Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Analys av kromosomsegregation, histonacetylering och spindelmorfologi i hästocyter

doi: 10.3791/55242 Published: May 11, 2017

Summary

Detta manuskript beskriver ett experimentellt tillvägagångssätt för att morfologiskt och biokemiskt karakterisera hästocyter. Specifikt illustrerar föreliggande arbete hur man samlar omogena och mogna hästocyter genom ultraljudstyrd äggupphämtning (OPU) och hur man undersöker kromosomsegregation, spindelmorfologi, global histonacetylering och mRNA-uttryck.

Abstract

Fältet assisterad reproduktion har utvecklats för att behandla infertilitet hos kvinnor, följeslagare och hotade arter. I hästen tillåter assisterad reproduktion också framställning av embryon från högpresterande utan att avbryta sin idrottskarriär och bidrar till en ökning av antalet föl från marer av högt genetiskt värde. Det nuvarande manuskriptet beskriver de förfaranden som används för att samla omogna och mogna oocyter från hästjuvarier med hjälp av äggplockning (OPU). Dessa oocyter användes sedan för att undersöka förekomsten av aneuploidi genom att anpassa ett protokoll som tidigare utvecklats i möss. Speciellt märktes kromosomerna och centromererna av metafas II (MII) -ocyter fluorescens och räknades på sekventiella fokalplaner efter konfokal lasermikroskopskanning. Denna analys avslöjade en högre incidens i aneuploiditetsfrekvensen när omogna oocyter uppsamlades från folliklarna och mognades in vitro jämfört medIn vivo. Immunostaining för tubulin och den acetylerade formen av histon fyra vid specifika lysinrester avslöjade också skillnader i den meotiska spindelens morfologi och i det globala mönstret av histonacetylering. Slutligen undersöktes uttrycket av mRNA som kodar för histon-deacetylaser (HDAC) och acetyltransferaser (HAT) genom omvänd transkription och kvantitativ PCR (q-PCR). Inga skillnader i det relativa uttrycket av transkript observerades mellan in vitro och in vivo mogna oocyter. I överensstämmelse med en allmän tystnad av transkriptionsaktiviteten under oocytmognad kan analysen av det totala transkriptionsmängden endast avslöja mRNA-stabilitet eller nedbrytning. Dessa resultat tyder på att andra översättnings- och posttranslationella regler kan påverkas.

Sammanfattningsvis beskriver den föreliggande studien ett experimentellt tillvägagångssätt för att morfologiskt och biokemiskt karakterisera hästocyten, en ceLl typ som är extremt utmanande att studera på grund av låg tillgänglighet i provet. Det kan dock utöka vår kunskap om reproduktiv biologi och infertilitet hos monovulatoriska arter.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ett brett spektrum av assisterade reproduktionstekniker har utvecklats för att behandla infertilitet hos kvinnor, följeslagare och utrotningshotade arter. Ett av de vanligaste förfarandena i kliniska inställningar är hämtning av metafas II (MII) -stage-oocyter från äggstocksfolliklarna genom ultraljudstyrd transvaginal aspiration, upptagning av ägg (OPU) 1 . Dessa oocyter befruktas sedan in vitro (IVF), med det resulterande embryot (erna) implanterade i en mottagare uterus. MII-stegen (mogna) oocyter hämtas efter administrering av exogena gonadotropiner. Denna behandling är dock associerad, hos vissa patienter, med utvecklingen av ovarie hyperstimuleringssyndrom (OHSS) 2 .

Att utnyttja den inre förmågan hos fullvuxna, omogna oocyter (GV-scenen) för att spontant återuppta meioser, när de en gång är isolerade från deras folliklar, är det möjligt att erhålla mogna oocyter utan adminisGonadotropin 3 . Denna procedur kallas oocyt in vitro mognad (IVM) och representerar en mindre läkemedelsinriktad, billigare och mer patientvänlig inställning till assisterad reproduktiv teknik. Emellertid är framgången med embryonutveckling med in vitro- mättade oocyter generellt lägre än hos in vivo mogna oocyter 4 , 5 . En möjlig förklaring är att in vitro- mogna oocyter påverkas mer av fel i kromosomsegregation, och den resulterande aneuploidin försvårar normal embryonal utveckling 6 .

Förstå den molekylära grunden för kromosomal miss-segregering under IVM skulle i slutändan avslöja den fulla potentialen i denna teknik. I den här venen användes det experimentella tillvägagångssättet för att undersöka de morfologiska och biokemiska egenskaperna hos in vitro- malda oocyter jämfört med in vivo maturEd oocyter beskrivs här 7 , 8 . Specifikt illustreras procedurerna för OPU hos omogna och mogna oocyter och IVM hos omogna oocyter med användning av vuxna och naturligt cyklande hästar som en experimentell modell. Därefter används immunfluorescens och bildanalys för att undersöka kromosomsegregation, spindelmorfologi och det globala mönstret av histonacetylering på dessa gameter. Slutligen beskrivs ett protokoll med omvänt transkription och kvantitativ PCR för analys av mRNA-uttryck.

Jämfört med gnagodjurmodeller tillåter hästar inte genetisk manipulation, är mindre lätt att manipulera, och kräver dyrt underhåll. Emellertid får denna modell ett stort intresse för studien av oocytmognad 9 , 10 på grund av likheten med mänsklig äggstocksfysiologi 11 , 12 </ Sup>. Vidare har utvecklingen av tillförlitliga protokoll för IVM-IVF i hästen ett väsentligt ekonomiskt intresse, eftersom det skulle möjliggöra en ökning av antalet föl från marer med högt genetiskt värde.

En av begränsningarna för att utföra experiment på oocyter, särskilt i monovulatoriska arter, är det begränsade provets tillgänglighet. Denna gräns har övervinnats här genom att justera ett tillvägagångssätt, tidigare utvecklat i möss, till hästocyter 13 , 14 för att utföra kromosomräkning som minimerar provförlusten (se diskussionen för jämförelse med andra tillgängliga tekniker). Vidare har ett triple-fluorescensfärgningsprotokoll optimerats för att utföra flera analyser på samma prov, och q-PCR-analyser utfördes endast på pooler med endast 2 oocyter.

Sammantaget beskriver den föreliggande studien ett experimentellt tillvägagångssätt som syftar till att morfologiskt och biokemiskt chaRacterize hästen oocyt, en celltyp som är extremt utmanande att studera på grund av låg tillgänglighet. Det kan emellertid expandera vår kunskap om reproduktiv biologi och infertilitet hos monovulatoriska arter.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Samtliga förfaranden godkändes av Djurvård och användningskommitté CEEA Val de Loire nummer 19 och utfördes i enlighet med de vägledande principerna för vård och användning av laboratoriedjur.

1. Oocytkollektion och In vitro- mognad

  1. Ovum pickup
    1. Dagligen bedöms med ultraljud diametern hos äggstocksfolliklar i en kohort av vuxna hoppar. Vid framkomst av en follikel ≥33 mm (dominerande follikel) injiceras maren med 1 500 IE av humant koriongonadotropin (hCG) i den övre delen av jugularvenen (iv).
      1. Innan du utför injektionen, svepa området med alkohol, lokalisera den jugulära furan och placera tummen 2-3 cm under injektionsstället för att inducera venen att stiga. Sätt in nålen nästan parallellt med nacken och aspirera för att försäkra dig om att nålen är i venen (blodet kommer in i sprutan). Vid denna tidpunkt injicera; HCG kommer att inducera mAturation av oocyten i den dominerande follikeln.
    2. 35 h efter hCG-injektionen seder maren med detomidin (15 μg / kg, iv), butorfanoltartrat (10 μg / kg, iv) och butylskopolaminbrom (0,2-0,3 mg / kg, 15 ml / mare, iv).
    3. Anslut nålen till ultraljudssonden. Sätt ultraljudssonden vaginalt och håll äggstocken transektalt i ansiktet mot ultraljudssonden. Instruera en operatör att manövrera nålen och den andra för att hålla äggstocken på plats med follikeln mot ultraljudssonden . Börja från äggstocken med den dominerande follikeln.
    4. Punktera vaginalväggen och den dominerande follikelns vägg med nålen (ultraljudsprober för OPU är utrustade med en kanal för nålen ansluten till ett sugsystem); Theneedle kommer att synas i echografisk bild.
    5. Aspirera follikelvätskan i ett 50 ml koniskt rör anslutet till sugsystemet. Häll innehållet i den koniskaRör in i en stor petriskål och sök efter cumulus-oocytkomplexet (COC) med hjälp av ett stereomikroskop.
    6. Eftersom COC inte alltid hämtas med follikelvätskan, spola follikeln med Dulbeccos modifierade fosfatbuffrade saltlösning (DPBS) innehållande 5 IE / ml heparinat 37 ° C. Undersök DPBS för COC-närvaro, som tidigare beskrivits för follikelvätskan i steg 1.1.5. Spola flera gånger tills COC hämtas.
    7. När COC från den dominerande follikeln hämtas, punktera och spola folliklarna ≥5 och ≤25 mm, som beskrivs för den dominerande follikeln i steg 1.1.3-1.1.4; Folliklarna ≥5 och ≤25 uttrycker inte luteiniserande hormon / koriogonadotropinreceptor (LHCGR), och därför kommer deras oocyter inte mogna som svar på hCG och kommer att samlas på GV-stadium (omogen). Håll bara COCs med flera kompletta lager av cumulusceller och brunt, fingranulerat öpplasm. Kassera de andra.
    8. I slutet av OPU, iSkjut maren med bensylpenicillin 15.000 IE / djur för att förhindra infektion.
    9. Huset hoppar i ett lugnt och rent ställe i minst 2 timmar. Kontrollera tecken på medvetenhet genom att bestämma öronens ställning, reaktion på stimuli ( t.ex. ljud) och gång innan du returnerar maren till andra djur.
  2. In vitro mognad
    1. Varm HEPES-buffrad TCM199 (20 mM Hepes) kompletterad med 1,790 IE / L heparin, 0,4% bovint serumalbumin (BSA), penicillin och streptomycin till 37 ° C. Förbered detta medium i förväg. Filtrera-sterilisera och håll det vid 4 ° C i upp till 6 månader.
    2. Förbered IVM-mediet genom att komplettera NaHCO3-buffert TCM199 (25 mM NaHCO3) med 50 ng / ml epidermal tillväxtfaktor (EGF) och 20% kalvserum 7 . Använd NaHCO 3- buffert TCM199 inom 3 veckor efter att ha öppnat en ny flaska. Förbered EGF i förväg som 100x lager, frys den vid -20 ° C, Och använd den inom 6 månader. Dispensera 500 μl i brunnarna i en 4-brunns skål och inkubera i fuktad luft med 5% CO2 vid 38,5 ° C under minst 2 timmar.
    3. Efter hämtning av COC från ≥5 och ≤25 mm folliklar, lägg dem i en petriskål (3,5 cm diameter) fylld med 2 ml HEPES-TCM199. Flytta COC: erna till olika delar av disken för att tvätta bort den cellulära skräpet.
    4. Överför COC: erna till IVM-mediet och inkubera i 28 h i fuktad luft med 5% CO2 vid 38,5 ° C.

2. Immunofluorescens och bildanalys

  1. Kromosomräkning
    1. Efter insamling från den dominerande follikeln eller vid slutet av IVM inkubera COC med 100 μM monastrol i 1 timme i fuktad luft med 5% CO2 vid 38,5 ° C. Förbered monastrol i förväg som 100x lager och förvara den vid -20 ° C i upp till 1 år.
    2. Ta bort cumuluscellernaGenom att behandla dem med 0,5% hyaluronidas eller genom försiktigt pipettering; Ta bort zona pellucida genom att behandla den i 0,2% pronas. Förbered hyaluronidas och pronas i förväg som 10x lager och förvara dem vid -20 ° C i upp till 1 år.
    3. Fixa oocyterna i 4% paraformaldehyd i DPBS i 15 minuter vid 38,5 ° C följt av ytterligare 45 min vid 4 ° C.
      VARNING! Använd personlig skyddsutrustning vid hantering av paraformaldehyd och kassera förorenade material i enlighet med riktlinjer för hantering av farligt avfall.
    4. Tvätta oocyterna genom att överföra i 3 brunnar fyllda med 500 pl DPBS kompletterad med 0,1% polyvinylalkohol (PVA). Permeabilisera i 0,3% Triton X-100 i 10 minuter vid rumstemperatur (RT).
    5. Blockera ospecifik bindning genom inkubation i DPBS kompletterad med 1% bovint serumalbumin (DPBS-1% BSA) och 10% normalt åsnorserum i minst 30 minuter vid RT. Prover kan hållas i blockerande lösning vid 4 ° C i 3-4 dagar.
    6. För primär färgning inkubera oocyterna i kanin-anti-Aurora B-fosfor-Thr232 i DPBS kompletterad med 1% BSA (utspädning 1:50) vid 4 ° C över natten.
    7. Tvätta oocyterna enligt beskrivningen i steg 2.1.4. Inkubera oocyterna i en lösning av tetra-metylrhodaminisotiocyanat (TRITC) -konjugerad åsna-anti-kanin-IgG (1: 100 i DPBS-1% BSA) i 1 timme vid RT i mörkret.
    8. Tvätta oocyterna som beskrivs i steg 2.1.4 och placera sedan 3-4 oocyter i en droppe icke-härdande, fettfri monteringsmedium kompletterad med 20 μM YOPRO1 på en glasskiva. Upprepa proceduren tills alla oocyter är monterade (3-4 oocytes per bild).
    9. Låt oocyterna lösa sig i ca 10 min i monteringsmediet och täcka dem sedan med täckglas. För att undvika att krossa oocyterna applicerar du två remsor av dubbelsidigt band innan du lägger täckglaset på glasskivan.
      OBS! Denna försiktighet kommer också att se till att alla proverna är lika komprimerade mellan glasskivanDe och täckglaset. Glasskivor kan frysas vid -20 ° C och avbildas under de följande 2-3 dagarna.
    10. Bilda proverna på ett konfokal laserskanningsmikroskop med ett 60X-objektiv med hjälp av de röda (centromerer) och gröna (kromosomernas) kanalerna 7 , 13 , 14 , 20 , 21 . Skanna proverna som spänner över hela metafasplattan på z-axeln, med steg varje 0.35 μm. Spara de digitaliserade bilderna av varje enskild plan.
    11. Räkna centromererna i seriella konfokala sektioner med hjälp av cellräkningsfunktionen för NIH ImageJ-programmet (tillgänglig på: https://imagej.nih.gov/ij/plugins/cell-counter.html).
      OBS: Undvik ett upprepat antal centromerer som visas på närliggande avsnitt genom att identifiera de centromerer som visas, stanna och försvinner i sekventiella sektioner med en numerisk kod.
    12. Upprepa det kromosomala coUnting i steg 2.1.11 med en oberoende operatör.
      OBS: Klassificera oocyterna som euploid (32 kromosomer), hyperploid (> 32) eller hypoploid (<32).
  2. Spindelmorfologi och histonacetylering
    1. Efter insamling från den dominerande follikeln eller vid slutet av IVM, avlägsna cumuluscellerna genom behandling i 0,5% hyaluronidas eller genom försiktig pipettering, såsom beskrivs i steg 2.1.2.
    2. Tvätta oocyterna i DPBS-PVA, som i steg 2.1.4, och fixa dem i 2,5% paraformaldehyd under 20 minuter vid 38 ° C. Tvätta i stor utsträckning som beskrivet i steg 2.1.4 och permeabilisera i 0,1% Triton X-100 i 5 minuter vid RT.
      OBSERVERA: Använd personlig skyddsutrustning vid hantering av paraformaldehyd och kassera förorenade material i enlighet med riktlinjer för hantering av farligt avfall.
    3. Blockera ospecifik bindning vid inkubation i DPBS kompletterat med 2% bovint serumalbumin (DPBS - 2% BSA), 0,05% saponin och 10% normalt åsnor serum foR 2 h vid RT.
      OBS: Prov kan hållas i blockeringslösning vid 4 ° C i 3-4 dagar.
    4. För primär färgning inkubera oocyterna i mus anti-alfa-tubulin (1: 150) och kanin anti-acH4K16 (1: 250) i DPBS-2% BSA med 0,05% saponin vid 4 ° C över natten.
    5. Tvätta oocyterna som i steg 2.1.4. Inkubera oocyterna i en lösning av grönt fluorescerande färgämne-konjugerat åsnor-anti-mus-IgG (1: 500) och TRITC-konjugerat åsnor-anti-kanin-IgG (1: 100) i DPBS-2% BSA med 0,05% saponin i 1 timme vid RT i mörkret.
    6. Tvätta oocyterna som i steg 2.1.4 och placera sedan 3-4 oocyter i en droppe av det icke-härdande, antifärgsmonteringsmedlet kompletterat med 1 μg / ml 4-dia-diidino-2-fenylindol (DAPI) På en glasskiva.
    7. Montera oocyterna på glasskivor enligt beskrivningen i steg 2.1.8.
    8. Bilda proverna på ett konfokal laserskanningsmikroskop med ett 60x-objektiv med hjälp av de röda (acH4K16), gröna (alfa-tubulin) och blå (DNA) kanalerna.
      OBS! Håll laserinställningarna för de röda och blåa kanalerna konstanta under hela förvärvet av alla prover. Skanna proverna som spänner över hela meiotiska spindeln och metafasplattan på z-axeln, med steg varje 0.35 μm. Spara de digitaliserade bilderna (enskilda planer och projicerade 3D-bilder).
    9. Mät polspolens spindellängd och spindeldiametern vid den maximala bredden på den projicerade bilden med hjälp av mätfunktionen för NIH ImageJ-programmet (https://imagej.nih.gov/ij/docs/guide/146-30 .html). Upprepa var 3 gånger och beräkna medelvärdet.
    10. Kvantifiera den relativa fluorescensen av acH4K16 med hjälp av den integrerade täthetsfunktionen i NIH ImageJ-programmet (https://imagej.nih.gov/ij/docs/guide/146-30.html). Normalisera den för den integrerade densiteten av DAPI-färgningen.

3. Analys av mRNA-uttryck

  1. När COCs har hämtats från 5 till 25 mm folliklar samlas granulosa cell sUspension som förblev i petriskålen och tvätta den två gånger i kall DPBS genom centrifugering vid 10 600 xg under 2 min. Snapfrys i flytande kväve. Förvara proverna vid -80 ° C i upp till 6 månader; Cellerna kommer att fungera för standardkurvan.
  2. Ta försiktigt bort alla cumulusceller, som beskrivs i steg 2.1.2, från omogna (GV), in vitro mognade och in vivo mogna oocyter.
  3. Tvätta oocyterna, som beskrivs i 2.1.4, i DPBS-PVA, samla dem enbart i 1 μl volymer och lägg 2 μL RNALater på toppen. Snapfrysning i flytande kväve. Förvara provet vid -80 ° C i upp till 6 månader.
  4. Tillsätt 2 pg Luciferase RNA till varje prov som en spik-in. Poola oocyterna 2 x 2 och extrahera det totala RNA med användning av ett silikamembranfilterbaserat kit som är lämpligt för att återvinna RNA från små prov.
  5. Reverse-transkribera RNA i 10 | il med 0,25 | jg slumpmässiga hexamerer och Moloney leukemivirus omvänd transkriptas under 1 timme vid 37 & # 176; C. Förvara provet vid -20 ° C i upp till 6 månader.
  6. Späd cDNA från granulosa cellerna i RNAsefritt vatten till 50 ng / μl. Seriellt späd denna lösning 1:10 för att erhålla 5 ng / μl, 0,5 ng / μl, 0,05 ng / μl och 0,005 ng / μl lösningar.
  7. Sammansätt reaktioner i triplicat i en total volym av 20 | il per reaktion med användning av cDNA ekvivalent med 0,05 oocyter som substratet eller 5 | il av serieutspädningarna av granulosacell cDNA, 10 | il SYBR grön supermix och 0,3 | iM av varje specifik primer Tabell 1 ).
  8. Kör reaktionen i en termisk cykler med användning av ett 3-stegs protokoll: 95 ° C i 30 s, 60 ° C i 30 s och 72 ° C i 20 s, upprepad 40 gånger. Slutligen förvärva smältkurvan från 60 ° C och öka temperaturen med 0,5 ° C var 20: e sekund upp till 95 ° C.
  9. Bedöm startkvantiteten (SQ) för det specifika mRNA i oocytproverna med hjälp av standardkurvanF "> 15 beräknat baserat på granulosa cellprovet. Uttryck data som förhållandet mellan SQ av genen av intresse och SQ hos hushållsgenerna.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De ursprungliga resultaten av dessa experiment beskrivs på djupet tidigare 7 och rapporteras häri som ett exempel på resultat som kan erhållas med användning av de beskrivna protokollen.

Mognadshastighet

Av de 32 COC som erhölls av OPU från dominerande folliklar var 28 (88%) vid MII-scenen. Fjorton av de 58 COC som samlats in från folliklarna 5-25 mm i storlek snäppades omedelbart som omogna oocyter för mRNA-expressionsstudien. De återstående 44na mognades in vitro och 37 nådde MII-steget (85%). Effektiviteten av mognad var inte signifikant olika i de två grupperna (Fishers exakta test P> 0,05).

Aneuploidy rate

För att studera huruvida IVM caN stör den troliga kromosompartitioneringen mellan den sekundära oocyten och den första polära kroppen räknades antalet kromosomer vid MII-steget, eftersom det representerar resultatet av kromosomsegregation under meios I. Såsom visas i Figur 1A , bekräftar anti-Aurora B Fosfat-Thr232 antikropp färgade specifikt den centromera regionen i hästocyter, så att man kunde räkna antalet kromosomer. In vitro- mognade oocyter var signifikant mer påverkad av aneuploidi (5/11) jämfört med in vivo mognade oocyter (0/12; Fishers exakta test, P <0,05; Figur IB ). De flesta aneuploida oocyterna (4/5) var hyperploida; Därför kommer aneuploiditetshastigheten inte från artefakter vid beredningen av den provbestämande kromosomala förlusten, vilket händer med kromosomala sprängor. Immunostaining av den centromeriska regionen försökades också med anti-CENPA- och anti-AURKB-antikropparna, men ingen signal var visUaliserades i båda fallen (data visas ej).

Spindelmorfologi och acetylering av H4K16

Pol-till-polig spindellängd och spindelns diameter vid maximal bredd mättes, såsom visas i figur 2 . Enligt dessa mätningar var in vitro- mättade oocyter signifikant längre (19,89 ± 1,15 μm) och bredare (17,28 ± 0,81 μm) jämfört med in vivo mognade oocyter (14,57 ± 1,7 μm i längd och 13,56 ± 0,91 μm i diameter, upplösning t -test, P <0,05). På samma prover mättes även den globala acetyleringsnivån av H4K16, vilket bekräftar att acetylering vid H4K16 var signifikant lägre i IVM-oocyter jämfört med deras in vivo motsvarigheter ( Figur 2 , röd).

Uttryck av tranSkript som kodar för histon-acetyltransferaser och deacetylaser

Huruvida uttrycket av gener som är involverade i histon-acetylerings-deacetyleringsprocessen förändrades i in vitro- malda oocyter undersöktes med q-PCR. Histon-acetyltransferas 1 ( HATl ), K-acetyltransferas 8 (KAT8 ), histon-deacetylas 1 ( HDACl ) och NAD-beroende proteindeacetylas sirtuin 1 ( SIRT1 ) identifierades som förmodade mål. Betydande skillnader i uttrycket av dessa transkript i omogna, in vitro mognade och in vivo mogna oocyter observerades ej oberoende av den använda normaliseringen. Specifikt beräknades resultaten av transkriptionsuttrycksanalysen som rapporterades i figur 3 mot en standardkurva med användning av SQ-metoden och normaliserades för hushållning av glyceraldehyd-3-fosfatdehydrogenas ( GAPDH ). På liknande sätt, ingen skillnadRencer observerades när resultaten var normaliserade för spetsen i luciferas eller när AΔct-metoden användes (ej visad).

Mål Fw primer Rv-primer Amplicon-storlek
GAPDH ATCACCATCTTCCAGGAGCGAGA GTCTTCTGGGTGGCAGTGATGG 241 bp
hat1 CTGACATGAGTGATGCTGAACA TAACGCGTCGGTAATCTTCC 219 bp
HDAC1 GAAGGCGGTCGCAAGAAT CCAACTTGACCTCCTCCTTGA 166 bp
KAT8 ACTGGTCTTGGGTCCTGCTG GGGCACTTTTGAGGTGTTCC 198 bp
luciferas TCATTCTTCGCCAAAAGCACTCTG d> AGCCCATATCCTTGTCGTATCCC 148 bp
SIRT1 GACTCGCAAAGGAGCAGATT GGACTCTGGCATGTTCCACT 169 bp

Tabell 1: Primer Setails. 5'> 3 '-sekvensen av de främre (Fw) och (Rv) -primrarna och den förväntade ampliconstorleken ges för varje transkriptanalys: glyceraldehyd-3-fosfatdehydrogenas ( GAPDH ) , histonacetyltransferas 1 ( HAT1 ) , histon Deacetylas 1 ( HDACl ) , K-acetyltransferas 8 ( KAT8 ) , luciferas och NAD-beroende proteindeacetylas sirtuin 1 ( SIRT1 ). Reprinted med tillstånd från referens 7 .

/55242fig1.jpg "/>
Figur 1: Aneuploidy Rate In In Vivo och In Vitro- Matured Horse Oocytes. ( A ) Representativa bilder som visar aurora B fosfon-Thr232 (röd) och DNA (grön) färgning av en MII-stegshästsoocyt behandlad med monastrol. En euploid oocyt (32 kromosomer) visas. Skala bar = 5 μm. ( B ) Stångdiagrammet representerar fördelningen av euploida och aneuploida MII-stegsocyter i in vivo (n = 12) och in vitro (n = 11) mogna oocyter. * Indikerar en signifikant skillnad i aneuploiditetsfrekvensen (Fishers exakta test, P <0,05). Reprinted med tillstånd från Referens 7. Vänligen klicka här för att se en större version av denna figur.

Figur 2 Figur 2: Spindelmätning och H4K16-acetylering i Vivo- och In Vitro- maturerade hästocyter. Representativa bilder som visar tubulin (grön), acetylerad H4K16 (röd) och DNA (blå) i MII-oocyter efter in vivo (n = 4) eller in vitro (n = 14) mognad. Tubulinbilderna visar axlarna som används för spindellängd och diametermätningar. Skala bar = 5 μm. Ändrad från referens 7 . Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Uttryck av KAT8 , SIRT1 , HAT1 , Och HDAC1 i ImmatuRe, in vivo Och In Vitro Matured Oocyter. Stångdiagrammen representerar medelvärdet ± SEM för det relativa mRNA-uttrycket av KAT8 , SIRT1 , HAT1 , Och HDAC1 , Uttryckt som startkvantitet (SQ) för transkriptet av intresse jämfört med SQ av GAPDH , som användes som hushållning. Inga statistiska skillnader observerades mellan omogna (GV, n = 14), in vivo (n = 14) och in vitro (n = 12) mogna oocyter (envägs ANOVA, P > 0,05). Reprinted med tillstånd från referens 7 . Vänligen klicka här för att se en större version av denna figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Trots att IVM har utförts på hästar i över 20 år 16 , vet vi inte om oocyten kan vara ursprunget till embryonal aneuploidi, vilket har föreslagits för människor 17 . Anledningen är förmodligen att beredningen av oocytspridningar för kromosomräkning resulterar i avsevärd provförlust. Med detta i åtanke genomfördes en undersökning av metoderna för undersökning av fel i kromosomsegregation för att söka efter den lämpligaste tekniken för att applicera på hästocyter. Fyra huvudtekniker fanns i den vetenskapliga litteraturen: 1) kromosomala spridningar 5 , 18 , 19 , 2) fluorescerande in situ- hybridisering (FISH) 4 , 6 , 17 , 20 , 3) centromere räknar på monastrol-kollapsade spindlar , 14 , 21 , 22 och 4) kromosom fluorescensfärgning utan kromosomräkning 23 , 24 , 25 .

Som redan nämnts komprimeras beredningen av kromosomala spridningar följt av Giemsa-färgning av en hög grad av provförlust. Denna metod har i många fall ersatts av FISH, som använder specifika sonder för att kartlägga olika kromosomer. En nackdel med FISH-tekniker är att när ett litet antal sonder används kan incidensen av en falsk negativ öka ( dvs. identifiera som normalt en cell som är aneuploid eftersom den saknade eller supernumerära kromosomen inte har undersökts). Den tillförlitliga användningen av FISH baseras därför i stor utsträckning på kunskapen a priori av kromosomerna som oftare påverkas av aneuploidi ( t.ex.., Kromosom 21 hos människor). FISH har tidigare använts för att undersöka kromosomala abnormiteter i hästembryon med 2 prober mot kromosom 2 och kromosom 4 20 . Enligt dessa experiment är kärnorna av in vitro- producerade embryon mer benägna att påverkas av kromosomala abnormiteter än in vivo producerade embryon. Detta resultat är överens med den ovan angivna observationen med användning av monastrol-kollapsmetoden i IVM-oocyter. Förekomsten av aneuploidi i IVM-oocyter var emellertid ännu högre än den som rapporterades med användning av FISH i in vitro- producerade embryon 20 . Denna partiella skillnad kan förklaras av det faktum att endast två kromosomspecifika sonder användes för FISH-experimenten. Detta tillvägagångssätt kan ha underskattat förekomsten av aneuploidi med andra kromosomer, speciellt när man funderar på att hästar har 32 kromosomer. Det kan emellertid inte uteslutas att allvarlig aneuPloider som kan påvisas i oocyterna upprätthålls inte i embryon eftersom gameter som påverkas av kritiska genetiska abnormiteter eventuellt inte utvecklas vidare.

Kombinationen av monastrolbehandling, kromosom och centromerfärgning och konfokalmikroskopi tillåts för konsekventa räkningar av kromosomtalet i MII-stegshästocyter med minimal provförlust. Den tekniska begränsningen som uppstod vid utvecklingen av denna teknik för hästocyter var tillgängligheten av hästspecifika antikroppar. Innan Aurora B fosfor (Thr232) användes, producerade två andra antikroppar (anti-Aurora B och anti-CENPA) inte en centromerisk fläck. I synnerhet har anti-Aurora B och anti-CENPA redan framgångsrikt använts i nötkreatur och humana celler 26 , 27 , 28 ; Därför drogs slutsatsen att de inte var specifika för hästen. Denna teknik kan också begränsas av tillgången på en konfokal laser scAnningmikroskop och bildanalysprogramvara. Också blindräkning av två oberoende operatörer är väsentlig för att utesluta operatörsinducerad artefakter. Även om kromosomaltalet hos en monastrol-kollapsad spindel är ett tillvägagångssätt som bättre bevarar cellens morfologi och förhindrar provförlust tillåter denna teknik endast observation av skillnader i det grundläggande antalet kromosomer; Det är inte informativt om andra kromosomala abnormiteter ( t.ex. translokationer, segmentintervall etc. ) som i stället kan avslöjas genom karyotypning och i vissa fall av FISH.

Fel i kromosomsegregation har också undersökts genom spindel- och kromosomimmunfluorescens, utan att utföra ett kromosomtal 23 , 24 , 25 . I detta fall anses spindlar med svåra anomalier och fördröjning eller spridda kromosomer tecken på oregelbunden chromosoMig segregering. Följaktligen observerades kromosomer som utspridda ur spindeln i in vitro mognade oocyter 7 (den klass som är mer sannolikt påverkad av aneuploidi). Men kromosomräkning har fördelen att överföra kvantifierbar information.

För att sammanfatta, jämfört med de andra beskrivna teknikerna, har användningen av monastrol och centromerfärgning fördelen att förhindra provförlust, minimera incidensen av falska negativa och kvantifierbara.

Ändringen av de epigenetiska modifieringarna har föreslagits som en möjlig mekanism vid uppkomsten av oocyt-aneuploidi 18 , 24 , 25 . Med hjälp av en trippel fluorescerande fläck kunde man visualisera och mäta den meotiska spindeln och observera slaktade / spridda kromosomer. Samtidigt tack vare utvecklingen av antikroppar somKänner igen specifika restmodifieringar, genomfördes acetyleringsnivån av H4K16 på samma prov. Detta tillvägagångssätt tjänade dubbelt syfte att minska mängden oocyter som var nödvändiga för analysen och korrelera H4-acetylering med spindelens morfologi.

Kvantifieringen av kovalenta proteinmodifieringar kan utföras med Western blot. Denna teknik kräver emellertid en större proverstorlek och bevarar inte provets integritet för morfologiska studier. Det tredubbla fluorescerande färgningsförfarandet kan appliceras på andra histon-modifikationer och eventuellt till vilket protein som helst som kan kännes igen av olika sekundära antikroppar 8 ; Den enda begränsande faktorn är tillgängligheten av hästspecifika antikroppar. I detta sammanhang hoppas författarna att uppmärksamheten på hästmodellen kommer att öka intresset för undersökningen av grundläggande biologiska mekanismer i denna art och därför i utvecklingsprocessenEnt av dedikerade verktyg.

Slutligen beskrivs även expressionsstudien av mRNA som kodar för histon-deacetylaser (HDAC) och acetyltransferaser (HAT) utförda genom omvänd transkription och kvantitativ PCR (q-PCR). Q-PCR är en brett spridd teknik; Dess användning för hästocyter är emellertid inte diffus. Det är väsentligt att specificera att på grund av den allmänna tystnaden av transkriptionsaktivitet under oocytmognad 29 kan analysen av det totala transkriptionsmängden endast avslöja mRNA-stabilitet eller nedbrytning i denna bakgrund 30 , 31 . Skillnader i det relativa uttrycket av transkript mellan in vitro och in vivo mognad observerades ej. Dessa resultat tyder på att översättnings- och posttranslationella regler kan påverkas av IVM, påpekar behovet av utveckling av andra experimentella metoder som syftar till att undersöka translations- och poSt-translationella mekanismer vid encells-nivån.

Sammanfattningsvis beskriver föreliggande studie ett experimentellt tillvägagångssätt för att morfologiskt och biokemiskt karakterisera hästocyter. Denna metod kan tillämpas på oocyter av andra arter som påverkas på liknande sätt av en låg återhämtningsgrad, inklusive människor eller hotade arter. Dessa studier kommer att öka vår kunskap om reproduktionsbiologi från däggdjur och bidra till vår förståelse av infertilitet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgments

Författarna skulle vilja tacka Fabrice Vincent för supporten med laserscanning-konfokal mikroskopi (LSCM) , och Philippe Barrière och Thierry Blard för att utföra daglig ultraljud ovariescanning och hCG-injektion. Detta arbete stöddes delvis av projektet "Regione Sardegna och Regione Lombardia" "Ex Ovo Omnia" (bidrag nr 26096200 till AML). "L'Oreal Italia per le Donne e la Scienza 2012" gemenskap (kontrakt 2012 till FF), FP7-PEOPLE-2011-CIG, forskningsförvaltningsbyrån (REA) "Pro-Ovum" (bidrag nr 303640 till VL) Och av doktorandskolan för jordbruk och veterinärmedicin, medfinansierad av Europeiska socialfonden, sektors operativt program för mänsklig resursutveckling 2007-2013 (kontrakt nr POSDRU / 89 / 1.5 / S / 62371 till IM). In vivo- oocytkollektionen finansierades av Institut Français du Cheval et de l'Equitation.

Materials

Name Company Catalog Number Comments
ultrasound probe Aloka UST-5820-7,5
human chorionic gonadotrophin centravet CHO004 1,500 unit/animal IV
detomidine centravet MED010 9 - 15 µg/kg IV
butylscopolamine bromure centravet EST001 0.2 mg/kg IV
stereomicroscope NIKON SMZ-2B
butorphanol centravet DOL003 10µg/kg IV
benzyl-penicillin centravet DEP203 IM 15,000 UI/animal
TCM199 Sigma-Aldrich M3769 10X1L powder for hepes-buffered TCM199
Hepes sodium salt Sigma-Aldrich H3784-100G
bovine serum albumin Sigma-Aldrich A8806
heparin  Sigma-Aldrich H3149-10KU
NaHCO3-buffered TCM199 Sigma-Aldrich M2154-500ML liquid for IVM medium
epidermal growth factor Sigma-Aldrich E4127
newborn calf serum Sigma-Aldrich N4762-500ML
4-well dishes NUNCLON 144444
incubator Heraeus BB6060
monastrol Sigma-Aldrich M8515
hyaluronidase Sigma-Aldrich H3506
pronase Sigma-Aldrich P5147
paraformaldehyde Sigma-Aldrich P6148
polyvinyl alcohol Sigma-Aldrich 341584
triton-X 100 Sigma-Aldrich T8787
normal donkey serum Sigma-Aldrich D9663
rabbit anti-Aurora B phospho-Thr232 BioLegend 636102
TRITC-conjugated donkey anti-rabbit IgG Vector Laboratories 711-025-152
Vecta-Shield Vector Laboratories H-1000
YOPRO1 Thermofisher Scientific Y3603
confocal laser scanning microscope LSM 780 Zeiss
confocal laser scanning microscope LSM 700 Zeiss
ImageJ software rsb.info. nih.gov/ij/download.html free resource
mouse anti-alpha-tubulin Sigma-Aldrich T8203
rabbit anti-acH4K16 Upstate Biotechnology 07-329
AlexaFluor 488-coniugated donkey anti-mouse IgG Life Technologies A21202
4’,6-diamidino-2-phenylindole Sigma-Aldrich D8417 DAPI
centrifuge Eppendorf 5417R
RNALater Invitrogen AM7020
Luciferase RNA Promega L4561
PicoPure RNA Isolation Kit Applied Biosystems 12204-01
random hexamers Thermofisher Scientific N8080127
mouse Moloney leukaemia virus reverse transcriptase Thermofisher Scientific 28025013
SYBR green supermix BioRad 1708880
specific primers Sigma-Aldrich specific primers were designed using Primer3Plus software (free resource)
thermal-cycler BioRad MyiQ
mouse monoclonal anti-CENPA Abcam ab13939
mouse monoclonal anti-Aurora B Abcam ab3609

DOWNLOAD MATERIALS LIST

References

  1. Dellenbach, P. Transvaginal, sonographically controlled ovarian follicle puncture for egg retrieval. Lancet. 1, (8392), 1467 (1984).
  2. Humaidan, P. Ovarian hyperstimulation syndrome: review and new classification criteria for reporting in clinical trials. Hum Reprod. (2016).
  3. Pincus, G., Enzmann, E. V. The Comparative Behavior of Mammalian Eggs in Vivo and in Vitro : I. The Activation of Ovarian Eggs. J Exp Med. 62, (5), 665-675 (1935).
  4. Emery, B. R., Wilcox, A. L., Aoki, V. W., Peterson, C. M., Carrell, D. T. In vitro oocyte maturation and subsequent delayed fertilization is associated with increased embryo aneuploidy. Fertil Steril. 84, (4), 1027-1029 (2005).
  5. Nichols, S. M., Gierbolini, L., Gonzalez-Martinez, J. A., Bavister, B. D. Effects of in vitro maturation and age on oocyte quality in the rhesus macaque Macaca mulatta. Fertil Steril. 93, (5), 1591-1600 (2010).
  6. Requena, A. The impact of in-vitro maturation of oocytes on aneuploidy rate. Reprod Biomed Online. 18, (6), 777-783 (2009).
  7. Franciosi, F. In vitro maturation affects chromosome segregation, spindle morphology and acetylation of lysine 16 on histone H4 in horse oocytes. Reprod Fertil Dev. (2015).
  8. Franciosi, F. Changes in histone H4 acetylation during in vivo versus in vitro maturation of equine oocytes. Mol Hum Reprod. 18, (5), 243-252 (2012).
  9. Choi, Y. H., Gibbons, J. R., Canesin, H. S., Hinrichs, K. Effect of medium variations (zinc supplementation during oocyte maturation, perifertilization pH, and embryo culture protein source) on equine embryo development after intracytoplasmic sperm injection. Theriogenology. (2016).
  10. Hendriks, W. K. Maternal age and in vitro culture affect mitochondrial number and function in equine oocytes and embryos. Reprod Fertil Dev. 27, (6), 957-968 (2015).
  11. Carnevale, E. M. The mare model for follicular maturation and reproductive aging in the woman. Theriogenology. 69, (1), 23-30 (2008).
  12. Ginther, O. J. The mare: a 1000-pound guinea pig for study of the ovulatory follicular wave in women. Theriogenology. 77, (5), 818-828 (2012).
  13. Chiang, T., Duncan, F. E., Schindler, K., Schultz, R. M., Lampson, M. A. Evidence that weakened centromere cohesion is a leading cause of age-related aneuploidy in oocytes. Curr Biol. 20, (17), 1522-1528 (2010).
  14. Duncan, F. E., Chiang, T., Schultz, R. M., Lampson, M. A. Evidence that a defective spindle assembly checkpoint is not the primary cause of maternal age-associated aneuploidy in mouse eggs. Biol Reprod. 81, (4), 768-776 (2009).
  15. Larionov, A., Krause, A., Miller, W. A standard curve based method for relative real time PCR data processing. BMC Bioinformatics. 6, (62), (2005).
  16. Choi, Y. H., Hochi, S., Braun, J., Sato, K., Oguri, N. In vitro maturation of equine oocytes collected by follicle aspiration and by the slicing of ovaries. Theriogenology. 40, (5), 959-966 (1993).
  17. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  18. Akiyama, T., Nagata, M., Aoki, F. Inadequate histone deacetylation during oocyte meiosis causes aneuploidy and embryo death in mice. Proc Natl Acad Sci U S A. 103, (19), 7339-7344 (2006).
  19. Homer, H. A. Mad2 prevents aneuploidy and premature proteolysis of cyclin B and securin during meiosis I in mouse oocytes. Genes Dev. 19, (2), 202-207 (2005).
  20. Rambags, B. P. Numerical chromosomal abnormalities in equine embryos produced in vivo and in vitro. Mol Reprod Dev. 72, (1), 77-87 (2005).
  21. Nabti, I., Marangos, P., Bormann, J., Kudo, N. R., Carroll, J. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity. J Cell Biol. 204, (6), 891-900 (2014).
  22. Shomper, M., Lappa, C., FitzHarris, G. Kinetochore microtubule establishment is defective in oocytes from aged mice. Cell Cycle. 13, (7), 1171-1179 (2014).
  23. Luzzo, K. M. High fat diet induced developmental defects in the mouse: oocyte meiotic aneuploidy and fetal growth retardation/brain defects. PLoS One. 7, (11), e49217 (2012).
  24. Ma, P., Schultz, R. M. Histone deacetylase 2 (HDAC2) regulates chromosome segregation and kinetochore function via H4K16 deacetylation during oocyte maturation in mouse. PLoS Genet. 9, (3), e1003377 (2013).
  25. Yang, F., Baumann, C., Viveiros, M. M., De La Fuente, R. Histone hyperacetylation during meiosis interferes with large-scale chromatin remodeling, axial chromatid condensation and sister chromatid separation in the mammalian oocyte. Int J Dev Biol. 56, (10-12), 889-899 (2012).
  26. Luciano, A. M. Oocytes isolated from dairy cows with reduced ovarian reserve have a high frequency of aneuploidy and alterations in the localization of progesterone receptor membrane component 1 and aurora kinase B. Biol Reprod. 88, (3), 58 (2013).
  27. Luciano, A. M., Lodde, V., Franciosi, F., Ceciliani, F., Peluso, J. J. Progesterone receptor membrane component 1 expression and putative function in bovine oocyte maturation, fertilization, and early embryonic development. Reproduction. 140, (5), 663-672 (2010).
  28. Terzaghi, L. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis. Cell Cycle. 1-14 (2016).
  29. Susor, A., Jansova, D., Anger, M., Kubelka, M. Translation in the mammalian oocyte in space and time. Cell Tissue Res. 363, (1), 69-84 (2016).
  30. Chen, J. Genome-wide analysis of translation reveals a critical role for deleted in azoospermia-like (Dazl) at the oocyte-to-zygote transition. Genes Dev. 25, (7), 755-766 (2011).
  31. Ma, J., Flemr, M., Strnad, H., Svoboda, P., Schultz, R. M. Maternally recruited DCP1A and DCP2 contribute to messenger RNA degradation during oocyte maturation and genome activation in mouse. Biol Reprod. 88, (1), 11 (2013).
Analys av kromosomsegregation, histonacetylering och spindelmorfologi i hästocyter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).More

Franciosi, F., Tessaro, I., Dalbies-Tran, R., Douet, C., Reigner, F., Deleuze, S., Papillier, P., Miclea, I., Lodde, V., Luciano, A. M., Goudet, G. Analysis of Chromosome Segregation, Histone Acetylation, and Spindle Morphology in Horse Oocytes. J. Vis. Exp. (123), e55242, doi:10.3791/55242 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter