. Maison la jument dans une étable calme et propre pendant au moins 2 h. Vérifiez les signes de sensibilisation en déterminant la position des oreilles, la réaction aux stimuli ( par exemple, le bruit) et la démarche avant de retourner la jument à la compagnie d'autres animaux.
  2. Mûrissement in vitro
    1. Le TCM199 tamponné par HEPES chaud (20 mM Hepes) complété par 1 790 UI / L d'héparine, 0,4% d'albumine de sérum bovin (BSA), de pénicilline et de streptomycine à 37 ° C. Préparez ce support à l'avance. Filtrer et stériliser à 4 ° C jusqu'à 6 mois.
    2. Préparer le milieu IVM en complétant le TCM199 tamponné au NaHC03 (25 mM de NaHC03) avec 50 ng / mL de facteur de croissance épidermique (EGF) et 20% de sérum de veau 7 . Utilisez le TCM199 tamponné avec du NaHCO 3 dans les 3 semaines suivant l'ouverture d'une nouvelle bouteille. Préparez l'EGF à l'avance en tant que stocks 100x, congéluez-le à -20 ° C, Et l'utiliser dans les 6 mois. Dispenser 500 μL dans les puits d'un plat à 4 puits et incuber dans de l'air humidifié avec 5% de CO 2 à 38,5 ° C pendant au moins 2 h.
    3. Après la récupération des COC des follicules ≥ 5 et ≤25 mm, les mettre dans une boîte de Petri (3,5 cm de diamètre) remplie de 2 mL de HEPES-TCM199. Déplacez les COC dans différentes zones du plat afin de laver les débris cellulaires.
    4. Transférer les COC au milieu IVM et incuber pendant 28 h dans de l'air humidifié avec 5% de CO 2 à 38,5 ° C.

2. Immunofluorescence et analyse d'image

  1. Nombre de chromosomes
    1. Après la collecte du follicule dominant ou à la fin de l'IVM, incuber les COC avec 100 μM de monastrol pendant 1 h dans de l'air humidifié avec 5% de CO 2 à 38,5 ° C. Préparez monastrol à l'avance en tant que 100x stocks et rangez-le à -20 ° C pour un maximum de 1 an.
    2. Supprimer les cellules cumulusEn les traitant avec 0,5% d'hyaluronidase ou par pipettage doux; Élimine la zone pelucheuse en la traitant avec une pronase de 0,2%. Préparer la hyaluronidase et pronase à l'avance en 10x et stocker à -20 ° C pendant 1 an.
    3. Fixer les ovocytes dans du paraformaldéhyde à 4% dans du DPBS pendant 15 minutes à 38,5 ° C, puis encore 45 minutes à 4 ° C.
      MISE EN GARDE! Portez un équipement de protection individuelle lors de la manipulation du paraformaldéhyde et éliminez les matériaux contaminés conformément aux directives d'élimination des déchets dangereux.
    4. Laver les ovocytes en transférant séquentiellement dans 3 puits remplis de 500 μl de DPBS additionnés de 0,1% d'alcool polyvinylique (PVA). Perméabiliser dans 0,3% de Triton X-100 pendant 10 min à température ambiante (RT).
    5. Bloquer la liaison non spécifique par incubation dans du DPBS supplémenté avec 1% d'albumine de sérum bovin (DPBS-1% BSA) et 10% de sérum d'âne normal pendant au moins 30 minutes à la RT. Les échantillons peuvent être conservés en solution de blocage à 4 ° C pendant 3 à 4 jours.
    6. Pour la coloration primaire, incuber les ovocytes chez le lapin anti-Aurora B phospho-Thr232 dans du DPBS additionné de 1% de BSA (dilution 1:50) à 4 ° C pendant une nuit.
    7. Lavez les ovocytes comme décrit à l'étape 2.1.4. Incuber les ovocytes dans une solution d'IgG anti-lapin conjuguée à l'isothiocyanate de tétra-méthylrhodamine (TRITC) (1: 100 dans DPBS-1% BSA) pendant 1 h à la RT dans l'obscurité.
    8. Lavez les ovocytes comme décrit à l'étape 2.1.4, puis placez 3-4 ovocytes dans une goutte de support de non-durcissement, anti-décoloré, complété par 20 μM de YOPRO1 sur une glissière en verre. Répétez la procédure jusqu'à ce que tous les ovocytes soient montés (3-4 ovocytes par lame).
    9. Laisser reposer les ovocytes pendant environ 10 min dans le support de montage, puis les couvrir avec une lamelle. Pour éviter d'écraser les ovocytes, appliquez deux bandes de ruban adhésif double face avant de poser la lamelle sur la glissière en verre.
      REMARQUE: Cette précaution garantira également que tous les échantillons sont également comprimés entre le verreDe et la lamelle couvre-chef. Les glissières en verre peuvent être congelées à -20 ° C et imagées pendant les 2-3 jours suivants.
    10. Image des échantillons sur un microscope à balayage laser confocal avec un objectif 60X en utilisant les canaux rouge (centromère) et vert (chromosomes) 7 , 13 , 14 , 20 , 21 . Numérisez les échantillons couvrant l'ensemble de la plaque métaphasique sur l'axe des z, avec des étapes toutes les 0,35 μm. Enregistrez les images numérisées de chaque plan.
    11. Comptez les centromères dans les sections confocales en série à l'aide de la fonction de comptage cellulaire du logiciel NIH ImageJ (disponible à: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      REMARQUE: Évitez un nombre répété de centromères qui apparaissent sur les sections adjacentes en identifiant les centromères qui apparaissent, restent et disparaissent dans des sections séquentielles avec un code numérique.
    12. Répétez la co chromosomiqueDébutant à l'étape 2.1.11 avec un opérateur indépendant.
      NOTE: Classer les ovocytes comme euploïde (32 chromosomes), hyperploïdes (> 32) ou hypoploïdes (<32).
  2. La morphologie de la broche et l'acétylation des histones
    1. Après la collecte du follicule dominant ou à la fin de l'IVM, éliminer les cellules cumulus par traitement dans 0,5% d'hyaluronidase ou par pipettage doux, comme décrit à l'étape 2.1.2.
    2. Laver les ovocytes dans le DPBS-PVA, comme à la étape 2.1.4, et les réparer dans du paraformaldéhyde à 2,5% pendant 20 minutes à 38 ° C. Lavage extensif, comme décrit dans la étape 2.1.4, et perméabiliser dans 0,1% de Triton X-100 pendant 5 min à la RT.
      REMARQUE: Portez un équipement de protection individuelle lors de la manipulation du paraformaldéhyde et éliminez les matériaux contaminés conformément aux directives d'élimination des déchets dangereux.
    3. Bloquer la liaison non spécifique par incubation dans du DPBS supplémenté avec 2% d'albumine de sérum bovin (DPBS - 2% BSA), 0,05% de saponine et 10% de sérum d'âne normal pourR 2 h à la RT.
      REMARQUE: Les échantillons peuvent être conservés dans une solution de blocage à 4 ° C pendant 3 à 4 jours.
    4. Pour la coloration primaire, incuber les ovocytes dans l'anti-alpha-tubuline de souris (1: 150) et le lapin anti-acH4K16 (1: 250) dans du DPBS-2% de BSA avec 0,05% de saponine à 4 ° C pendant une nuit.
    5. Lavez les ovocytes à l'étape 2.1.4. Incuber les ovocytes dans une solution d'IgG anti-souris anti-souris (1: 500) et d'IgG conjuguée à un colorant fluorescent vert (1: 500) et IgG anti-lapin conjuguée à TRITC (1: 100) dans de la BSA à DPBS-2% avec 0,05% de saponine pendant 1 h à RT dans l'obscurité.
    6. Laver les ovocytes comme à la étape 2.1.4, puis placer 3-4 ovocytes dans une goutte du milieu de montage non durcissant, anti-fade supplémenté avec 1 μg / mL 4 ', 6-diamidino-2-phénylindole (DAPI) Sur une glissière en verre.
    7. Monter les ovocytes sur les lames de verre comme décrit à l'étape 2.1.8.
    8. Image des échantillons sur un microscope à balayage laser confocal avec un objectif 60x en utilisant les canaux rouge (acH4K16), vert (alpha-tubuline) et bleu (ADN).
      REMARQUE: conservez les réglages laser pour les canaux rouge et bleu pendant toute l'acquisition de tous les échantillons. Numérisez les échantillons couvrant toute la broche méiotique et la plaque métaphasique sur l'axe z, avec des étapes toutes les 0,35 μm. Enregistrez les images numérisées (plans simples et image 3D projetée).
    9. Mesurez la longueur de la broche de pôle à pignon et le diamètre de la broche à la largeur maximale de l'image projetée à l'aide de la fonction de mesure du logiciel NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Répétez chaque fois 3 fois et calculez la moyenne.
    10. Quantifier la fluorescence relative d'acH4K16 en utilisant la fonction de densité intégrée du logiciel NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normalisez-le pour la densité intégrée de la coloration DAPI.

3. Analyse de l'expression de l'ARNm

  1. Une fois que les COC ont été récupérés à partir des follicules de 5 à 25 mm, collecter la cellule granulosa sLa suspension usée qui est restée dans la boîte de Petri et la lave deux fois en DPBS froid en centrifugant à 10 600 xg pendant 2 min. Geler instantanément dans l'azote liquide. Conservez les échantillons à -80 ° C pendant jusqu'à 6 mois; Les cellules serviront pour la courbe standard.
  2. Supprimez soigneusement toutes les cellules cumulus, comme décrit à l'étape 2.1.2, à partir d'ovocytes mûrs (MV) immatures (GV), mûrs in vitro et in vivo .
  3. Lavez les ovocytes, comme décrit dans 2.1.4, dans DPBS-PVA, collectez-les individuellement dans des volumes de 1 μL et pose 2 μL de RNALater sur le dessus. Gel instantané à l'azote liquide. Conservez les échantillons à -80 ° C pendant jusqu'à 6 mois.
  4. Ajouter 2 pg d'ARN de Luciferase à chaque échantillon comme piquante . Collez les ovocytes 2 x 2 et extrayez l'ARN total en utilisant un kit à base de filtre à membrane de silice approprié pour récupérer l'ARN à partir de petits échantillons.
  5. Inverser la transcription de l'ARN dans 10 μL avec 0,25 μg d'hexamères aléatoires et la transcriptase inverse du virus de la leucémie Moloney de souris pendant 1 h à 37 ° C 176; C. Conservez les échantillons à -20 ° C pendant jusqu'à 6 mois.
  6. Diluer l'ADNc des cellules de granulosa dans de l'eau sans ARNase à 50 ng / μL. Diluer en série cette solution 1:10 pour obtenir des solutions de 5 ng / μL, 0,5 ng / μL, 0,05 ng / μL et 0,005 ng / μL.
  7. Assembler les réactions par triplé dans un volume total de 20 μL par réaction en utilisant un ADNc équivalent à 0,05 oocytes comme substrat, soit 5 μL des dilutions en série de l'ADNc de la cellule granulosa, 10 μL de supermix vert SYBR et 0,3 μM de chaque amorce spécifique ( Tableau 1 ).
  8. Exécuter la réaction dans un thermocycleur en utilisant un protocole en 3 étapes: 95 ° C pendant 30 s, 60 ° C pendant 30 s et 72 ° C pendant 20 s, répétés 40 fois. Enfin, acquérir la courbe de fusion, à partir de 60 ° C, et augmenter la température de 0,5 ° C toutes les 20 s jusqu'à 95 ° C.
  9. Évaluer la quantité de départ (SQ) de l'ARNm spécifique dans les échantillons d'ovocytes en utilisant la courbe standardF "> 15 calculé sur la base de l'échantillon de cellules de granulosa. Exprimez les données en tant que rapport entre le SQ du gène d'intérêt et le SQ des gènes de ménage.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les résultats originaux de ces expériences ont été décrits en profondeur précédemment 7 et sont présentés ici comme un exemple de résultats qui peuvent être obtenus en utilisant les protocoles décrits.

Taux de maturation

Sur les 32 COC récupérés par OPU à partir des follicules dominants, 28 (88%) étaient au stade MII. Quatorze des 58 COC collectés à partir de follicules de 5 à 25 mm ont été immédiatement congelés comme des ovocytes immatures pour l'étude de l'expression de l'ARNm. Les 44 autres ont été mûr in vitro et 37 ont atteint le stade MII (85%). L'efficacité de la maturation n'a pas été significativement différente dans les deux groupes (test exact de Fisher P> 0,05).

Taux d'aneuploidie

Afin d'étudier si IVM caN perturbe le partage chromosomique fidèle entre l'ovocyte secondaire et le premier corps polaire, le nombre de chromosomes au stade MII a été compté, car il représente le résultat de la ségrégation chromosomique pendant la méiose I. Comme le montre la figure 1A , l'anti-Aurora B L'anticorps phospho-Thr232 a spécifiquement coloré la région centromère dans les ovocytes à cheval, permettant de compter le nombre de chromosomes. Les ovocytes matures in vitro ont été significativement plus affectés par l'aneuploïdie (5/11) par rapport aux ovocytes matures in vivo (0/12; test exact de Fisher, P <0,05; figure 1B ). La plupart des ovocytes aneuploïdes (4/5) étaient hyperploïdes; Par conséquent, le taux d'aneuploïdie ne résulte pas des artefacts dans la préparation de l'échantillon déterminant la perte chromosomique, comme c'est le cas avec les spreads chromosomiques. L'immunocoloration de la région centromérique a également été tentée avec les anticorps anti-CENPA et anti-AURKB, mais aucun signal n'était vis à visDans les deux cas (données non présentées).

La morphologie de broche et l'acétylation de H4K16

La longueur de la broche de pôle à pôle et le diamètre de la broche à la largeur maximale ont été mesurés, comme illustré à la figure 2 . Selon ces mesures, les ovocytes matures in vitro étaient significativement plus longs (19,89 ± 1,15 μm) et plus larges (17,28 ± 0,81 μm) par rapport aux ovocytes mûrs in vivo (14,57 ± 1,7 μm de longueur et 13,56 ± 0,91 μm de diamètre; T non appariés -test, P <0,05). Sur les mêmes échantillons, le niveau global d'acétylation de H4K16 a également été mesuré, ce qui confirme que l'acétylation au H4K16 était significativement plus faible chez les ovocytes IVM par rapport à leurs homologues in vivo ( Figure 2 , rouge).

Expression de tranScripts codant pour les histone acétyltransférases et les désacétyleses

L'identification des gènes impliqués dans le processus d'acétylation-désacétylation des histones a été modifiée dans les ovocytes à matrice in vitro qui a été étudiée par la q-PCR. L'histone acétyl-transférase 1 ( HAT1 ), la K-acétyltransférase 8 (KAT8 ), l'histone désacétylase 1 ( HDAC1 ) et la protéine déacétylase dépendante de NAD sirctine 1 ( SIRT1 ) ont été identifiées comme des cibles putatives. Des différences significatives dans l'expression de ces transcrits chez les ovocytes matures immatures, in vitro , matures et in vivo n'ont pas été observées, indépendamment de la normalisation utilisée. Plus précisément, les résultats de l'analyse de l'expression de la transcription rapportée à la figure 3 ont été calculés par rapport à une courbe standard en utilisant la méthode SQ et normalisés pour le ménage de la glycéraldéhyde-3-phosphate déshydrogénase ( GAPDH ). De même, aucune différenceDes rences ont été observées lorsque les résultats ont été normalisés pour la pointe de la luciférase ou lorsque la méthode ΔΔct a été utilisée (non représentée).

Cible Primaire Fw Primaire Rv Taille d'Amplicon
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 pb
HAT1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 pb
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 pb
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 pb
Luciferase TCATTCTTCGCCAAAAGCACTCTG D> AGCCCATATCCTTGTCGTATCCC 148 pb
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 pb

Tableau 1: Primer Setails. La séquence 5 '> 3' des amorces avant (Fw) et (Rv) et la taille d'amplicon attendue sont données pour chaque transcription analysée: glycéraldéhyde-3-phosphate déshydrogénase ( GAPDH ) , histone acétyl-transférase 1 ( HAT1 ) , histone De la désacétylase 1 ( HDAC1 ) , de la K-acétyltransférase 8 ( KAT8 ) , de la luciférase et de la protéine déacétylase dépendante de NAD Sirtuin 1 ( SIRT1 ). Reproduit avec l'autorisation de la référence 7 .

/55242fig1.jpg "/>
Figure 1: Taux d' aneuploïdie chez les ovocytes à cheval mature et in vitro . ( A ) Images représentatives montrant la coloration aurora B phospho-Thr232 (rouge) et l'ADN (vert) d'un ovocyte à cheval de stade MII traité avec monastrol. Un ovocyte euploïde (32 chromosomes) est présenté. Barre d'échelle = 5 μm. ( B ) Le graphique à barres représente la distribution des ovocytes euploïdes et aneuploïdes MII dans les ovocytes matures in vivo (n = 12) et in vitro (n = 11). * Indique une différence significative dans le taux d'aneuploïdie (test exact de Fisher, P <0,05). Réimprimé avec l'autorisation de la référence 7. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2 Figure 2: Mesure de la broche et acétylation H4K16 dans les ovocytes à cheval in vitro et in vitro . Des images représentatives représentant la tubuline (verte), le H4K16 acétylé (rouge) et l'ADN (bleu) dans les ovocytes MII après la maturation in vivo (n = 4) ou in vitro (n = 14). Les images tubulines montrent les axes utilisés pour la longueur de la broche et les mesures du diamètre. Barre d'échelle = 5 μm. Modifié à partir de la référence 7 . Cliquez ici pour voir une version plus grande de ce chiffre.

figure 3
Figure 3: Expression de KAT8 , SIRT1 , HAT1 , Et HDAC1 à ImmatuRe, In Vivo , Et les ovocytes mûres in vitro . Les graphiques à barres représentent la moyenne ± SEM de l'expression relative d'ARNm de KAT8 , SIRT1 , HAT1 , Et HDAC1 , Exprimé en quantité de départ (SQ) de la transcription d'intérêt par rapport à la SQ de GAPDH , utilisé comme ménage. Aucune différence statistique n'a été observée chez les ovocytes mûrs (ANOVA à sens unique, P > 0,05) immatures (GV, n = 14), in vivo (n = 14) et in vitro (n = 12). Reproduit avec l'autorisation de la référence 7 . Cliquez ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Même si la MIV a été réalisée chez les chevaux depuis plus de 20 ans 16 , nous ne savons pas encore si l'ovocyte peut être l'origine de l'aneuploïdie embryonnaire, comme cela a été proposé pour l'homme 17 . La raison en est probablement que la préparation de spreads d'ovocytes pour le comptage des chromosomes entraîne une perte d'échantillon considérable. Dans cet esprit, une enquête sur les méthodes utilisées pour enquêter sur les erreurs dans la ségrégation des chromosomes a été menée pour rechercher la technique la plus appropriée à appliquer aux ovocytes à cheval. Quatre techniques principales ont été trouvées dans la littérature scientifique: 1) spores chromosomiques 5 , 18 , 19 , 2) hybridation in situ fluorescente (FISH) 4 , 6 , 17 , 20 , 3) nombre de centromères sur des broches effondrées à monastrol , 14 , 21 , 22 et 4) coloration par fluorescence chromosomique sans nombre de chromosomes 23 , 24 , 25 .

Comme nous l'avons déjà mentionné, la préparation de spreads chromosomiques suivie d'une coloration au Giemsa est compliquée par un taux élevé de perte d'échantillon. Cette méthode a été remplacée dans de nombreux cas par FISH, qui utilise des sondes spécifiques pour cartographier différents chromosomes. Un inconvénient des techniques FISH est que lorsque l'on utilise un petit nombre de sondes, l'incidence d'un faux négatif peut augmenter ( c.-à-d., Identifiant comme étant normal une cellule aneuploïde car le chromosome disparu ou surnuméraire n'a pas été sondé). L'utilisation fiable de FISH est donc largement basée sur la connaissance a priori des chromosomes qui sont plus fréquemment affectés par une aneuploïdie ( p. Ex.., Chromosome 21 chez l'homme). FISH a déjà été utilisé pour étudier les anomalies chromosomiques dans les embryons de cheval en utilisant 2 sondes, contre le chromosome 2 et le chromosome 4 20 . Selon ces expériences, les noyaux d'embryons produits in vitro sont plus susceptibles d'être affectés par des anomalies chromosomiques que les embryons produits in vivo . Cette constatation est en accord avec l'observation rapportée ci-dessus en utilisant la méthode de collapsus monastrol dans les ovocytes IVM. Cependant, l'incidence de l'aneuploïdie dans les ovocytes IVM était encore plus élevée que celle rapportée en utilisant du FISH dans des embryons produits par in vitro 20 . Cet écart partiel s'explique par le fait que seules deux sondes spécifiques au chromosome ont été utilisées pour les expériences FISH. Cette approche pourrait avoir sous-estimé l'incidence de l'aneuploïdie impliquant d'autres chromosomes, surtout si l'on considère que les chevaux ont 32 chromosomes. Cependant, il ne peut être exclu que l'aneu graveLes piétons détectés dans les ovocytes ne sont pas maintenus dans les embryons car les gamètes affectés par des anomalies génétiques critiques pourraient ne pas se développer davantage.

La combinaison du traitement par monastrol, la coloration au chromosome et au centromère et la microscopie confocale ont permis de compter uniformément le nombre de chromosomes dans les ovocytes à cheval de stade MII avec une perte minimale d'échantillon. La limitation technique rencontrée dans le développement de cette technique pour les ovocytes à cheval était la disponibilité d'anticorps spécifiques au cheval. Avant d'utiliser Aurora B phospho- (Thr232), deux autres anticorps (anti-Aurora B et anti-CENPA) n'ont pas produit une coloration centromère. Notamment, anti-Aurora B et anti-CENPA ont déjà été utilisés avec succès dans les cellules bovines et humaines 26 , 27 , 28 ; Par conséquent, on a conclu qu'ils n'étaient pas spécifiques au cheval. Cette technique peut également être limitée par la disponibilité d'un laser laser confocalMicroscope et logiciel d'analyse d'image. En outre, le comptage aveugle par deux opérateurs indépendants est essentiel pour exclure les artefacts induits par l'opérateur. Même si le nombre chromosomique d'une broche à effondrement monastrol est une approche qui préserve mieux la morphologie de la cellule et empêche la perte d'échantillon, cette technique permet seulement d'observer des différences dans le nombre basique de chromosomes; Il n'est pas informatif sur d'autres anomalies chromosomiques ( p. Ex., Translocations, échanges segmentaires, etc. ) qui peuvent être révélés par le caryotypage et, dans certains cas, par FISH.

Des erreurs dans la ségrégation chromosomique ont également été étudiées par immunofluorescence de broche et chromosome, sans effectuer un compte chromosomique 23 , 24 , 25 . Dans ce cas, des fuseaux avec des anomalies sévères et des chromosomes en retard ou dispersés sont considérés comme des signes de chromosomes erratiquesMoi ségrégation. En conséquence, les chromosomes qui ont été dispersés hors de la broche ont été observés dans les ovocytes matures in vitro 7 (la classe qui est plus susceptible d'être affectée par une aneuploïdie). Cependant, le comptage chromosomique présente l'avantage de transmettre des informations quantifiables.

En résumé, par rapport aux autres techniques décrites, l'utilisation de la coloration au monastrol et au centromère présente l'avantage de prévenir la perte d'échantillon, de minimiser l'incidence de faux négatifs et d'être quantifiable.

L'altération des modifications épigénétiques a été proposée comme un mécanisme possible lors du début de l'aneuploïdie des ovocytes 18 , 24 , 25 . En utilisant une triple coloration fluorescente, il était possible de visualiser et de mesurer la broche méiotique et d'observer des chromosomes retardés / dispersés. Dans le même temps, grâce au développement d'anticorps quiReconnaître les modifications spécifiques des résidus, le niveau d'acétylation de H4K16 a été effectué sur le même échantillon. Cette approche a eu pour double objectif de réduire la quantité d'ovocytes nécessaire à l'analyse et de corréler l'acétylation H4 avec la morphologie de la broche.

La quantification des modifications de protéines covalentes peut être effectuée par Western Blot. Cependant, cette technique nécessite une plus grande taille d'échantillons et ne conserve pas l'intégrité de l'échantillon pour les études morphologiques. L'approche de coloration à triple fluorescence peut être appliquée à d'autres modifications d'histones et, potentiellement, à toute protéine qui peut être reconnue par différents anticorps secondaires 8 ; Le seul facteur limitant est la disponibilité d'anticorps spécifiques au cheval. Dans ce contexte, les auteurs espèrent que l'attention portée au modèle du cheval augmentera l'intérêt pour l'étude des mécanismes biologiques de base dans cette espèce et, par conséquent, dans le développementD'outils dédiés.

Enfin, l'étude de l'expression des ARNm codant pour les histone désacétylases (HDAC) et les acétyl-transferases (HAT) menées par transcription inverse et PCR quantitative (q-PCR) est également décrite. La q-PCR est une technique largement répandue; Cependant, son utilisation pour les ovocytes à cheval n'est pas diffuse. Il est essentiel de préciser que, en raison du silence général de l'activité transcriptionnelle pendant la maturation des ovocytes 29 , l'analyse de la quantité de transcription totale ne peut révéler la stabilité ou la dégradation de l'ARNm dans cet arrière-plan 30 , 31 . Les différences dans l'expression relative des transcrits entre la maturation in vitro et in vivo n'ont pas été observées. Ces résultats indiquent que la traduction et la traduction post-traductionnelle pourraient être affectés par IVM, en soulignant la nécessité de développer d'autres approches expérimentales visant à enquêter sur les traductions et les traductionsLes mécanismes de la st-traduction au niveau de la cellule unique.

Dans l'ensemble, la présente étude décrit une approche expérimentale pour caractériser morphologiquement et biochimiquement les ovocytes à cheval. Cette approche peut être appliquée aux ovocytes d'autres espèces qui sont également affectés par un faible taux de récupération, y compris les humains ou les espèces en voie de disparition. Ces études élargiront notre connaissance de la biologie de la reproduction des mammifères et contribueront à notre compréhension de la stérilité.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Les auteurs souhaitent remercier Fabrice Vincent pour le support avec la microscopie confocale à laser (LSCM) , et Philippe Barrière et Thierry Blard pour l'analyse quotidienne des ultrasons et l'injection de hCG. Ce travail a été soutenu en partie par le projet «Ex Ovo Omnia» de Regione Sardegna and Regione Lombardia (Subvention n ° 26096200 à AML); La bourse "L'Oreal Italie par le Donne et la Scienza 2012" (contrat 2012 à FF), FP7-PEOPLE-2011- CIG, Agence de recherche et de recherche (REA) "Pro-Ovum" (Subvention n ° 303640 à VL); Et par l'École postdoctorale d'agriculture et de médecine vétérinaire, cofinancée par le Fonds social européen, Programme opérationnel sectoriel pour le développement des ressources humaines 2007-2013 (numéro de contrat POSDRU / 89 / 1.5 / S / 62371 à la messagerie instantanée). La collecte ovocyte in vivo a été financée par l'Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analyse de la ségrégation chromosomique, de l&#39;acétone d&#39;histone et de la morphologie de la broche dans les ovocytes
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter