Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Análise da segregação cromossômica, acetilação de histona e morfologia do fuso em ovócitos de cavalo

doi: 10.3791/55242 Published: May 11, 2017

Summary

Este manuscrito descreve uma abordagem experimental para caracterizar morfologicamente e bioquimicamente ovócitos de cavalo. Especificamente, o presente trabalho ilustra como recolher ovócitos de equídeos imaturos e maduros por captação de óvulos guiados por ultra-som (OPU) e como investigar a segregação cromossómica, a morfologia do fuso, a acetilação das histonas globais ea expressão de mRNA.

Abstract

O campo da reprodução assistida tem sido desenvolvido para tratar a infertilidade em mulheres, animais de companhia e espécies ameaçadas. No cavalo, a reprodução assistida também permite a produção de embriões de alto desempenho sem interromper sua carreira esportiva e contribui para um aumento no número de potros de éguas de alto valor genético. O presente manuscrito descreve os procedimentos utilizados para a coleta de ovócitos imaturos e maduros de ovários de cavalo usando o coletor de óvulos (OPU). Estes oócitos foram então utilizados para investigar a incidência de aneuploidia através da adaptação de um protocolo previamente desenvolvido em ratinhos. Especificamente, os cromossomos e os centrómeros dos oócitos da metafase II (MII) foram marcados fluorescentemente e contados em planos focais sequenciais após varrimento de microscópio confocal a laser. Esta análise revelou uma incidência mais elevada na taxa de aneuploidia quando os oócitos imaturos foram recolhidos dos folículos e maturados in vitro em comparação comIn vivo. A imunocoloração para a tubulina ea forma acetilada da histona quatro em resíduos de lisina específicos também revelaram diferenças na morfologia do fuso meiótico e no padrão global de acetilação das histonas. Por fim, investigou-se a expressão de mRNAs que codificam histonas desacetilases (HDAC) e acetil-transferases (HATs) por transcrição reversa e PCR quantitativa (q-PCR). Não foram observadas diferenças na expressão relativa dos transcritos entre oócitos maturados in vitro e in vivo . De acordo com um silenciamento geral da actividade transcricional durante a maturação do oócito, a análise da quantidade total de transcrição só pode revelar estabilidade ou degradação do ARNm. Portanto, esses achados indicam que outras regulamentações de translação e pós-tradução podem ser afetadas.

Em geral, o presente estudo descreve uma abordagem experimental para caracterizar morfologicamente e bioquimicamente o oócito de cavalo, a ceTipo que é extremamente desafiador para estudar devido à baixa disponibilidade da amostra. No entanto, pode expandir nossos conhecimentos sobre a biologia reprodutiva e infertilidade em espécies monovulatórias.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Uma vasta gama de técnicas de reprodução assistida foi desenvolvida para tratar a infertilidade em mulheres, animais de companhia e espécies ameaçadas de extinção. Um dos procedimentos mais comuns em contextos clínicos é a recuperação de oócitos da fase metafásica II (MII) dos folículos ovarianos por aspiração transvaginal guiada por ultrassom, captação de óvulos (OPU) 1 . Estes oócitos são então fertilizados in vitro (FIV), com o (s) embrião (s) resultante (s) implantado (s) num útero receptor. Os oócitos do estádio MII (maduro) são recuperados após a administração de gonadotropinas exógenas. No entanto, este tratamento está associado, em alguns pacientes, ao desenvolvimento da síndrome de hiperestimulação ovariana (OHSS) 2 .

Aproveitando a capacidade intrínseca de ovócitos inteiramente crescidos e imaturos (estágio GV) para retomar espontaneamente a meiose uma vez isolado de seus folículos, é possível obter oócitos maduros sem adminisGonadotropina 3 . Esse procedimento é chamado de maturação in vitro de oócitos (IVM) e representa uma abordagem menos voltada para o uso de drogas, menos dispendiosa e mais paciente para a tecnologia de reprodução assistida. No entanto, o sucesso do desenvolvimento embrionário com oócitos maturados in vitro é geralmente menor do que com os oócitos maturados in vivo 4 , 5 . Uma possível explicação é que os oócitos maturados in vitro são mais afetados por erros na segregação cromossômica, ea aneuploidia resultante prejudica o desenvolvimento embrionário normal 6 .

Compreender as bases moleculares da segregação cromossômica errada durante IVM acabaria por revelar o pleno potencial desta técnica. Nesta via, a abordagem experimental utilizada para investigar as características morfológicas e bioquímicas dos oócitos maturados in vitro , em comparação com a maturidade in vivoEd oócitos é aqui descrito 7 , 8 . Especificamente, os procedimentos para a OPU de oócitos imaturos e maduros e a IVM de oócitos imaturos são ilustrados usando cavalos adultos e de ciclismo natural como modelo experimental. Em seguida, a imunofluorescência e a análise de imagem são usadas para investigar a segregação cromossômica, a morfologia do fuso e o padrão global de acetilação das histonas nesses gametas. Finalmente, é descrito um protocolo de transcrição reversa e PCR quantitativa para a análise da expressão de mRNA.

Em comparação com modelos de animais roedores, os cavalos não permitem a manipulação genética, são menos fáceis de manipular e requerem manutenção cara. No entanto, este modelo está ganhando interesse considerável para o estudo da maturação do oócito 9,10 , devido à semelhança com a fisiologia ovariana humana 11 , 12 </ Sup>. Além disso, o desenvolvimento de protocolos confiáveis ​​de IVM-IVF no cavalo tem um interesse econômico substancial, pois permitiria um aumento no número de potros de éguas de alto valor genético.

Uma das limitações da realização de experiências em oócitos, especialmente em espécies monovulatórias, é a disponibilidade restrita de amostras. Este limite foi superado aqui ajustando uma abordagem, previamente desenvolvida em ratinhos, a ovócitos de cavalo 13 , 14 para conduzir a contagem de cromossomas que minimiza a perda de amostra (ver a discussão para uma comparação com outras técnicas disponíveis). Além disso, um protocolo de coloração com fluorescência tripla foi otimizado para realizar múltiplas análises na mesma amostra, e as análises de q-PCR foram realizadas em pools de 2 oócitos apenas.

Em termos globais, o presente estudo descreve uma abordagem experimental destinada a caracterizar morfologicamente eRacterizar o oócito de cavalo, um tipo de célula que é extremamente desafiador para estudar devido à baixa disponibilidade da amostra. No entanto, pode expandir o nosso conhecimento da biologia reprodutiva e infertilidade das espécies monovulatórias.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos os procedimentos foram aprovados pelo Comitê de Cuidados e Uso de Animais CEEA Val de Loire Número 19 e foram realizados de acordo com os Princípios Orientadores para o Cuidado e Uso de Animais de Laboratório.

1. Coleção de Oócitos e Maturação In Vitro

  1. Recolha de óvulos
    1. Avaliar diariamente por ultra-som o diâmetro dos folículos ovarianos em uma coorte de éguas adultas. No surgimento de um folículo ≥ 33 mm (folículo dominante), injete a égua com 1.500 UI de gonadotrofina coriônica humana (hCG) na parte superior da veia jugular (iv).
      1. Antes de realizar a injeção, esfregue a área com álcool, localize o sulco jugular e coloque o polegar 2-3 cm sob o local da injeção para induzir a veia a subir. Insira a agulha quase paralela ao pescoço e aspirar para certificar-se de que a agulha está na veia (o sangue vai entrar na seringa). Neste ponto, injete; HCG irá induzir a mAtuação do oócito no folículo dominante.
    2. 35 h após a injecção de hCG, sedar a égua com detomidina (15 μg / kg, iv), tartarato de butorfanol (10 μg / kg, iv) e brometo de butilscopolamina (0,2-0,3 mg / kg, 15 mL / égua, iv).
    3. Conecte a agulha à sonda de ultra-som. Insira a sonda de ultra-som vaginalmente e segure o ovário transrectalmente para fazer face à sonda de ultra-som. Instruir um operador a manobra da agulha eo outro para manter o ovário no lugar, com o folículo voltado para a sonda de ultra-som . Comece a partir do ovário com o folículo dominante.
    4. Punção da parede vaginal e da parede do folículo dominante com a agulha (sondas de ultra-som para OPU são equipadas com um canal para a agulha conectada a um sistema de sucção); Serão visíveis na imagem ecográfica.
    5. Aspirar o fluido folicular em um tubo cônico de 50 mL ligado ao sistema de sucção. Despeje o conteúdo doTubo em uma grande placa de Petri e procurar o complexo cumulus-oócito (COC) usando um estereomicroscópio.
    6. Uma vez que o COC nem sempre é recuperado com o fluido folicular, lave o folículo com solução salina tamponada com fosfato modificada (DPBS) de Dulbecco contendo 5 UI / mL de heparinato a 37 ° C. Examinar DPBS para COC presença, como descrito anteriormente para o fluido folicular no passo 1.1.5. Lave várias vezes até que o COC seja recuperado.
    7. Uma vez que o COC do folículo dominante é recuperado, perfure e lave os folículos ≥ 5 e ≤ 25 mm, conforme descrito para o folículo dominante nos passos 1.1.3-1.1.4; Os folículos ≥5 e ≤25 não expressam o receptor da hormona luteinizante / coriogonadotropina (LHCGR) e, portanto, seus oócitos não amadurecerão em resposta à hCG e serão coletados no estádio GV (imaturos). Apenas mantenha COCs com várias camadas completas de células de cumulus e ooplasma marrom finamente granulado. Descarte os outros.
    8. No final da OPU, emA égua com benzil-penicilina 15.000 UI / animal para prevenir a infecção.
    9. Casa da égua em uma calma, estábulo limpo, pelo menos, 2 h. Verifique os sinais de consciência, determinando a posição das orelhas, a reação aos estímulos ( por exemplo, o ruído) e marcha antes de retornar a égua para a companhia de outros animais.
  2. Maturação in vitro
    1. TCM199 tamponado com HEPES quente (Hepes 20 mM) suplementado com heparina de 1790 UI / L, albumina de soro bovino (BSA) a 0,4%, penicilina e estreptomicina a 37 ° C. Prepare este meio com antecedência. Filtrar-esterilizar e mantê-lo a 4 ° C por até 6 meses.
    2. Preparar o meio IVM suplementando NaHCO3 com tampão TCM199 (25 mM NaHCO3) com 50 ng / mL de factor de crescimento epidérmico (EGF) e 20% de soro de vitelo 7 . Use NaHCO 3 -buffered TCM199 dentro de 3 semanas de abrir um novo frasco. Preparar o FEG com antecedência como 100x estoques, congelá-lo a -20 ° C, E usá-lo dentro de 6 meses. Distribuir 500 μL nos poços de uma placa de 4 poços e incubar em ar humidificado com 5% de CO 2 a 38,5 ° C durante pelo menos 2 h.
    3. Após a recuperação dos COCs dos folículos ≥5 e ≤25 mm, coloque-os em uma placa de Petri (diâmetro de 3,5 cm) cheia com 2 mL de HEPES-TCM199. Mover os COCs para diferentes áreas do prato, a fim de lavar os detritos celulares.
    4. Transferir os COCs para o meio IVM e incubar durante 28 h em ar umidificado com 5% de CO 2 a 38,5 ° C.

2. Imunofluorescência e Análise de Imagem

  1. Contagem de cromossomos
    1. Após a coleta do folículo dominante ou no final da IVM, incubar os COCs com monastrol 100 μM durante 1 h em ar umidificado com 5% de CO2 a 38,5 ° C. Preparar antecipadamente o monastrol como 100x estoques e armazená-lo a -20 ° C por até 1 ano.
    2. Remova as células cumulusTratando-os com hialuronidase a 0,5% ou pipetando suavemente; Remover a zona pelúcida tratando-a em 0,2% de pronase. Preparar a hialuronidase e a pronase com antecedência como 10x estoques e armazená-los a -20 ° C por até 1 ano.
    3. Fixar os oócitos em paraformaldeído a 4% em DPBS durante 15 min a 38,5 ° C seguido por mais 45 min a 4 ° C.
      CUIDADO! Usar equipamento de proteção pessoal ao manusear o paraformaldeído e eliminar os materiais contaminados de acordo com as diretrizes de eliminação de resíduos perigosos.
    4. Lavar os oócitos por transferência sequencial em 3 poços cheios com 500 μL de DPBS suplementado com álcool polivinílico a 0,1% (PVA). Permeabilize em Triton X-100 a 0,3% durante 10 min à temperatura ambiente (RT).
    5. Bloqueia a ligação não específica por incubação em DPBS suplementado com albumina de soro bovino a 1% (DPBS-1% de BSA) e soro de burro normal a 10% durante pelo menos 30 min à RT. As amostras podem ser mantidas em solução de bloqueio a 4 ° C durante 3-4 dias.
    6. Para a coloração primária, incubar os oócitos em coelho anti-Aurora B fosfo-Thr232 em DPBS suplementado com 1% BSA (diluição 1:50) a 4 ° C durante a noite.
    7. Lavar os oócitos como descrito no passo 2.1.4. Incubar os oócitos numa solução de anti-IgG anti-coelho conjugado com isotiocianato de tetra-metilrhodamina (TRITC) (1: 100 em DPBS-1% BSA) durante 1 h à RT no escuro.
    8. Lavar os oócitos como descrito no passo 2.1.4 e, em seguida, colocar 3-4 oócitos numa gota de meio de montagem não endurecedor e anti-fade suplementado com YOPRO1 20 μM num vidro. Repita o procedimento até que todos os ovócitos estejam montados (3-4 oócitos por lâmina).
    9. Permitir que os oócitos para resolver por cerca de 10 min no meio de montagem e, em seguida, cobri-los com uma lamela. Para evitar o esmagamento dos oócitos, aplique duas tiras de fita dupla face antes de colocar a lamela na lâmina de vidro.
      NOTA: Esta precaução também assegurará que todas as amostras estejam igualmente comprimidas entre o vidro sliDe e a lamela. As lâminas de vidro podem ser congeladas a -20 ° C e fotografadas durante os 2-3 dias seguintes.
    10. Imagem das amostras em um microscópio confocal de varredura a laser com um objetivo de 60X usando os canais vermelho (centromeres) e verde (cromossomos) 7 , 13 , 14 , 20 , 21 . Digitalizar as amostras abrangendo toda a placa metafásica no eixo z, com passos cada 0,35 μm. Salve as imagens digitalizadas de cada plano.
    11. Contar os centromeres em seções confocal serial usando a função de contagem de células do software NIH ImageJ (disponível em: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      NOTA: Evite uma contagem repetida de centromeres que aparecem em seções adjacentes, identificando os centromeres que aparecem, permanecem e desaparecem em seqüências com um código numérico.
    12. Repita o cromossômico coUnindo no passo 2.1.11 com um operador independente.
      NOTA: Classifique os oócitos como euploides (32 cromossomos), hiperplóides (> 32) ou hipoplóides (<32).
  2. Morfologia do fuso e acetilação das histonas
    1. Após a coleta do folículo dominante ou no final da IVM, remover as células cumulus por tratamento em hialuronidase a 0,5% ou por pipetagem suave, conforme descrito no passo 2.1.2.
    2. Lavar os oócitos em DPBS-PVA, como no passo 2.1.4, e fixá-los em paraformaldeído a 2,5% durante 20 min a 38 ° C. Lavar extensivamente, tal como descrito no passo 2.1.4, e permeabilizar em 0,1% de Triton X-100 durante 5 min à TA.
      NOTA: Usar equipamento de proteção pessoal ao manusear o paraformaldeído e eliminar os materiais contaminados de acordo com as diretrizes de eliminação de resíduos perigosos.
    3. Bloqueia a ligação não específica por incubação em DPBS suplementado com 2% de albumina de soro bovino (DPBS - 2% de BSA), 0,05% de saponina e 10% de soro de burro normalR 2 h à TA.
      NOTA: As amostras podem ser mantidas em solução de bloqueio a 4 ° C durante 3-4 dias.
    4. Para a coloração primária, incubar os oócitos em anti-alfa-tubulina de ratinho (1: 150) e anti-acH4K16 de coelho (1: 250) em DPBS-2% BSA com 0,05% de saponina a 4 ° C durante a noite.
    5. Lave os oócitos como no passo 2.1.4. Incubar os oócitos numa solução de IgG anti-rato de burro conjugado com corante fluorescente verde (1: 500) e IgG anti-coelho conjugado com TRITC (1: 100) em DPBS-2% de BSA com 0,05% de saponina durante 1 h a RT no escuro.
    6. Lavar os oócitos como no passo 2.1.4 e, em seguida, colocar 3-4 oócitos numa gota do meio de montagem não endurecível e anti-fade suplementado com 1 μg / mL de 4 ', 6-diamidino-2-fenilindole (DAPI) Em uma lâmina de vidro.
    7. Monte os oócitos em lâminas de vidro como descrito no passo 2.1.8.
    8. Image as amostras em um microscópio confocal de varredura a laser com um objetivo 60x usando os canais vermelho (acH4K16), verde (alfa-tubulina) e azul (DNA).
      NOTA: Mantenha as configurações de laser para os canais vermelho e azul constantes durante a aquisição de todas as amostras. Digitalizar as amostras abrangendo todo o fuso meiótico e placa metafásica no eixo z, com passos cada 0,35 μm. Salve as imagens digitalizadas (planos únicos e imagem 3D projetada).
    9. Meça o comprimento do eixo do pólo a pólo e o diâmetro do fuso na largura máxima na imagem projetada usando a função de medição do software NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Repita cada 3 vezes e calcule a média.
    10. Quantifique a fluorescência relativa de acH4K16 usando a função de densidade integrada do software NIH ImageJ (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normalize-o para a densidade integrada da coloração DAPI.

3. Análise da Expressão de mRNA

  1. Depois de os COCs terem sido recuperados dos folículos de 5 a 25 mm, recolher as células da granulosa sQue permaneceu na placa de Petri e lavou-a duas vezes em DPBS frio por centrifugação a 10.600 xg durante 2 min. Snap congelar em azoto líquido. Armazenar as amostras a -80 ° C por até 6 meses; As células servirão para a curva padrão.
  2. Remova cuidadosamente todas as células cumulus, como descrito no passo 2.1.2, a partir de oócitos maduros (GV), maturados in vitro e in vivo .
  3. Lavar os oócitos, tal como descrito em 2.1.4, em DPBS-PVA, recolhê-los individualmente em volumes de 1 μL e colocar 2 μL de RNALater por cima. Snap-freeze em nitrogênio líquido. Armazenar as amostras a -80 ° C por até 6 meses.
  4. Adicionar 2 pg de RNA de luciferase a cada amostra como um pico-in. Juntar os oócitos 2 x 2 e extrair o RNA total utilizando um kit à base de filtro de membrana de sílica adequado para recuperar RNA de pequenas amostras.
  5. Reverse-transcrever o ARN em 10 μL com 0,25 μg de hexâmeros aleatórios e transcriptase reversa do vírus da leucemia Moloney de rato durante 1 h a 37 & # 176; C. Armazenar as amostras a -20 ° C por até 6 meses.
  6. Diluir o cDNA das células da granulosa em água isenta de RNAse para 50 ng / μL. Diluir seriamente esta solução 1:10 para obter soluções de 5 ng / μL, 0,5 ng / μL, 0,05 ng / μL e 0,005 ng / μL.
  7. Reúnam-se as reacções em triplicado num volume total de 20 μL por reacção utilizando ADNc equivalente a 0,05 oócitos como substrato, ou 5 μL das diluições em série de cDNA de células de granulosa, 10 μL de super-mistura SYBR verde e 0,3 μM de cada iniciador específico Tabela 1 ).
  8. Executar a reacção num ciclador térmico utilizando um protocolo de 3 passos: 95 ° C durante 30 s, 60 ° C durante 30 s, e 72 ° C durante 20 s, repetido 40 vezes. Finalmente, adquire a curva de fusão, a partir de 60 ° C, e aumente a temperatura em 0,5 ° C a cada 20 s até 95 ° C.
  9. Avaliar a quantidade inicial (SQ) do mRNA específico nas amostras de oócitos utilizando a curva padrãoF "> 15 calculado com base na amostra de células da granulosa Expressar os dados como a razão entre o SQ do gene de interesse eo SQ dos genes housekeeping.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

As descobertas originais destas experiências foram descritas em profundidade previamente 7 e são aqui relatadas como um exemplo de resultados que podem ser obtidos utilizando os protocolos descritos.

Taxa de maturação

Dos 32 COCs obtidos pela OPU dos folículos dominantes, 28 (88%) estavam na fase MII. Quatorze dos 58 COCs coletados de folículos de 5 a 25 mm de tamanho foram instantaneamente congelados como oócitos imaturos para o estudo de expressão de mRNA. Os 44 restantes foram maturados in vitro , e 37 atingiram o estádio MII (85%). A eficiência de maturação não foi significativamente diferente nos dois grupos (teste exato de Fisher P> 0,05).

Taxa de Aneuploidy

A fim de estudar se IVM caN, o número de cromossomos no estádio MII foi contado, pois representa o resultado da segregação cromossômica durante a meiose I. Conforme mostrado na Figura 1A , o anticorpo anti-Aurora B Fosfo-Thr232 corou especificamente a região centromérica em oócitos de cavalo, permitindo a contagem do número de cromossomas. Os oócitos maturados in vitro foram significativamente mais afetados pela aneuploidia (5/11) em comparação aos oócitos maturados in vivo (0/12, teste exato de Fisher, P <0,05, Figura 1B ). A maioria dos oócitos aneuplóides (4/5) eram hiperplóides; Portanto, a taxa de aneuploidia não resulta de artefatos na preparação da amostra que determina a perda cromossômica, como acontece com os spreads cromossômicos. A imunotintura da região centromérica também foi tentada com os anticorpos anti-CENPA e anti-AURKB, mas nenhum sinal foi visEm ambos os casos (dados não apresentados).

Morfologia do fuso e acetilação de H4K16

O comprimento do eixo do pólo ao pólo e o diâmetro do fuso na largura máxima foram medidos, conforme ilustrado na Figura 2 . De acordo com estas medições, os oócitos maturados in vitro foram significativamente mais longos (19,89 ± 1,15 μm) e mais largos (17,28 ± 0,81 μm) comparados com os oócitos maturados in vivo (14,57 ± 1,7 μm de comprimento e 13,56 ± 0,91 μm de diâmetro , P <0,05). Nas mesmas amostras, também foi medido o nível de acetilação global de H4K16, confirmando que a acetilação a H4K16 era significativamente menor em ovócitos IVM em comparação com os seus homólogos in vivo ( Figura 2 , vermelho).

Expressão de tranCodificação de histonas acetiltransferases e deacetilases

Se a expressão de genes envolvidos no processo de acetilação-desacetilação das histonas foi alterada em oócitos maturados in vitro foi investigada por q-PCR. A histona acetiltransferase 1 ( HAT1 ), a K-acetiltransferase 8 (KAT8 ), a histona desacetilase 1 ( HDAC1 ) e a proteína desacetilase sirtuina 1 ( SIRT1 ) dependente de NAD foram identificadas como alvos putativos. Não foram observadas diferenças significativas na expressão destes transcritos em oócitos imaturos, maturados in vitro e maturados in vivo , independentemente da normalização utilizada. Especificamente, os resultados da an�ise de express� de transcritos relatados na Figura 3 foram calculados contra uma curva padr� utilizando o m�odo SQ e normalizado para gliceralde�o-3-fosfato desidrogenase de manuten�o ( GAPDH ). Da mesma forma, nenhuma diferençaForam observadas quando os resultados foram normalizados para o pico em luciferase ou quando o método ΔΔct foi utilizado (não mostrado).

Alvo Fw primer Rv primer Tamanho do amplicão
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 pb
Hata1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 pb
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 pb
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 pb
Luciferase TCATTCTTCGCCAAAAGCACTCTG D AGCCCATATCCTTGTCGTATCCC 148 pb
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 pb

Tabela 1: Iniciador Setails. A sequ�cia 5 '> 3' dos iniciadores dianteiros (Fw) e (Rv) e o tamanho de amplic� esperado s� dadas para cada transcritos analisados: gliceralde�o-3-fosfato desidrogenase ( GAPDH ) , histona acetiltransferase 1 ( HAT1 ) , histona Desacetilase 1 ( HDAC1 ) , K-acetiltransferase 8 ( KAT8 ) , luciferase e proteína desacetilase sirtuina 1 ( SIRT1 ) dependente de NAD. Reproduzido com permissão da referência 7 .

/55242fig1.jpg "/>
Figura 1: Taxa de Aneuploidia em Oócitos de Cavalos Vivos e In Vitro- madurados. ( A ) Imagens representativas que mostram a aurora B fosfo-Thr232 (vermelho) e a coloração de ADN (verde) de um ovócito de cavalo de fase MII tratado com monastrol. Um ovócito euplóide (32 cromossomos) é mostrado. Barra de escala = 5 μm. ( B ) O gráfico de barras representa a distribuição dos oócitos euploides e aneuploides de estádio MII em oócitos maturados in vivo (n = 12) e in vitro (n = 11). * Indica uma diferença significativa na taxa de aneuploidia (teste exato de Fisher, P <0,05). Reproduzido com permissão da Referência 7. Clique aqui para ver uma versão maior desta figura.

Figura 2 Figura 2: Medição do Fuso e Acetilação de H4K16 em Ovócitos de Cavalos Vivos e In Vitro . Imagens representativas mostrando tubulina (verde), H4K16 acetilado (vermelho) e DNA (azul) em oócitos MII após maturação in vivo (n = 4) ou in vitro (n = 14). As imagens de tubulina mostram os eixos usados ​​para medições de comprimento e diâmetro do fuso. Barra de escala = 5 μm. Modificado a partir da referência 7 . Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Expressão de KAT8 , SIRT1 , HAT1 , E HDAC1 em ImmatuRe, In Vivo , E ovócitos maduros in vitro . Os gráficos de barras representam a média ± EPM da expressão relativa de mRNA de KAT8 , SIRT1 , HAT1 , E HDAC1 , Expressa como a quantidade inicial (SQ) da transcrição de interesse comparada com a SQ de GAPDH , usada como limpeza. Não foram observadas diferenças estatísticas entre ovócitos maduros (GV, n = 14), in vivo (n = 14) e in vitro (n = 12) (ANOVA unidirecional, P > 0,05). Reproduzido com permissão da referência 7 . Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Embora a IVM tenha sido realizada em cavalos há mais de 20 anos 16 , ainda não sabemos se o oócito pode ser a origem da aneuploidia embrionária, como tem sido proposto para os seres humanos 17 . A razão é provavelmente que a preparação de spreads de oócitos para contagem de cromossomos resulta em perda de amostra considerável. Com isto em mente, um levantamento dos métodos utilizados para investigar erros na segregação cromossômica foi conduzido para procurar a técnica mais adequada para aplicar a oócitos de cavalo. Quatro técnicas principais foram encontradas na literatura científica: 1) espalhamento cromossômico 5 , 18 , 19 , 2) hibridação fluorescente in situ (FISH) 4 , 6 , 17 , 20 , 3) centromero contar com fusos monastrol-colapsados , 13 , 14 , 21 , 22 e 4) coloração por fluorescência cromossômica sem contagem de cromossomos 23 , 24 , 25 .

Como já mencionado, a preparação de espalhamentos cromossómicos seguida pela coloração com Giemsa é complicada por uma elevada taxa de perda de amostra. Este método foi substituído em muitos casos por FISH, que usa sondas específicas para mapear cromossomos diferentes. Uma desvantagem das técnicas de FISH é que quando um pequeno número de sondas é usado, a incidência de um falso negativo pode aumentar ( isto é, identificar como normal uma célula que é aneuplóide porque o cromossomo ausente ou supernumerário não foi sondado). O uso confiável de FISH é, portanto, amplamente baseado no conhecimento a priori dos cromossomos que são mais freqüentemente afetados pela aneuploidia ( por exemplo,., Cromossoma 21 em seres humanos). FISH foi anteriormente utilizado para investigar anomalias cromossômicas em embriões de cavalo usando 2 sondas, contra cromossomo 2 e cromossomo 4 20 . De acordo com estas experiências, os núcleos de embriões produzidos in vitro são mais susceptíveis de serem afectados por anomalias cromossómicas do que os embriões produzidos in vivo . Este achado está de acordo com a observação acima relatada usando o método monastrol-colapso em ovócitos IVM. No entanto, a incidência de aneuploidia em ovócitos IVM foi ainda maior do que a relatada utilizando FISH em embriões produzidos in vitro 20 . Esta discrepância parcial pode ser explicada pelo fato de que apenas duas sondas cromossômicas específicas foram usadas para as experiências FISH. Essa abordagem pode ter subestimado a incidência de aneuploidia envolvendo outros cromossomos, especialmente quando se considera que os cavalos possuem 32 cromossomos. No entanto, não se pode excluir que aAs plóides detectáveis ​​nos oócitos não são mantidas nos embriões porque os gâmetas afectados por anomalias genéticas críticas podem não se desenvolver mais.

A combinação de tratamento com monastrol, coloração cromossômica e centromérica e microscopia confocal permitiu contagens consistentes do número de cromossomos em oócitos de equinos de estádio MII com perda mínima de amostra. A limitação técnica encontrada no desenvolvimento desta técnica para oócitos de cavalo foi a disponibilidade de anticorpos específicos de cavalos. Antes de utilizar Aurora B phospho- (Thr232), outros dois anticorpos (anti-Aurora B e anti-CENPA) não produziram manchas centroméricas. Notavelmente, anti-Aurora B e anti-CENPA já foram utilizados com sucesso em células bovinas e humanas 26 , 27 , 28 ; Portanto, concluiu-se que eles não eram específicos para o cavalo. Esta técnica também pode ser limitada pela disponibilidade de um laser confocal scUm microscópio e um software de análise de imagem. Além disso, a contagem de blinds por dois operadores independentes é essencial para excluir os artefatos induzidos pelo operador. Embora a contagem cromossômica de um fuso monastrol-colapsado seja uma abordagem que preserve melhor a morfologia da célula e evite a perda de amostra, esta técnica só permite a observação de diferenças no número básico de cromossomos; Não é informativo sobre outras anomalias cromossómicas ( por exemplo, translocações, intercâmbios segmentares, etc. ) que podem ser reveladas pela cariotipagem e, em alguns casos, pelo FISH.

Erros na segregação cromossômica também foram investigados por fuso e imunofluorescência cromossômica, sem realizar uma contagem cromossômica 23 , 24 , 25 . Neste caso, os fusos com anomalias graves e cromossomos retardados ou dispersos são considerados sinais de cromossoma erráticoSegregação. Consequentemente, os cromossomas que foram dispersos fora do fuso foram observados em oócitos maturados in vitro 7 (a classe que é mais provavelmente afectada pela aneuploidia). Contudo, a contagem cromossômica tem a vantagem de transmitir informações quantificáveis.

Em resumo, em comparação com as outras técnicas descritas, o uso da coloração com monastrol e centrómero tem a vantagem de evitar a perda de amostras, minimizar a incidência de falsos negativos e ser quantificável.

A alteração das modificações epigenéticas tem sido proposta como um possível mecanismo no início da aneuploidia do oócito 18 , 24 , 25 . Utilizando uma mancha tripla fluorescente, foi possível visualizar e medir o fuso meiótico e observar os cromossomos atrasados ​​/ dispersos. Ao mesmo tempo, graças ao desenvolvimento de anticorpos queReconhecer modificações de resíduo específicas, o nível de acetilação de H4K16 foi realizado na mesma amostra. Esta abordagem serviu para o duplo objectivo de reduzir a quantidade de oócitos necessários para a análise e correlacionar a acetilação de H4 com a morfologia do fuso.

A quantificação de modificações de proteínas covalentes pode ser realizada por Western blot. No entanto, esta técnica requer um maior tamanho das amostras e não preserva a integridade da amostra para estudos morfológicos. A abordagem de coloração tripla fluorescente pode ser aplicada a outras modificações de histonas e, potencialmente, a qualquer proteína que possa ser reconhecida por diferentes anticorpos secundários 8 ; O único fator limitante é a disponibilidade de anticorpos específicos de cavalos. Nesse contexto, os autores esperam que a atenção ao modelo cavalo aumente o interesse na investigação de mecanismos biológicos básicos nesta espécie e, portanto, no desenvolvimentoFerramentas dedicadas.

Por fim, descreve-se também o estudo de expressão de mRNAs que codificam histonas desacetilases (HDAC) e acetil-transferases (HATs) por transcrição reversa e PCR quantitativa (q-PCR). Q-PCR é uma técnica amplamente difundida; Entretanto, seu uso para oócitos de cavalo não é difuso. É essencial especificar que, devido ao silenciamento geral da atividade transcricional durante a maturação do oócito 29 , a análise da quantidade total do transcrito só pode revelar estabilidade ou degradação do ARNm nesse contexto 30 , 31 . Não foram observadas diferenças na expressão relativa dos transcritos entre maturação in vitro e in vivo . Estes achados indicam que as regulações translacionais e pós-traducionais podem ser afetadas pela IVM, ressaltando a necessidade de desenvolvimento de outras abordagens experimentais visando investigarSt-translacional mecanismos no nível de célula única.

Globalmente, o presente estudo descreve uma abordagem experimental para caracterizar morfologicamente e bioquimicamente ovócitos de cavalo. Esta abordagem pode ser aplicada a oócitos de outras espécies que são igualmente afectadas por uma taxa de recuperação baixa, incluindo seres humanos ou espécies ameaçadas de extinção. Estes estudos vão expandir o nosso conhecimento da biologia reprodutiva dos mamíferos e contribuirão para a nossa compreensão da infertilidade.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os autores gostariam de agradecer a Fabrice Vincent pelo suporte com microscopia confocal de varredura a laser (LSCM) e Philippe Barrière e Thierry Blard pela realização de exames de ultra-sonografia ovariana diária e injeção de hCG. Este trabalho foi apoiado em parte pelo projecto "Ex Ovo Omnia" (Concessão nº 26096200 à AML) "Regione Sardegna and Regione Lombardia"; (Contrato 2012 a FF), FP7-PEOPLE-2011- CIG, Agência de Execução de Investigação (REA) "Pro-Ovum" (subvenção n.º 303640 a VL); E pela Escola de Pós-Doutoramento em Agricultura e Medicina Veterinária, co-financiada pelo Fundo Social Europeu, Programa Operacional Sectorial para o Desenvolvimento de Recursos Humanos 2007-2013 (Contrato POSDRU / 89 / 1.5 / S / 62371 ao IM). A coleta de oócitos in vivo foi financiada pelo Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Análise da segregação cromossômica, acetilação de histona e morfologia do fuso em ovócitos de cavalo
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter